CN113136394A

CN113136394A - Expression vector of membrane protein CcmB and expression purification method thereof

Info

Publication number: CN113136394A
Application number: CN202010048422.1A
Authority: CN
Inventors: 周敏; 张苑桢; 华铮翼; 卢颖洪
Original assignee: Nanjing University of Science and Technology
Current assignee: Nanjing University of Science and Technology
Priority date: 2020-01-16
Filing date: 2020-01-16
Publication date: 2021-07-20

Abstract

The invention discloses an expression vector of a membrane protein CcmB and an expression and purification method thereof. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises: the bacteriophage T7 promoter; an escherichia coli ribosome binding site which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein CcmB sequence shown in SEQ ID NO.1 and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; NdeI restriction site CATATG; a hyper-folding Venus fluorescent protein coding sequence; XhoI cleavage site CTCGAG; 6 histidine sites and the stop codon TAG. The invention uses the fluorescent protein with rigid molecules as a screening marker and an expression process indicator, and the fluorescent protein can be quickly folded due to the rigid structure with molecular level, and can help the nitrogen-terminal membrane protein Ccmc to stabilize the conformation. The expression vector constructed by the invention can realize the mass expression of the membrane protein Ccmc, and can be used for the high-throughput screening of the subsequent novel antibiotics.

Description

Expression vector of membrane protein CcmB and expression purification method thereof

Technical Field

The invention belongs to the technical field of protein production, and relates to an expression vector of a membrane protein heme secretory protein B subunit (Ccmc) and an expression and purification method thereof.

Background

The cell membrane is the boundary between the inside and the outside of the cell, is an important organelle, and plays important roles in information transfer, energy transmission and material exchange. The target of the drug action is often located on the cell membrane. It is currently known that more than 50% of the targets for drug action are membrane proteins. Therefore, the method has very important significance for the research of the membrane protein.

However, since the membrane protein has a few natural states and a multi-transmembrane structure, the membrane protein is easy to be folded mistakenly and has a complex structure, and thus, the large-scale preparation of the membrane protein is always a difficult point and a hot point. In China, no biological company can express transmembrane proteins for more than 12 times, and only one or two companies can express transmembrane proteins for four times.

Coli has been the first choice for protein expression as a commonly used expression host, however, even the proteins of e.coli themselves are difficult to express in large amounts in e.coli. Currently, abuse of antibiotics causes a dilemma that the antibiotics cannot resist drug-resistant bacteria within 50 years. Therefore, a great amount of expression membrane protein is used as an action target of the antibiotic, and a pilot technical support is provided for the high-throughput screening of the subsequent non-denaturing mass spectrum.

Disclosure of Invention

The invention aims to provide an expression vector for expressing a large amount of membrane protein heme secretion protein B subunit (Ccmc) and an expression and purification method thereof. The invention establishes a high-efficiency fusion expression system aiming at the escherichia coli membrane protein CcmB, and can be used for the subsequent further research on the non-denatured real-time monitoring mass spectrum of the protein.

The technical scheme for realizing the purpose of the invention is as follows:

the expression vector of the membrane protein Ccmc takes the hyper-folding Venus fluorescent protein (Chinese patent application 201910347575.3) which is obtained in the laboratory and used for positioning the Chlamydomonas reinhardtii protein as an initial protein skeleton, and obtains a fluorescent protein expression label with rigid molecules by further optimizing the composition of codons used for sequence expression, and is suitable for large-scale expression of the Escherichia coli membrane protein. The invention utilizes the fluorescent protein with rigid molecules as a screening marker and an expression process indicator, and the fluorescent protein can be quickly folded due to the rigid structure with molecular level and helps the nitrogen-terminal membrane protein Ccmc to stabilize the conformation.

The expression vector of the membrane protein CcmB is expression plasmid pLy077-CcmB (SEQ ID NO.2), and comprises: the bacteriophage T7 promoter; an Escherichia coli ribosome binding site comprising an NcoI sequence CCATGG, an Escherichia coli membrane protein CcmB sequence (SEQ ID NO.1) and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; NdeI restriction site CATATG; a hyper-folding Venus fluorescent protein coding sequence; XhoI cleavage site CTCGAG; 6 histidine sites and the stop codon TAG.

The invention also provides an expression and purification method of the expression vector of the membrane protein Ccmc, which comprises the following specific steps:

step 1, preparing an escherichia coli membrane protein CcmB expression vector mutant strain: transforming an expression vector of the membrane protein CcmB, namely expression plasmid pLy077-CcmB into host escherichia coli, coating the host escherichia coli on an agar plate containing antibiotics and 0.1mM IPTG, and selecting yellow-green positive monoclonal bacteria for amplification culture and induced expression;

and 2, inoculating the selected mutant strain transformant into a culture medium for amplification culture, and carrying out large-scale induction expression on the membrane protein Ccmc by using 1mM IPTG.

