CN103233004B - Artificial DNA (deoxyribonucleic acid) molecule and method for detecting expression of target gene - Google Patents

Abstract

The invention provides a DNA (deoxyribonucleic acid) molecule. The base sequence of the DNA molecule is shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and can code a TALE-TFs; and the TALE-TFs can identify corresponding loci in SEQ ID NO.5. According to the invention, a mammal fibroblast cell which does not express a beta-casein gene can express the beta-casein gene through the TALE-TFs technology, thus realizing the activation of a recombinant beta-casein gene (exogenous integrator gene expression cassette) in the fibroblast cell through TALE-TFs, and providing a more convenient detection way for the in-vitro detection of an expression cassette driven by a recombinant beta-casein promoter without culturing a mammary gland epithelial cell.

Description

A kind of method that artificial DNA molecule and detection target gene are expressed

Technical field

The present invention relates to gene engineering field, particularly relate to a kind of artificial DNA molecule, and utilize this artificial DNA molecule to detect the method for target gene expression.

Background technology

Mammals beta-casein gene high expression level in mammary gland, also can express in skin and poisonous T lymphocyte (cytotoxic T lymphocytes).Casein is the main protein component in Mammals Ruzhong, is divided into 4 classes: α according to structure _s1, α _s2, β and κ.In mammary tissue, 4 kinds of casein gene mRNA translation efficiencies are different, α _s1α with the mRNA translation efficiency of β _s2with 3 to 4 times of κ.In sum, beta-casein gene site is the appropriate targets preparing galactophore biological reactor.

Whether effective for confirming the expression cassette of beta-casein gene promoters driven, Kolb etc. (1999) adopt mammary epithelial cell.Domestic galactophore biological reactor research aspect, also adopts the validity of mammary epithelial cell checking expression cassette.If beta-casein gene promotor can be activated in inoblast, detect the expression of results of recombinant expressed frame, the structure for galactophore biological reactor is provided the detection technique of direct convenience.

Summary of the invention

The object of the present invention is to provide a kind of artificial DNA molecule, a kind of method utilizing this DNA molecular detection target gene to express in inoblast is also provided.

In the present invention, term " TALE " refers to transcriptional activation sample effector.

In the present invention, term " TALE-TFs " refers to TALE transcription factor, i.e. TALE transcription factors.

In order to solve the problems of the technologies described above, present invention employs following technical scheme:

A kind of DNA molecular, the base sequence of described DNA molecular is for shown in SEQ ID NO.1 or SEQ ID NO.2, and its a kind of TALE-TFs that can encode, described TALE-TFs can identify the 11-29 position in SEQ ID NO5;

The base sequence of described DNA molecular also can for shown in SEQ ID NO.3 or SEQ ID NO.4, and its a kind of TALE-TFs that can encode, described TALE-TFs can identify the 23-41 position in SEQ ID NO5.

A kind of expression vector, described expression vector comprises above-mentioned DNA molecular, and it can express a kind of TALE-TFs.

A kind of reconstitution cell, described reconstitution cell is the prokaryotic cell prokaryocyte or eukaryotic cell that transform with above-mentioned expression vector.

Detect the method that target gene is expressed, comprise the following steps,

Steps A, target gene is proceeded to Mammals beta-casein gene, build the Mammals beta-casein gene expression vector containing target gene;

Step B, to design TALE arrangement respectively according to Mammals beta-casein gene promotor target sequence TFm1 and TFm2, and the expression vector of construction expression TALE-TFs; Wherein said Mammals beta-casein gene promotor target sequence TFm1 is the 11-29 position in SEQ ID NO1, and target sequence TFm2 is the 23-41 position in SEQ ID NO1;

Step C, with described containing the Mammals beta-casein gene expression vector of target gene and the expression vector cotransfection inoblast of described expression TALE-TFs;

Step D, in inoblast, detect the expression of target gene.

Further, the method that above-mentioned detection target gene is expressed, wherein, beta-casein gene described in steps A is mouse beta-casein gene.

Further, the method that above-mentioned detection target gene is expressed, wherein, the expression vector of expressing TALE-TFs described in step B comprises above-mentioned DNA molecular.

Further, the method that above-mentioned detection target gene is expressed, wherein, the inoblast described in step C is l cell.

