CN103667332A - Expression vector containing green fluorescent protein gene and construction method and application thereof - Google Patents
Expression vector containing green fluorescent protein gene and construction method and application thereof Download PDFInfo
- Publication number
- CN103667332A CN103667332A CN201310673891.2A CN201310673891A CN103667332A CN 103667332 A CN103667332 A CN 103667332A CN 201310673891 A CN201310673891 A CN 201310673891A CN 103667332 A CN103667332 A CN 103667332A
- Authority
- CN
- China
- Prior art keywords
- gene
- expression vector
- sfgfp
- green fluorescent
- protein gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an expression vector containing a green fluorescent protein gene. The green fluorescent protein gene is a gene sfGFP, wherein the nucleotide sequence of the gene sfGFP is shown in SEQ ID NO: 1. The invention further relates to a construction method of the expression vector containing the green fluorescent protein gene and application of the expression vector containing the green fluorescent protein gene in positive clone screening. According to the expression vector containing the green fluorescent protein gene and the construction method and application thereof, the characteristic that the sfGFP can complete super-folding and illuminate under various conditions is utilized, the advantages of luminous power and luminous intensity of the sfGFP are obviously stronger than those of ordinary proteins, such as GFP (Green Fluorescent Protein), EGFP (Enhanced Green Fluorescent Protein) and the like, and are 1.6 times the EGFP, and obvious green fluorescent light can be observed by unaided eyes, so that the screening of positive clones during protein expressed cloning can be facilitated, and the fast and accurate screening for the positive clones is facilitated.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of expression vector that contains green fluorescence protein gene and construction process and application.
Background technology
Green fluorescent protein, molecular mass is about 28kDa, by 238 Amino acid profiles, 65-67 amino acids (Ser-Tyr-Gly) forms luminophor, through covalent linkage, be formed by connecting as oxybenzene Methylimidazole alkane ketone, it can be produced fluorescence by optical excitation, is main luminous position.The shape of green fluorescent protein molecule is cylindrical, and just as a bucket, luminous group is positioned at bucket central authorities, and therefore, it can liken into one " paint kettle " that pigment is housed visually.The formation of its luminophor does not have specificity, and the fluorescence that sends is stable, and does not need to rely on other matrix and luminous.
Green fluorescent protein (GFP) is often used as reporter gene in field of biology, is a kind of desirable radioactive labelling, in fields such as biotechnology, cytobiology, transgenic animal, environmental engineering, microbiologies, is widely used.Utilize the distinctive luminous mechanism of green fluorescent protein, can be using GFP as albumen label (protein tagging), utilize exactly DNA recombinant technology, goal gene and GFP are formed to fusion gene, transfection or be converted into suitable cell and express, then by the protein of mark in live body in fluorescence microscope cell.Because GFP only has 238 amino acid, relatively little, so will not affect the lighting function of himself after itself and other protein fusion, utilize this characteristic of GFP, deepened the understanding to some processes in cell, as growth and signal transduction, cell fission, chromosome duplication and division etc.The location that utilizes GFP to detect target protein provides a kind of novel method that physiological process in cell is observed.
In view of green fluorescent protein can be used as reporter gene, and be widely used in biotechnology, but the existing expression vector with target protein gene fragment needs to determine whether as correct positive colony through picking colony and gene sequencing step in application, need to carry out the work that a large amount of blindnesses is chosen spot and PCR evaluation, waste time and energy.
Summary of the invention
In order to solve above technical problem, the invention provides a kind of preparation method of expression vector and this expression vector with green fluorescent protein.
The present invention is achieved through the following technical solutions:
An expression vector that contains green fluorescence protein gene, described green fluorescence protein gene is sfGFP gene, the nucleotide sequence of described sfGFP gene is as shown in SEQ ID NO:1.