Preferably, in step 1, the Escherichia coli is Escherichia coli BL21(DE3) or Escherichia coli C43(DE 3).

Preferably, in step 2, the culture medium is an LB culture medium or a TB culture medium.

The invention introduces the target gene and the codon optimized hyper-folding Venus fluorescent protein with molecular rigidity into the expression vector by fully synthesizing the expression vector, and greatly improves the transcription and translation efficiency of the target gene by optimizing the primary sequence of the nucleic acid coding. In addition, the folding speed of the carboxyl-terminal rigid fluorescent protein is controlled, so that the target membrane protein is helped to be correctly folded and inserted into the membrane. The rigid fluorescent protein can be used for monitoring the real-time expression process of the protein and protecting the carboxyl terminal of the protein, so that the target protein is enriched. The invention realizes high-flux screening of novel antibiotics through mass expression and later purification of escherichia coli membrane protein, and has important commercial prospect.

Drawings

FIG. 1 is a diagram showing the result of PCR agarose gel electrophoresis of the CcmB protein coding sequence.

FIG. 2 is a schematic structural diagram of the pLy077-CcmB plasmid.

FIG. 3 is a diagram showing the results of PCR verification of pLy077-CcmB colonies.

FIG. 4 shows the results of single-restriction double-restriction agarose gel electrophoresis of plasmid pLy077-CcmB with NcoI and BamHI.

FIG. 5 is a diagram showing the results of sequencing verification of the recombinant plasmid.

FIG. 6 is a graph of the growth of pLy 077-Ccmc in different expression strains and media.

FIG. 7 is a fluorescence image of colonies on transformed agar plates.

FIG. 8 is fluorescence imaging after induction in LB medium and comparison of whole bacterial proteins before and after induction, using Escherichia coli BL21 as expression strain.

FIG. 9 is fluorescence imaging after induction in TB medium and comparison of total mycoprotein before and after induction using Escherichia coli C43 as expression strain.

Detailed Description

The invention will be further described with reference to specific embodiments and figures, but is not limited thereto. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited.

The materials used in the examples are as follows:

1. cell source

Coli strains DH5 α, BL21(DE3), C41(DE3), C43(DE3) were purchased from Wuhanling vast Bio Inc.

2. Source of plasmids

The pLy077 plasmid and the CcmB coding sequence were synthesized by shanghai bio-inc, the pLy077 plasmid containing: the bacteriophage T7 promoter; coli ribosome binding site comprising the NcoI sequence CCATGG and BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; NdeI restriction site CATATG; a hyper-folding Venus fluorescent protein coding sequence; XhoI cleavage site CTCGAG; 6 histidine sites and the stop codon TAG. pLy077 plasmid and the CcmB coding sequence are shown in the sequence listing.

3. Source of primers

The synthetic primers were all from Biotechnology, Inc. of Ongbenaceae, Beijing.

4. Primary reagent

Tryptone, yeast extract, NaCl, Tris-baes were purchased from Sigma; restriction endonucleases, phusion enzymes, were purchased from Thermo Fisher; rTaq enzyme, T4 ligase, was purchased from Takara. The plasmid miniprep kit and the gel recovery kit were purchased from Axygen corporation. NTP, DEPC water and RNase inhibitor were purchased from Shanghai Biotechnology Ltd.

Example 1 cloning of the Gene of CcmB

Cloning of CcmB

a) A completely new CcmB coding sequence (SEQ ID NO.1) was designed and synthesized based on the comparison of the codon used in the CcmB sequence with the frequency of the Escherichia coli codon usage in the Kazusa online database (http:// www.kazusa.or.jp/codon /). And then amplified by a PCR method. The PCR reaction system configuration is shown in Table 1.