Compared with prior art, beneficial effect of the present invention is:

Whether effective for confirming the expression cassette of restructuring, all adopt both at home and abroad and detect in mammary epithelial cell.And utilize TALE-TFs technology to enable the mammalian fibroblasts of not expressing beta-casein gene express beta-casein gene, also beta-casein gene---the external source integrator gene expression cassette activating restructuring with TALE-TFs in inoblast can just be realized, a kind of convenient detection approach can be provided, without the need to cultivating mammary epithelial cell for the expression cassette of the beta-casein promoters driven of vitro detection restructuring.

Accompanying drawing explanation

Fig. 1 is mouse beta-casein gene the 1st exon targeting vector structural representation;

Fig. 2 is intermediate carrier pEGFP-N1-BsmBI structural representation;

Fig. 3 is that in l cell, TALE-TFs activates beta-casein gene promoter plasmid expression of results picture.

Embodiment

Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail, but not as a limitation of the invention.

Embodiment 1 mouse beta-casein gene-red fluorescent protein reporter gene expression vector construction

In embodiment 1 using red fluorescent protein reporter gene as goal gene, proceed to mouse beta-casein gene, and be built into mouse beta-casein gene-red fluorescent protein reporter gene expression carrier.

As shown in Figure 1, mouse beta-casein gene-red fluorescent protein reporter gene expression carrier comprises left and right homology arm, mRNA 5 ' non-translational region, signal peptide sequence, Red gene and poly A, form a complete expression cassette, and comprise promoter regulation sequence and TATA box.Therefore, this carrier can be used in the detection that TALE-TFs activates beta-casein gene promotor.

1.1 design of primers primers also add BsmBI restriction enzyme site (small letter tilted letter) and the restriction enzyme site required for other (underscore part), and primer synthesizes (see table 1) by Invitrogen company.

Table 1 Primer and sequence

Bacterial strain and carrier: intestinal bacteria (Escherichia coli) DH5a, pDsRed2-1 carrier, pEGFP-N1 carrier.

Enzyme and main biochemical reagent: BglII, EcoRI, HindIII, NcoI are purchased from precious biotechnology (Dalian) company limited; Taq archaeal dna polymerase, pfu archaeal dna polymerase are purchased from TIANGEN Biotech (Beijing) Co., Ltd.; Esp3I (BsmBI), Rapid DNA Ligation Kit are purchased from Fermentas; T4 DNA Ligase (HC) is purchased from Promega company; Genome extraction agent box is purchased from Sangon Biotech (Shanghai) Co., Ltd., and other reagent are domestic analytical pure.

1.2 mouse genome extractings

Adopt cervical dislocation to put to death experiment mice, take about about the 25mg of muscle tissue, use genome extraction agent box extracting mouse genome, detect for subsequent use.

1.3 mouse beta-casein gene First Exon two ends homology arm sequence amplifications

For mouse beta-casein gene First Exon genome sequence (X13484.1), design homology arm specificity amplification primer.First Exon: upstream primer E1F, downstream primer E1R, amplification First Exon homology arm E1B, object fragment length 3370bp.Adopt 25 μ L reaction system (table 2):

Table 2 homology arm sequence amplification system

PCR response procedures: 94 DEG C of 5min; 94 DEG C of 30s, 66 DEG C of 30s, 72 DEG C of 5min, totally 36 circulations; 72 DEG C of 5min, 4 DEG C of preservations.

1.4 homology arms are connected with carrier T

Glue reclaims First Exon homology arm pcr amplification product E1B, and is connected with pMD18-T sample carrier, builds homology arm carrier T pT-mExon1.Linked system 10 μ L (table 3):

Table 3 homology arm sequence and carrier T linked system

Put into 16 DEG C of water-baths to spend the night connection, obtain link product.

The conversion of 1.5 connection products

(1) (competent cell, from-80 DEG C of taking-ups, is placed in and treats that it dissolves on ice) in DH5a intestinal bacteria (Escherichia coli) competent cell of 50 μ L ice baths is added by connecting product in 5 μ L 1.4.

(2) light thrum centrifuge tube makes connection product mix with competence, leaves standstill 30min in ice.

(3) 42 DEG C of heat shock 90s, leave standstill 5min in fast transfer to ice.