A construction process for the expression vector that contains green fluorescence protein gene, comprises the following steps:
The sfGFP gene of synthesizing ribonucleotide sequence as shown in SEQ ID NO:1;
The synthetic primer with restriction enzyme site, and under the guiding of this primer, the sfGFP gene of nucleotide sequence as shown in SEQ ID NO:1 of take carries out pcr amplification as template, obtains the nucleotide sequence with restriction enzyme site;
The nucleotide sequence with restriction enzyme site that unloaded plasmid and described pcr amplification are obtained carries out respectively double digestion and reclaims enzyme and cut rear fragment, with DNA ligase ligase enzyme, cuts rear fragment, and for transforming intestinal bacteria;
With containing the antibiotic LB solid medium corresponding with resistant gene in unloaded plasmid, screen, the clone of picking green-emitting fluorescence detects carrier sequence, detects correct carrier be the described expression vector that contains green fluorescence protein gene by gene sequencing.
In technique scheme, described unloaded plasmid is pET-28a (+) or pGEX-6P-1.
In technique scheme, described intestinal bacteria are intestinal bacteria RosettaBlue (DE3).
The application of the above expression vector that contains green fluorescence protein gene in the screening of positive colony, step is as follows:
Synthetic goal gene;
The synthetic primer with restriction enzyme site, and under the guiding of this primer, the goal gene sequence of synthesizing of take is template, carries out pcr amplification and obtains the object nucleotide sequence with restriction enzyme site;
Described expression vector and pcr amplification are obtained carrying out respectively double digestion with the goal gene sequence of restriction enzyme site, reclaim endonuclease bamhi, expression vector fragment and goal gene fragment after cutting with DNA ligase ligase enzyme, and transform intestinal bacteria, with containing the corresponding antibiotic LB solid medium of resistant gene having with the expression vector described in claim 1, screen, the non-luminous spot of picking, is the clone with goal gene sequence.
The present invention has utilized Superfolder GFP(sfGFP) can complete under various conditions super folding and luminous characteristic, its luminous power and the luminous intensity albumen such as common GFP, EGFP that are better than with the obvious advantage, for 1.6 times of EGFP, naked eyes can be observed obvious green fluorescence, therefore can facilitate the screening of positive colony in albumen cloning by expression process, be conducive to fast and accurately positive colony be screened.
Accompanying drawing explanation
PET-28a (+)-sfGFP expression vector structural representation that Fig. 1 provides for the embodiment of the present invention.
The pGEX-6P-1-sfGFP expression vector structural representation that Fig. 2 provides for the embodiment of the present invention.
PET-28a (+)-β 2M carrier structure schematic diagram that utilizes pET-28a (+)-sfGFP expression vector establishment that Fig. 3 provides for the embodiment of the present invention.
Fig. 4 is that the present invention utilizes pGEX-6P-1-sfGFP expression vector establishment pGEX-6P-1-β 2M carrier structure schematic diagram.
Embodiment
Below in conjunction with drawings and Examples, technical scheme of the present invention is described in detail.
Embodiment mono-
The structure of expression vector pET-28a (+)-sfGFP that contains sfGFP gene
1. the preparation of plasmid pET-28a (+)
By the intestinal bacteria that contain plasmid pET-28a (+) at LB(containing kantlex 50mg/L) under 37 ℃ of conditions, cultivate 12 hours on solid medium.The single bacterium colony of picking contains plasmid pET-28a (+) from substratum intestinal bacteria, and proceeded to LB(containing kantlex 50mg/L) in liquid nutrient medium, on the shaking table that is 250rpm at rotating speed under 37 ℃ of conditions, suspension culture 12 hours.Finally with Sangon company plasmid extraction kit, extract plasmid pET-28a (+), and the plasmid of acquisition is kept under-20 ℃ of conditions standby.
2. build expression vector pET-28a (+)-sfGFP that contains sfGFP gene
1) the sfGFP gene order of synthetic SEQ ID NO:1;
2) at primer 1:5'ACGCGTCGACTGATGTCCAAAGGAGAAGAGC3'
Primer 2: 5'ATGCGCGGCCGCTTACTTGTACAGCTCGT3'
Guiding under, the sfGFP gene order of SEQ ID NO:1 of take is carried out PCR as template, amplification obtains the nucleotide sequence with Sal I and Not I of SEQ ID NO:2,50 μ L pcr amplification systems comprise 5 μ L10 * Buffer, 2mmol/L Mg
2+, 200 μ mol/LdNTPs, the forward and reverse primer of 200nmol/L, 1ng sfGFP plasmid, 2.5U KOD Tag archaeal dna polymerase.The PCR program of 35 circulations is that 94 ℃/30S(circulates for the first time as 5min), 55 ℃/30s, the last circulation of 72 ℃/20s(is 5min).Amplified production carries out electrophoretic analysis and reclaims purifying with 1% sepharose.