TABLE 1 PCR reaction System preparation Table

Name of reagent	Stock solution concentration	Volume added to PCR reaction System(μL)
			5×HF Buffer	5×	10
dNTP Mix	10mmol/L	2
			Forward primer	10μmol/L	2.5
Reverse primer	10μmol/L	2.5
			Phusion enzyme	5U/μL	0.5
DNA template	50ng/μL	2
			MilliQ H₂O		Adding MilliQ H₂O to a final volume of 50. mu.L

The PCR results are shown in FIG. 1. The target fragment length is 681bp, and the optimal annealing temperature is 52 ℃.

b) Recovering target DNA, cutting the target fragment and pLy077 plasmid by using Nco I and BamHI enzyme, then carrying out agarose gel electrophoresis, and recovering a cut enzyme product; the recovered target fragment and the pLy077 plasmid fragment were added to a small centrifuge tube at a molar ratio of 5:1, and T4 ligase was added thereto and ligated at 16 ℃ overnight.

c) mu.L of the above ligation product was transformed into 80. mu.L of DH 5. alpha. competent cells by heat shock at 42 ℃ and 700. mu.L of LB medium was added thereto, followed by shaking at 37 ℃ and culturing at 200 rpm for 45 minutes.

d) Centrifuging the bacterial liquid at the rotating speed of 4000 rpm for 1 minute, and sucking 700 mu L of supernatant; after the remaining medium was gently aspirated by a pipette, the medium was spread on an LB solid plate containing ampicillin, and the plate was placed upside down in an incubator at 37 ℃ and cultured for 12 hours.

e) And (3) selecting a single colony in the plate, extracting plasmids after a small amount of amplification, carrying out single enzyme digestion and double enzyme digestion on the extracted plasmids by using Nco I and BamHI, carrying out agarose gel electrophoresis identification, and carrying out sequencing identification to obtain an expression vector pLy077-CcmB of the membrane protein CcmB, wherein the structural schematic diagram of the plasmids is shown in FIG. 2. FIG. 3 is a diagram showing the results of PCR verification of pLy077-CcmB colonies. FIG. 4 shows the results of single-restriction double-restriction agarose gel electrophoresis of plasmid pLy077-CcmB with NcoI and BamHI. FIG. 5 is a diagram showing the results of sequencing verification of the recombinant plasmid.

Example 2 expression of CcmB induced expression of fusion protein CcmB-Superfolder fluorescent protein

The correctly identified pLy 077-CmcmB plasmid was transferred into E.coli expression hosts BL21(DE3) and C43(DE3) and spread on a single colony containing 0.1mM isopropyl thiogalactoside (IPTG) to obtain a stably transformed single colony; by detecting the fluorescence of the colonies, fig. 7 is a fluorescence chart of the colonies on the transformed agar plate, and it can be seen from the presence or absence of fluorescence that whether the colonies contain the recombinant plasmid or not, and the colonies containing the recombinant plasmid show fluorescence, and it can be seen that a mutant strain expressing a large amount of the target protein is obtained.

Each colony was inoculated into LB and TB liquid media containing 100. mu.g/ml ampicillin, and cultured overnight at 37 ℃ at 200 rpm to give overnight-cultured bacteria. The overnight bacteria were inoculated into 750mL LB and TB medium at a ratio of 1:250 and cultured at 30 ℃ to OD at 230 rpm₆₀₀Reaching 0.8-1.0, adding IPTG with final concentration of 0.5mM, and culturing at 25 deg.C for 2-6 hr. The cells were collected by centrifugation at 4000 rpm for 15 minutes. And (3) suspending the thalli in a PBS buffer solution, and centrifuging for 15 minutes at 4000 rpm to obtain the thalli containing the CcmB fusion expression protein. FIG. 6 is a graph showing the growth of pLy 077-Ccmc in different expression strains and culture media, and from the growth graph, it can be seen that the bacteria can grow to a higher cell concentration in TB medium than in LB medium, i.e., the growth is better. FIG. 8 is a graph showing fluorescence imaging after induction in LB medium and comparison of whole bacterial proteins before and after induction using E.coli BL21 as an expression strain, and it can be seen from FIG. 8 that CcmB protein expression level is the highest after induction for 4 hours in LB medium using E.coli BL21 as an expression strain. FIG. 9 is fluorescence imaging after induction in TB medium and comparison of total mycoprotein before and after induction using Escherichia coli C43 as expression strain. As seen from FIG. 9, the expression level of CcmB protein was the highest after 6 hours of induction in TB medium using E.coli C43 as the expression strain.

Sequence listing

<110> Nanjing university of science and technology

Expression vector of <120> membrane protein CcmB and expression purification method thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 660