(4) 700 μ L non-resistant LB substratum are added.

1h is cultivated in (5) 37 DEG C of concussions, and bacterium is recovered, and expresses resistance protein.

(6) after 1h, the centrifugal 2min of 3000r/min, abandons 600 μ L supernatants, by gained cell piping and druming mixing also coated plate.

Coated plate puts into 37 DEG C of constant incubator overnight incubation.Next day picking grow fine mono-clonal bacterium colony line, do bacterium colony PCR primary dcreening operation positive colony.Sieving positive colony shakes bacterium upgrading grain, is First Exon homology arm carrier T pT-mExon1.

1.6 homologous recombination targeting vector object fragment PCR amplifications

For mouse beta-casein gene First Exon left and right arms, the amplimer of design containing BsmBI restriction enzyme site.The long 1156bp of left arm upstream and downstream primer B1LF/B1LR, amplification object fragment B1L; The long 1033bp of right arm upstream and downstream primer B1RF/B1RR, amplification object fragment B1R.For the red fluorescent protein gene order imported between left and right arms, the long 914bp of design upstream and downstream primer Red1F/Red1R, amplification object fragment Red1.

With First Exon homology arm carrier T pT-mExon1 for template, respectively with B1LF/B1LR and B1RF/B1RR for primer, amplification homologous recombination object fragment B1L and B1R; With pDsRed2-1 vector plasmid for template, take Red1F/Red1R as primer, the red fluorescent protein gene fragment Red1 imported between amplification left and right arms.

Above amplified reaction all adopts 50 μ L reaction system (table 4):

Table 4 targeting vector object fragment PCR amplification system

PCR response procedures: 94 DEG C of 3min; 94 DEG C of 20s, 50 DEG C of 15s, 68 DEG C of 2min, totally 36 circulations; 72 DEG C of 5min.Glue reclaims and detects, and-20 DEG C save backup.

1.7 intermediate carrier pEGFP-N1-BsmBI build

Because common carrier multiple clone site II type restriction endonuclease recognition sequence has palindrome, the sticky end that cutting produces is reverse complementary sequence.Reverse complemental sticky end exists, and may reduce the efficiency of " Golden Gate " cloning.For implementing " Golden Gate " cloning approach smoothly, eukaryotic expression vector pEGFP-N1 transforms by the present embodiment, import the exogenous dna fragment containing BsmBI restriction enzyme site in one section of two ends at pEGFP-N1 vector multiple cloning site, construct pEGFP-N1-BsmBI intermediate carrier.

Analyze mouse beta-casein gene with DNAMAN, find one section in its downstream not containing the DNA sequence dna of BsmBI, BglII and EcoRI restriction enzyme site, in its two ends design of amplification primers.Upstream primer ZTF, adds BglII and BsmBI restriction enzyme site successively; Downstream primer ZTR, adds EcoRI and BsmBI restriction enzyme site successively.Amplification length is the exogenous dna fragment of 594bp.

Exogenous dna fragment BsmBIE8, through BglII/EcoRI double digestion, is cloned and is entered pEGFP-N1 carrier, builds and obtains pEGFP-N1-BsmBI intermediate carrier (as shown in Figure 2).

(1) foreign DNA Insert Fragment amplification

Take ZTF/ZTR as primer, amplification, for inserting the exogenous dna fragment BsmBIE8 of pEGFP-N1 vector multiple cloning site, adopts 50 μ L reaction system (table 5):

Table 5 foreign DNA Insert Fragment amplification system

PCR response procedures: 94 DEG C of 5min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1.5min, totally 36 circulations; 72 DEG C of 5min.Glue reclaims and detects, and-20 DEG C save backup.

(2) connection of pEGFP-N1 and Insert Fragment BsmBIE8

With BglII and EcoRI double digestion eukaryotic expression vector pEGFP-N1 and Insert Fragment BsmBIE8, glue reclaims and detects and connect with Rapid DNA Ligation Kit.Linked system 20 μ L (table 6):

The connection of table 6pEGFP-N1 and Insert Fragment BsmBIE8

(3) intermediate carrier pEGFP-N1-BsmBI transformed competence colibacillus cell

Above-mentioned ligation system is put in 22 DEG C and hatches 5min, get 10 μ L and connect product conversion DH5a competent escherichia coli cell.37 DEG C of constant incubator overnight incubation are put into by being coated with flat board.Next day picking grow fine mono-clonal line, be bacterium colony PCR and screen.PCR screening positive clone shakes bacterium upgrading grain.