3) plasmid pET-28a (+) is carried out to double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing pET-28a (+) 10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
4) by 2) the PCR product of the purifying that obtains of step carries out double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing 2) PCR product 10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
5) by 3) product and 4 that obtains of step) product that obtains of step under 16 ℃ of conditions with T4DNA ligase enzyme ligation 12 hours, ligation product is transformed into competence intestinal bacteria RosettaBlue (DE3), at LB(, contain kantlex 50mg/L, 0.2% lactose) on solid medium, under 37 ℃ of conditions, cultivate 12 hours, single bacterium colony of picking jaundice green light from solid medium, and by gene sequencing, identify the exactness of its plasmid construction, by correct positive colony preserve, standby.
The structure of the expression vector pGEX-6P-1-sfGPF that embodiment bis-contains sfGFP gene
1. the preparation of plasmid pGEX-6P-1
By the intestinal bacteria that contain plasmid pGEX-6P-1 at LB(containing penbritin 50mg/L) under 37 ℃ of conditions, cultivate 12 hours on solid medium.The single bacterium colony of picking contains plasmid pGEX-6P-1 from substratum intestinal bacteria, and proceeded to LB(containing penbritin 50mg/L) in liquid nutrient medium, on the shaking table that is 250rpm at rotating speed under 37 ℃ of conditions, suspension culture 12 hours.Finally with Sangon company plasmid extraction kit, extract plasmid pGEX-6P-1, and the plasmid of acquisition is kept under-20 ℃ of conditions standby.
2. build the expression vector pGEX-6P-1-sfGFP that contains sfGFP gene
1) the sfGFP gene order of synthetic SEQ ID NO:1;
2) at primer 1:5'ACGCGTCGACTGATGTCCAAAGGAGAAGAGC3'
Under the guiding of primer 2: 5'ATGCGCGGCCGCTTACTTGTACAGCTCGT3', the sfGFP gene order of SEQ ID NO:1 of take is carried out PCR as template, amplification obtains the nucleotide sequence with Sal I and Not I of SEQ ID NO:2,50 μ L pcr amplification systems comprise 5 μ L10 * Buffer, 2mmol/L Mg
2+, 200 μ mol/LdNTPs, the forward and reverse primer of 200nmol/L, 1ng sfGFP plasmid, 2.5U KOD Tag archaeal dna polymerase.The PCR program of 35 circulations is that 94 ℃/30S(circulates for the first time as 5min), 55 ℃/30s, the last circulation of 72 ℃/20s(is 5min).Amplified production carries out electrophoretic analysis and reclaims purifying with 1% sepharose.
3) plasmid pGEX-6P-1 is carried out to double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing pGEX-6P-110ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
4) by 2) the PCR product of the purifying that obtains of step carries out double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing 2) PCR product 10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
5) by 3) product and 4 that obtains of step) product that obtains of step under 16 ℃ of conditions with T4DNA ligase enzyme ligation 12 hours, ligation product is transformed into competence intestinal bacteria RosettaBlue (DE3), at LB(, contain penbritin 50mg/L, 0.2% lactose) on solid medium, under 37 ℃ of conditions, cultivate 12 hours, single bacterium colony of picking jaundice green light from solid medium, and by gene sequencing, identify the exactness of its plasmid construction, by correct positive colony preserve, standby.