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgatgtttt ggcgcatttt tcgcctggaa ctgcgcgtgg cgtttcgcca tagcgcggaa 60

attgcgaacc cgctgtggtt ttttctgatt gtgattaccc tgtttccgct gagcattggc 120

ccggaaccgc agctgctggc gcgcattgcg ccgggcatta tttgggtggc ggcgctgctg 180

agcagcctgc tggcgctgga acgcctgttt cgcgatgatc tgcaggatgg cagcctggaa 240

cagctgatgc tgctgccgct gccgctgccg gcggtggtgc tggcgaaagt gatggcgcat 300

tggatggtga ccggcctgcc gctgctgatt ctgagcccgc tggtggcgat gctgctgggc 360

atggatgtgt atggctggca ggtgatggcg ctgaccctgc tgctgggcac cccgaccctg 420

ggctttctgg gcgcgccggg cgtggcgctg accgtgggcc tgaaacgcgg cggcgtgctg 480

ctgagcattc tggtgctgcc gctgaccatt ccgctgctga tttttgcgac cgcggcgatg 540

gatgcggcga gcatgcatct gccggtggat ggctatctgg cgattctggg cgcgctgctg 600

gcgggcaccg cgaccctgag cccgtttgcg accgcggcgg cgctgcgcat tagcattcag 660

<210> 2

<211> 6655

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggtatga tgttctggcg cattttccgt 5100

cttgagctgc gtgtagcgtt tcgccatagc gccgaaatcg ccaacccgct gtggttcttc 5160

ctgattgtaa ttaccctttt tccgctcagt atcggtccgg agccgcaact gctggcgcgt 5220

attgcaccgg gcattatctg ggttgctgcg ctgctttcat ccttgctggc gctggaacga 5280

ctgttccgtg acgatttgca ggacggcagt cttgaacaat tgatgttgtt gccgttaccc 5340

ttgcccgccg ttgtgctggc gaaggtgatg gcgcactgga tggtaaccgg tctgccgtta 5400

ctcatccttt cgccactggt agcaatgcta ctgggaatgg atgtttatgg ctggcaagtg 5460

atggcgctga cgctgctgct gggaacgcct acgcttggct ttctcggtgc accgggcgtg 5520

gcgctgacag tgggacttaa gcgcggtggt gtgctgctca gcatactggt gttaccgctg 5580

actatcccat tactcatctt tgccaccgcc gcgatggacg cggcttctat gcatttgccc 5640

gttgacgggt atctggcaat tttaggcgcg ttgctggcag gcaccgcgac attaagtcct 5700

tttgcgacgg cggcagcgtt acgaatcagc attcaaggat ccggactgca ggagaacctg 5760

tacttccaat cccaccatat gtctaaaggt gaagaactgt tcaccggtgt tgttccgatc 5820

ctggttgaac tggacggtga cgttaacggt cacaaattct ctgttcgtgg tgaaggtgaa 5880

ggtgacgcta ccaacggtaa actgaccctg aaattcatct gcaccaccgg taaactgccg 5940

gttccgtggc cgaccctggt taccaccctg acctacggtg ttcagtgctt ctctcgttac 6000

ccggaccaca tgaaacgtca cgacttcttc aaatctgcta tgccggaagg ttacgttcag 6060

gaacgtacca tctctttcaa agacgacggt acctacaaaa cccgtgctga agttaaattc 6120

gaaggtgaca ccctggttaa ccgtatcgaa ctgaaaggta tcgacttcaa agaagacggt 6180

aacatcctgg gtcacaaact ggaatacaac ttcaactctc acaacgttta catcaccgct 6240

gacaaacaga aaaacggtat caaagctaac ttcaaaatcc gtcacaacgt tgaagacggt 6300

tctgttcagc tggctgacca ctaccagcag aacaccccga tcggtgacgg tccggttctg 6360

ctgccggaca accactacct gtctacccag tctgttctgt ctaaagaccc gaacgaaaaa 6420

cgtgaccaca tggttctgct ggaattcgtt accgctgctg gtatcaccca cggtatggac 6480

gaactgtaca aactcgagca ccaccaccac caccactgag atccggctgc taacaaagcc 6540

cgaaaggaag ctgagttggc tgctgccacc gctgagcaat aactagcata accccttggg 6600

gcctctaaac gggtcttgag gggttttttg ctgaaaggag gaactatatc cggat 6655

Claims

1. An expression vector of a membrane protein CcmB is an expression plasmid pLy077-CcmB, and is characterized in that the nucleotide sequence is shown as SEQ ID NO.2 and comprises: the bacteriophage T7 promoter; an escherichia coli ribosome binding site which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein CcmB sequence shown in SEQ ID NO.1 and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; NdeI restriction site CATATG; a hyper-folding Venus fluorescent protein coding sequence; XhoI cleavage site CTCGAG; 6 histidine sites and the stop codon TAG.

2. The method for expressing and purifying the expression vector of the membrane protein CcmB according to claim 1, which comprises the following steps:

3. The method for expression purification according to claim 1, wherein in step 1, the Escherichia coli is Escherichia coli BL21(DE3) or Escherichia coli C43(DE 3).

4. The expression purification method according to claim 1, wherein in step 2, the culture medium is LB medium or TB medium.