1.8 " Golden Gate " cloning assembling homologous recombination targeting vector

First quantitative with agarose gel electrophoresis, adjustment object fragment B1L, Red1, B1R concentration are to 45ng/ μ L, and adjustment intermediate carrier plasmid pEGFP-N1-BsmBI concentration is to 80ng/ μ L.Recombinant target carrier adopts 10 μ L reaction system (table 7):

Table 7 homologous recombination targeting vector assembly system

Reaction conditions: 37 DEG C of 5min, 16 DEG C of 5min, totally 25 circulations, 80 DEG C of deactivation 20min.

Get 5 μ L and connect product conversion DH5a competent cell.Spend the night 37 DEG C and cultivate, choose 20 mono-clonal bacterium colonies grown fine, LB plate streaking 37 DEG C cultivation, after cultivating 6h, do bacterium colony PCR screening positive clone, shake bacterium and extract plasmid as mouse beta-casein-Red expression vector.

Embodiment 2 " Golden Gate " cloning builds TALE-TFs expression vector

This enforcement object is acquisition four kinds of TALE-TF plasmids, is respectively TALE-TF plasmid 1, TALE-TF plasmid 2, TALE-TF plasmid 3 and TALE-TF plasmid 4.

Build flow process: first pcr amplification obtains RVD monomer module DNA, then uses " Golden Gate " cloning by N ₁n ₂n ₃n ₄n ₅n ₆, N ₇n ₈n ₉n ₁₀n ₁₁n ₁₂and N ₁₃n ₁₄n ₁₅n ₁₆n ₁₇n ₁₈assembling formation 3 annular 6 aggressiveness respectively.In each " Golden Gate " reaction system, BsmBI enzyme cuts RVD monomer DNA fragmentation, and produce the DNA fragmentation that sticky end is complementary successively, these sticky ends connect in turn, is formed not containing annular 6 aggressiveness of RVD repeating unit series connection of BsmBI restriction enzyme site.Then carry out pcr amplification with annular 6 aggressiveness for template and obtain linear 6 aggressiveness, TALE-TFs skeleton plasmid and 3 linear 6 aggressiveness are cut with BsaI enzyme, produce the DNA fragmentation that sticky end is complementary successively, connect the sticky end of DNA fragmentation again by " Golden Gate " cloning in turn, obtain artificial T ALE-TFs plasmid.

2.1 materials and reagent

TALE Toolbox test kit is provided by Addgene (http://www.addgene.org).This test kit is made up of 13 plasmids, 5 RVD monomer template plasmid: pNI_v2, pNG_v2, pHD_v2, pNN_v2, pNH_v2, RVD monomer template genes encoding 34 amino acid; 4 TALE-TF skeleton plasmid: pTALE-TF_v2 (NI), pTALE-TF_v2 (NG), pTALE-TF_v2 (HD), pTALE-TF_v2 (NN); 4 TALEN skeleton plasmid: pTALEN_v2 (NI), pTALEN_v2 (NG), pTALEN_v2 (HD), pTALEN_v2 (NN).

Herculase II fusion polymerase is purchased from Agilent Technologies, Esp3I (BsmBI), AfeI is purchased from Fermentas, BsaI-HF is purchased from NEW England Biolabs, T7 DNA ligase is purchased from Enzymatics, PlasmidSafe ATP-dependent DNase is purchased from Epicentre, sepharose reclaims test kit, the reagent such as the little extraction reagent kit of plasmid are purchased from Sangon Biotech (Shanghai) Co., Ltd., DL10 000 DNA Marker, DL2 000 DNA Marker is purchased from precious biotechnology (Dalian) company limited, Marker VII, DH5a intestinal bacteria (Escherichia coli) competent cell is purchased from TIANGEN Biotech (Beijing) Co., Ltd., nucleic acid dye GELVIEW is purchased from Beijing hundred Tyke Bioisystech Co., Ltd, primer synthesis is completed by Invitrogen company.