Embodiment tri-utilizes plasmid pET-28a (+)-sfGFP construction of expression vector pET-28a (+)-β 2M
1. the preparation of plasmid pET-28a (+)-sfGFP
By the intestinal bacteria that contain plasmid pET-28a (+)-sfGFP at LB(containing kantlex 50mg/L) under 37 ℃ of conditions, cultivate 12 hours on solid medium.The single bacterium colony of picking contains plasmid pET-28a (+)-sfGFP from substratum intestinal bacteria, and proceeded to LB(containing that mould 50mg/L of card) in liquid nutrient medium, on the shaking table that is 250rpm at rotating speed under 37 ℃ of conditions, suspension culture 12 hours.Finally with Sangon company plasmid extraction kit, extract plasmid pET-28a (+)-sfGFP, and the plasmid of acquisition is kept under-20 ℃ of conditions standby.
2. build expression vector pET-28a (+)-β 2M that contains β 2M gene
1) the β 2M gene order of synthetic SEQ ID NO:3;
2) at primer 1:5'ACGCGTCGACTGATCCAGCGTACTCCAAAG3'
Primer 2: 5'ATGCGCGGCCGCCATGTCTCGATCCC3'
Guiding under, the SEQ ID NO:3 of take carries out PCR as template, amplification obtains in SEQ ID NO:4 with the nucleotide sequence of Sal I and Not I, 50 μ L pcr amplification systems comprise 5 μ L10 * Buffer, 2mmol/L Mg
2+, 200 μ mol/LdNTPs, the forward and reverse primer of 200nmol/L, 1ng β 2M plasmid, 2.5U KOD Tag archaeal dna polymerase.The PCR program of 35 circulations is that 94 ℃/30S(circulates for the first time as 5min), 55 ℃/30s, the last circulation of 72 ℃/20s(is 5min).Amplified production carries out electrophoretic analysis and reclaims purifying with 1% sepharose.
3) plasmid pET-28a (+)-sfGFP is carried out to double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing pET-sfGFP10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
4) by 3) the digested plasmid fragment that obtains of step processes with the dephosphorylation test kit of TaKaRa company, 50 μ L endonuclease reaction systems are containing 3) step digested plasmid fragment 15pmol, 10 * BAP Buffer5 μ L, Bacterial Alkaline Phosphatase(BAP) 2.5 μ L, with distilled water, complement to 50 μ L, 65 ℃ of insulations are after 30 minutes, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying, reclaim dephosphorylized linear plasmid fragment.
5) by 2) the PCR product of the purifying that obtains of step carries out double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing 2) PCR product 10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
6) by 4) product and 5 that obtains of step) product that obtains of step under 16 ℃ of conditions with T4DNA ligase enzyme ligation 12 hours, ligation product is transformed into competence intestinal bacteria RosettaBlue (DE3), at LB(, contain kantlex 50mg/L, 0.2% lactose) on solid medium, under 37 ℃ of conditions, cultivate 12 hours the non-luminous single bacterium colony of picking from solid medium.By gene sequencing, verify that all non-luminous single bacterium colonies are positive colony.Accordingly, illustrate and utilize the expression vector with goal gene fragment with the expression vector establishment of sfGPF gene, directly the non-luminous single bacterium colony of picking, as positive colony, can save bacterium colony PCR and verify work, can effectively save time and expense cost.
Embodiment tetra-utilizes plasmid pGEX-6P-1-sfGPF construction of expression vector pGEX-6P-1-β 2M
1. the preparation of plasmid pGEX-6P-1-sfGFP
The intestinal bacteria that contain plasmid pGEX-6P-1-sfGFP are cultivated 12 hours containing on penbritin 50mg/L solid medium at LB(under 37 ℃ of conditions.The single bacterium colony of picking contains plasmid pGEX-6P-1-sfGFP from substratum intestinal bacteria, and proceeded to LB(containing penbritin 50mg/L) in liquid nutrient medium, on the shaking table that is 250rpm at rotating speed under 37 ℃ of conditions, suspension culture 12 hours.Finally with Sangon company plasmid extraction kit, extract plasmid pGEX-sfGFP, and the plasmid of acquisition is kept under-20 ℃ of conditions standby.
2. build the expression vector pGEX-6P-1-β 2M that contains β 2M gene
1) β 2M gene order in composition sequence table 3;
2) at primer 1:5'ACGCGTCGACTGATCCAGCGTACTCCAAAG3'
Primer 2: 5'ATGCGCGGCCGCCATGTCTCGATCCC3'
Guiding under, the SEQ ID NO:3 of take carries out PCR as template, amplification obtains the nucleotide sequence with Sal I and Not I of SEQ ID NO:4,50 μ L pcr amplification systems comprise 5 μ L10 * Buffer, 2mmol/L Mg
2+, 200 μ mol/LdNTPs, the forward and reverse primer of 200nmol/L, 1ng β 2M plasmid, 2.5U KOD Tag archaeal dna polymerase.The PCR program of 35 circulations is that 94 ℃/30S(circulates for the first time as 5min), 55 ℃/30s, the last circulation of 72 ℃/20s(is 5min).Amplified production carries out electrophoretic analysis and reclaims purifying with 1% sepharose.
3) plasmid pGEX-6P-1-sfGFP is carried out to double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing pGEX-6P-1-sfGFP10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
4) by 3) the digested plasmid fragment that obtains of step processes with the dephosphorylation test kit of TaKaRa company, 50 μ L endonuclease reaction systems are containing 3) step digested plasmid fragment 15pmol, 10 * BAP Buffer5 μ L, Bacterial Alkaline Phosphatase(BAP) 2.5 μ L, with distilled water, complement to 50 μ L, 65 ℃ of insulations are after 30 minutes, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying, reclaim dephosphorylized linear plasmid fragment.
5) by 2) the PCR product of the purifying that obtains of step carries out double digestion with Sal I and Not I.50 μ L endonuclease reaction systems are containing 2) PCR product 10ug, 10 * Buffer4(NEB) 5 μ L, Sal I and each 20U of Not I, water complements to 50 μ L, 37 ℃ of enzymes carry out 1% agarose gel electrophoresis after cutting 4h, under ultraviolet lamp, with blade, large fragment is cut, with the Agarose Gel DNA Purification kit of TaKaRa company, reclaim purifying.
6) by 4) product and 5 that obtains of step) product that obtains of step under 16 ℃ of conditions with T4DNA ligase enzyme ligation 12 hours, ligation product is transformed into competence intestinal bacteria RosettaBlue (DE3), at LB(, contain penbritin 50mg/L, 0.2% lactose) on solid medium, under 37 ℃ of conditions, cultivate 12 hours the non-luminous single bacterium colony of picking from solid medium.By gene sequencing, verify that all non-luminous single bacterium colonies are positive colony.Accordingly, illustrate and utilize the expression vector with goal gene fragment with the expression vector establishment of sfGPF gene, directly the non-luminous single bacterium colony of picking, as positive colony, can save bacterium colony PCR and verify work, can effectively save time and expense cost.
It should be noted last that, above embodiment only in order to illustrate this material technology implementation scheme but not restriction, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not departing from the spirit and scope of technical solution of the present invention, it all should be encompassed in the middle of claim scope of the present invention.
<110> Wuhan Sino-American Biotechnology Company
The expression vector that <120> contains green fluorescence protein gene and construction process thereof and application
<130>
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 717
<212> DNA
<213> artificial sequence
<220>
<221> misc_feature
<222> (717)..(717)
<400> 1
atgtccaaag gagaagagct gttcactgga gtggtaccaa tacttgtgga gttggacgga 60
gatgtgaacg gacacaaatt ttcagtccgc ggggaggggg aaggggatgc tactattggc 120
aagctgacgc tcaaattcat ctgtaccacc ggaaaactcc ctgtaccctg gcccacactg 180
gtgacaactc tgacttacgg cgtgcaatgt tttagccgat acccagacca catgaagagg 240
cacgactttt tcaaaagcgc aatgcctgaa ggatacgtac aggaaaggac catttctttt 300