The determination of 2.2 TALE target spot recognition sequences

In mouse beta-casein gene promoter sequence, the DNA sequence dna selecting one section of 19bp long is as target sequence.Artificial T ALE target sequence carries out identifying (5 ＇-N according to the direction of 5 ＇ to 3 ＇ ₁n ₂n ₃n ₄n ₅n ₆n ₇n ₈n ₉n ₁₀n ₁₁n ₁₂n ₁₃n ₁₄n ₁₅n ₁₆n ₁₇n ₁₈n ₁₉-3 '), front 18 bases are determined by artificial constructed RVD repeating unit concatermer, and last base (N19) is determined by half RVD repeating unit of TALE-TF expression plasmid skeletal internal.For effectively preventing effect of missing the target, the target sequence building TALE-TF should be not too short, general recommendations 16-30bp.The present embodiment selects length 19bp.

Mouse beta-casein gene promotor TALE-TFs target spot DNA sequence dna:

TFm1 gaagggactttttgagtat

TFm2 tgagtatcttacaaaccac

tcttggaattgaagggactttttgagtatcttacaaaccacaaaattagcatgtcattaagtgcag cggt SEQ ID NO.5

Note: square frame is TATA box sequence

TFm1 target spot DNA sequence dna: tgaagggactttttgagtat, its corresponding RVD sequence:

NN-NI-NI-NN-NN-NN-NI-HD-NG-NG-NG-NG-NG-NN-NI-NN-NG-NI-NG or

NH-NI-NI-NH-NH-NH-NI-HD-NG-NG-NG-NG-NG-NH-NI-NH-NG-NI-NG

TFm2 target spot DNA sequence dna: ttgagtatcttacaaaccac, its corresponding RVD sequence:

NG-NN-NI-NN-NG-NI-NG-HD-NG-NG-NI-HD-NI-NI-NI-HD-HD-NI-HD or

NG-NH-NI-NH-NG-NI-NG-HD-NH-NH-NI-HD-NI-NI-NI-HD-HD-NI-HD

2.3 RVD fragment amplifications

TALE Toolbox construction procedures needs pcr amplification RVD monomer 72.Analyze TALE Toolbox construction procedures, in 72 monomers of amplification, have 48 to repeat 3 times.Therefore, it is possible to reduce by 32 monomer amplifications, only amplification 40 monomers, alleviate the workload that follow-up glue reclaims, reduce the error of quantitative RVD monomer fragment.Amplification RVD fragment primer used is in table 8, and primer pairing is in table 9.

Table 8 TALE builds primer sequence

Table 9 primer pairing scheme

N represents A (NI), T (NG), C (HD), G (NN or NH); Intermediate monomer 8,9,10,11 and 14,15,16,17 primers and monomer 2,3,4,5 primer just the same.

With corresponding pNI_v2, pNG_v2, pHD_v2, pNN_v2, pNH_V2RVD monomer plasmid for template, corresponding primer pair pcr amplification is utilized to obtain RVD monomer.Adopt 100 μ L reaction system (table 10):

Table 10 RVD fragment amplification system

PCR response procedures: 95 DEG C of denaturation 2min; 95 DEG C of sex change 20s, 60 DEG C of annealing 20s, 72 DEG C extend 10s, totally 32 circulations; Last 72 DEG C extend 3min, 4 DEG C of preservations.For ensureing that the concentration of the rear monomer of agarose gel purification recovery can reach needed for next step experiment, each monomer 100 μ L reaction system amplification two pipe.Agarose gel purification reclaims pcr amplification product.

Pcr amplification gained monomer runs glue, and determines each monomer concentration with Quantity One quantitative analysis.Each monomer sample loading 1 μ L, DNA standard quantitative Marker appropriate (2-5 μ L) time quantitative, 120v leakage of electricity swimming is until standard quantitative Marker all pulls open.Each monomer concentration is adjusted according to quantitative gained concentration value.

Monomer 1 in the present embodiment, 6,7,12,13,18 final concentrations are adjusted to 18ng/ μ L, and all the other are adjusted to 15ng/ μ L.