aaagacgacg ggaagtacaa aacccgggca gtggtgaagt ttgagggcga taccctcgtc 360
aataggatcg aattgaaggg aactgacttc aaagaagatg gcaacatcct gggtcacaag 420
cttgagtata actttaactc ccacaacgtg tatattacag ccgacaaaca gaagaatgga 480
attaaggcta acttcactgt cagacacaat gtcgaagatg gctccgtgca gctcgccgat 540
cactatcaac agaatactcc tatcggggac ggcccagtcc tgctgcccga caaccactac 600
ctgagtaccc agactgttct gagcaaagat ccgaacgaga agcgcgacca catggtgctg 660
catgagtatg tcaacgctgc gggaattacc ctcggcatgg acgagctgta caagtaa 717
<210> 2
<211> 742
<212> DNA
<213> artificial sequence
<220>
<221> misc_feature
<222> (742)..(742)
<400> 2
acgcgtcgac tgatgtccaa aggagaagag ctgttcactg gagtggtacc aatacttgtg 60
gagttggacg gagatgtgaa cggacacaaa ttttcagtcc gcggggaggg ggaaggggat 120
gctactattg gcaagctgac gctcaaattc atctgtacca ccggaaaact ccctgtaccc 180
tggcccacac tggtgacaac tctgacttac ggcgtgcaat gttttagccg atacccagac 240
cacatgaaga ggcacgactt tttcaaaagc gcaatgcctg aaggatacgt acaggaaagg 300
accatttctt ttaaagacga cgggaagtac aaaacccggg cagtggtgaa gtttgagggc 360
gataccctcg tcaataggat cgaattgaag ggaactgact tcaaagaaga tggcaacatc 420
ctgggtcaca agcttgagta taactttaac tcccacaacg tgtatattac agccgacaaa 480
cagaagaatg gaattaaggc taacttcact gtcagacaca atgtcgaaga tggctccgtg 540
cagctcgccg atcactatca acagaatact cctatcgggg acggcccagt cctgctgccc 600
gacaaccact acctgagtac ccagactgtt ctgagcaaag atccgaacga gaagcgcgac 660
cacatggtgc tgcatgagta tgtcaacgct gcgggaatta ccctcggcat ggacgagctg 720
tacaagtaag cggccgcgcg at 742
<210> 3
<211> 297
<212> DNA
<213> people
<220>
<221> misc_feature
<222> (297)..(297)
<400> 3
atccagcgta ctccaaagat tcaggtttac tcacgtcatc cagcagagaa tggaaagtca 60
aatttcctga attgctatgt gtctgggttt catccatccg acattgaagt tgacttactg 120
aagaatggag agagaattga aaaagtggag cattcagact tgtctttcag caaggactgg 180
tctttctatc tcttgtacta cactgaattc acccccactg aaaaagatga gtatgcctgc 240
cgtgtgaacc atgtgacttt gtcacagccc aagatagtta agtgggatcg agacatg 297
<210> 4
<211> 322
<212> DNA
<213> artificial sequence
<220>
<221> misc_feature
<222> (322)..(322)
<400> 4
acgcgtcgac tgatccagcg tactccaaag attcaggttt actcacgtca tccagcagag 60
aatggaaagt caaatttcct gaattgctat gtgtctgggt ttcatccatc cgacattgaa 120
gttgacttac tgaagaatgg agagagaatt gaaaaagtgg agcattcaga cttgtctttc 180
agcaaggact ggtctttcta tctcttgtac tacactgaat tcacccccac tgaaaaagat 240
gagtatgcct gccgtgtgaa ccatgtgact ttgtcacagc ccaagatagt taagtgggat 300
cgagacatgg cggccgcgcg at 322
Claims (5)
1. an expression vector that contains green fluorescence protein gene, is characterized in that: described green fluorescence protein gene is sfGFP gene, and the nucleotide sequence of described sfGFP gene is as shown in SEQ ID NO:1.
2. the construction process of the expression vector that contains green fluorescence protein gene as claimed in claim 1, is characterized in that: comprise the following steps:
The sfGFP gene of synthesizing ribonucleotide sequence as shown in SEQ ID NO:1;
The synthetic primer with restriction enzyme site, and under the guiding of this primer, the sfGFP gene of nucleotide sequence as shown in SEQ ID NO:1 of take carries out pcr amplification as template, obtains the nucleotide sequence with restriction enzyme site, with the nucleotide sequence of restriction enzyme site as shown in SEQ ID NO:2;
The nucleotide sequence with restriction enzyme site that unloaded plasmid and described pcr amplification are obtained carries out respectively double digestion and reclaims enzyme and cut rear fragment, with DNA ligase ligase enzyme, cuts rear fragment, and for transforming intestinal bacteria;
With containing the antibiotic LB solid medium corresponding with resistant gene in unloaded plasmid, screen, the clone of picking green-emitting fluorescence detects carrier sequence, detects correct carrier be the described expression vector that contains green fluorescence protein gene by gene sequencing.
3. the construction process of the expression vector that contains green fluorescence protein gene as claimed in claim 2, is characterized in that: described unloaded plasmid is pET-28a (+) or pGEX-6P-1.
4. the construction process of the expression vector that contains green fluorescence protein gene as claimed in claim 2, is characterized in that: described intestinal bacteria are intestinal bacteria RosettaBlue (DE3).
5. the application of expression vector in the screening of positive colony as described in claim 1, is characterized in that: step is as follows:
Synthetic goal gene;
The synthetic primer with restriction enzyme site, and under the guiding of this primer, the goal gene sequence of synthesizing of take is template, carries out pcr amplification and obtains the object nucleotide sequence with restriction enzyme site;
Expression vector described in claim 1 is carried out to double digestion, then enzyme is cut to the plasmid fragment obtaining and processed through dephosphorylation, reclaim dephosphorylized linear plasmid fragment; The goal gene sequence with restriction enzyme site that pcr amplification is obtained is carried out double digestion, reclaim endonuclease bamhi, with DNA ligase, connect dephosphorylized expression vector fragment and goal gene fragment, and transform intestinal bacteria, with containing the corresponding antibiotic LB solid medium of resistant gene having with the expression vector described in claim 1, screen, the non-luminous spot of picking, is the clone with goal gene sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310673891.2A CN103667332A (en) | 2013-12-11 | 2013-12-11 | Expression vector containing green fluorescent protein gene and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310673891.2A CN103667332A (en) | 2013-12-11 | 2013-12-11 | Expression vector containing green fluorescent protein gene and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103667332A true CN103667332A (en) | 2014-03-26 |
Family
ID=50306101
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310673891.2A Pending CN103667332A (en) | 2013-12-11 | 2013-12-11 | Expression vector containing green fluorescent protein gene and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667332A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104711281A (en) * | 2013-12-11 | 2015-06-17 | 中国科学院深圳先进技术研究院 | LAMP1 green fluorescence expression vector and preparation method and application of LAMP1 green fluorescence expression vector |
| CN106318959A (en) * | 2016-09-28 | 2017-01-11 | 河南大学 | Building method of FXR (farnesoid X receptor) gene expression carrier and application thereof |
| CN106591343A (en) * | 2016-11-29 | 2017-04-26 | 湖北大学 | Method for secretory expression of super-folded green fluorescent protein mediated heterologous protein in escherichia coli |
| CN109520985A (en) * | 2018-12-07 | 2019-03-26 | 江南大学 | A kind of method of ethyl alcohol acid yield in quick detection Escherichia coli |
| CN111549046A (en) * | 2020-04-22 | 2020-08-18 | 通用生物系统（安徽）有限公司 | Construction method of recombinant vector capable of stably emitting light |
| CN113136394A (en) * | 2020-01-16 | 2021-07-20 | 南京理工大学 | Expression vector of membrane protein CcmB and expression purification method thereof |
| CN116574749A (en) * | 2022-10-20 | 2023-08-11 | 江南大学 | Method for improving expression level of exogenous protein based on protein N-terminal modification |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409061A (en) * | 2011-03-23 | 2012-04-11 | 江苏大学 | Preparation method of T vector based on EGFP (enhanced green fluorescent protein) |
-
2013
- 2013-12-11 CN CN201310673891.2A patent/CN103667332A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409061A (en) * | 2011-03-23 | 2012-04-11 | 江苏大学 | Preparation method of T vector based on EGFP (enhanced green fluorescent protein) |
Non-Patent Citations (2)
| Title |
|---|
| YAMAGATA M ET.AL.: "Transgenic strategy for identifying synaptic connections in mice by fluorescence complementation (GRASP)", 《FRONT MOL NEUROSCI.》 * |