The assembling of 2.4 annular 6 aggressiveness

According to the corresponding RVD sequence of TFm1: NN-NI-NI-NN-NN-NN-NI-HD-NG-NG-NG-NG-NG-NN-NI-NN-NG-NI-NG, by " Golden Gate " cloning by N ₁n ₂n ₃n ₄n ₅n ₆, N ₇n ₈n ₉n ₁₀n ₁₁n ₁₂and N ₁₃n ₁₄n ₁₅n ₁₆n ₁₇n ₁₈assembling formation 3 annular 6 aggressiveness, in RVD sequence, monomer presses tandem by 1 open numbering, final RVD monomer N ₁₉thered is provided by TALE-TFs skeleton plasmid.Repetition said process builds annular 6 aggressiveness that other RVD sequence pair are answered.Adopt 10 μ L reaction system (table 11):

The annular 6 aggressiveness assembly systems of table 11

Reaction conditions: 37 DEG C of 5min, 20 DEG C of 5min, totally 15 circulations, 4 DEG C of preservations.Because DTT is easily oxidized in atmosphere, so DTT used is now with the current in embodiment.

2.5 acyclic fragment digestion degradeds

After the first round " Golden Gate " reaction terminates, only have 6 aggressiveness of correct assembling can cyclisation.Non-cyclizing DNA fragmentation PlasmidSafe ATP-dependent DNase digests degraded, adopts 10 μ L reaction system (table 12):

Table 12 PlasmidSafe ATP-dependent DNase digests degraded system

Reaction conditions: 37 DEG C of 30min, 70 DEG C of 30min.

After PlasmidSafe DNase digestion reaction, reaction system is surplus annular 6 aggressiveness only, then make template with this, and increase linear 6 aggressiveness.

The amplification of 2.6 linear 6 aggressiveness

Adopt Hex-F and Hex-R primer, with annular 6 aggressiveness for template, pcr amplification obtains linear 6 segment fraction of polymer.Adopt 50 μ L reaction system (table 13):

The linear 6 aggressiveness amplification systems of table 13

PCR response procedures: 95 DEG C of 2min; 95 DEG C of 20s, 60 DEG C of 20s, 72 DEG C of 30s, totally 36 circulations; Last 72 DEG C extend 3min, 4 DEG C of preservations.For after guarantee sepharose recovery purifying, the concentration of monomer can reach needed for next step experiment, each six aggressiveness 50 μ L reaction systems amplification two pipes.

Agarose gel purification reclaims pcr amplification product, determines each 6 aggressiveness concentration (method is the same) with Quantity One quantitative analysis.According to each linear 6 aggressiveness concentration of quantitative gained concentration value adjustment to 20ng/ μ L.

2.7 eukaryon expression plasmid assemblings

Second takes turns " Golden Gate " cloning reaction, according to the corresponding RVD sequence of TFm1: NN-NI-NI-NN-NN-NN-NI-HD-NG-NG-NG-NG-NG-NN-NI-NN-NG-NI-NG, 3 corresponding annular 6 aggressiveness and TALE-TFs skeleton plasmid pTALE-TF_v2 (NG) assemble, and build TALE-TF plasmid 1.With identical process, respective annular 6 aggressiveness and TALE-TFs skeleton plasmid is adopted to build TALE-TF plasmid 2, TALE-TF plasmid 3 and TALE-TF plasmid 4 respectively.Before reaction, skeleton concentrations is adjusted to 100ng/ μ L.Adopt 10 μ L reaction system (table 14):

Table 14 eukaryon expression plasmid assembling reaction system

Reaction conditions: 37 DEG C of 5min, 20 DEG C of 5min, totally 21 circulations; Last 80 DEG C of deactivation 20min, 4 DEG C of preservations.

TALE-TF plasmid 1 and TALE-TF plasmid 2 corresponding target spot DNA sequence dna: tgaagggactttttgagtat, TALE-TF plasmid 1 comprises SEQ ID NO1 sequence and corresponding RVD sequence: NN-NI-NI-NN-NN-NN-NI-HD-NG-NG-NG-NG-NG-NN-NI-NN-NG-NI-NG; TALE-TF plasmid 2 comprises SEQ ID NO2 sequence and corresponding RVD sequence: NH-NI-NI-NH-NH-NH-NI-HD-NG-NG-NG-NG-NG-NH-NI-NH-NG-NI-NG.