| 霍海龙 等: "绿色荧光蛋白基因原核表达质粒pET32a-AcGFP1的构建及其在大肠杆菌中的高效表达", 《云南农业大学学报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104711281A (en) * | 2013-12-11 | 2015-06-17 | 中国科学院深圳先进技术研究院 | LAMP1 green fluorescence expression vector and preparation method and application of LAMP1 green fluorescence expression vector |
| CN106318959A (en) * | 2016-09-28 | 2017-01-11 | 河南大学 | Building method of FXR (farnesoid X receptor) gene expression carrier and application thereof |
| CN106591343A (en) * | 2016-11-29 | 2017-04-26 | 湖北大学 | Method for secretory expression of super-folded green fluorescent protein mediated heterologous protein in escherichia coli |
| CN106591343B (en) * | 2016-11-29 | 2020-02-18 | 湖北大学 | Secretory expression method of superfolder green fluorescent protein mediated heterologous protein in escherichia coli |
| CN109520985A (en) * | 2018-12-07 | 2019-03-26 | 江南大学 | A kind of method of ethyl alcohol acid yield in quick detection Escherichia coli |
| CN113136394A (en) * | 2020-01-16 | 2021-07-20 | 南京理工大学 | Expression vector of membrane protein CcmB and expression purification method thereof |
| CN111549046A (en) * | 2020-04-22 | 2020-08-18 | 通用生物系统（安徽）有限公司 | Construction method of recombinant vector capable of stably emitting light |
| CN116574749A (en) * | 2022-10-20 | 2023-08-11 | 江南大学 | Method for improving expression level of exogenous protein based on protein N-terminal modification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667332A (en) | Expression vector containing green fluorescent protein gene and construction method and application thereof | |
| CN107922931B (en) | Thermostable Cas9 nuclease | |
| CN106947827B (en) | Bighead carp gender specific molecular marker, screening method and application thereof | |
| CN107880132A (en) | A kind of fusion protein and the method using its progress homologous recombination | |
| US11788123B2 (en) | Systems and methods for high-throughput image-based screening | |
| Rosin et al. | Co-evolving CENP-A and CAL1 domains mediate centromeric CENP-A deposition across Drosophila species | |
| Vera et al. | Imaging single mRNA molecules in mammalian cells using an optimized MS2-MCP system | |
| Tutucci et al. | Single-mRNA detection in living S. cerevisiae using a re-engineered MS2 system | |
| CN110128546B (en) | Fusion protein for RNA tracing and application thereof | |
| CN108342511A (en) | Detect primer sets and its application of cell enlargement irido virus | |
| CN113584133B (en) | Multi-target in-situ detection method based on color coding and programmable fluorescent probe | |
| CN112899238A (en) | Based on RNA-m6A modification level compound screening cell model and construction and application thereof | |
| CN107266523A (en) | Protein purification method and fused protein and its production method containing peptide tag | |
| CN103667344A (en) | Method for activating expression of erythrogenin genes | |
| CN101173296B (en) | Construction method for broad spectrum bacterium host green fluorescence protein expression vector | |
| CN108411030A (en) | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 | |
| CN110499316B (en) | Milk cow mammary gland epithelial cell line with CD44 gene knocked out and construction method thereof | |
| CN105483155A (en) | Method for detecting effect of 3' untranslated region on mRNA translation efficiency | |
| CN108486115A (en) | A kind of transfection method and its application for the expression of crayfish Cells Exogenous genetic | |
| CN102181465B (en) | Fluorescent clone screening vector and preparation and application thereof | |
| CN103233004B (en) | Artificial DNA (deoxyribonucleic acid) molecule and method for detecting expression of target gene | |
| Geng et al. | CAS-LiveFISH: Simple and versatile imaging of genomic loci in live mammalian cells and early pre-implantation embryos | |
| CN116548388B (en) | Preparation method of transgenic zebra fish model for marking hematopoietic stem/progenitor cell cycle | |
| CN117126874B (en) | Biological method for preparing 164.88 DEG triple-helix structure collagen on large scale | |
| CN107012146A (en) | The tetrahymena expression vector recombinated based on locus specificity and its structure and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140326 |