TALE-TF plasmid 3 and TALE-TF plasmid 4 corresponding target spot DNA sequence dna: ttgagtatcttacaaaccac, TALE-TF plasmid 3 comprises SEQ ID NO3 sequence and corresponding RVD sequence: NG-NN-NI-NN-NG-NI-NG-HD-NG-NG-NI-HD-NI-NI-NI-HD-HD-NI-HD; TALE-TF plasmid 4 comprises SEQ ID NO4 sequence and corresponding RVD sequence: NG-NH-NI-NH-NG-NI-NG-HD-NH-NH-NI-HD-NI-NI-NI-HD-HD-NI-HD.

2.8 Plastid transformation

(1) the connection product 5 μ L containing corresponding plasmid obtained in 2.7 is added (competent cell, from-80 DEG C of taking-ups, is placed in and treats that it dissolves on ice) in DH5a intestinal bacteria (Escherichia coli) competent cell of 50 μ L ice baths.

(2) light thrum centrifuge tube makes connection product mix with competence, leaves standstill 5min in ice.

(3) 42 DEG C of heat shock 45s, leave standstill 5min in fast transfer to ice.

(4) 500 μ L non-resistant SOC substratum are added.

1h is cultivated in (5) 37 DEG C of concussions, and bacterium is recovered, and expresses resistance protein.

(6), after cultivating 1h, draw 100 μ L nutrient solutions and be applied to ammonia benzyl resistance LB flat board

(7) 37 DEG C of constant incubator overnight incubation are put into by being coated with flat board.

Dull and stereotyped after incubated overnight, next day, experimental group flat board can see a large amount of mono-clonal bacterium colony, and negative control group flat board can only see a little mono-clonal bacterium colony.

Embodiment 3 mouse primary Fibroblast cell-culture

Mouse primary inoblast is separated and cultivates

Get the Kunming small white mouse embryo of pregnant 18 ages in days, adopt and organize fast culture method, nutrient solution is DMEM, adds 15% foetal calf serum, 100mg/L penicillin and 100mg/L Streptomycin sulphate, at 37 DEG C, 5%CO ₂saturated humidity environment is cultivated, and obtains mouse primary inoblast.Changed nutrient solution 1 time every 2 days, within 5 days, go down to posterity 1 time.

Mouse primary inoblast is gone down to posterity.When mouse primary fibroblastic growth covers 80%-90% bottom culture dish, go down to posterity.Cell is washed 2 times, with 0.25% trypsin solution peptic cell 1 to 3min by PBS solution.When cellular form becomes bowlder, add the nutrient solution containing serum 15%, stop cell dissociation.With pipettor pressure-vaccum gently, the cell to culture dish is completely floating.Cell suspension is transferred in centrifuge tube, the centrifugal 10min of 400g.Retain cell precipitation, supernatant discarded.Add the abundant suspension cell of 1ml nutrient solution, proceed in Tissue Culture Dish by this suspension cell, add appropriate nutrient solution, rolling uniform cell, is placed in 37 DEG C, 5%CO ₂cultivate in saturated humidity incubator.

Embodiment 4 mouse primary inoblast electrotransfection plasmid

According to Amax Nucleofector II electroporation operation instructions, 1:50 times of premix S1 solution (10ml solution: 2g ATP-disodium salt, 1.2g MgCl2*6H ₂and S2 solution (500ml solution: 6g KH O) ₂pO ₄, 0.6g NaHCO ₃, 0.2g glucose) prepare electricity and turn liquid.Collect 2 × 10 ⁶individual mouse embryo fibroblasts, turns liquid suspension cell with 100ul electricity, adds except endotoxic TALE-TF plasmid 1 and beta-casein gene-red fluorescent protein reporter gene expression plasmid are by each 2.5ug, and mixing proceeds in electric shock cup.Select l cell electricity carryover sequence, electricity is implemented to mouse embryo fibroblasts and turns.Leave standstill 10min, add the DMEM nutrient solution suspension cell containing 15% foetal calf serum, the mouse embryo fibroblasts after electrotransfection is proceeded to 6 well culture plates, 37 DEG C, 5.0%CO ₂with saturated humidity CMC model, change nutrient solution after 6 hours 1 time.Electricity turns cell 36 hours observation of cell fluorescence protein gene expression effects.

Embodiment 5 TALE-TFs activates Red gene plasmid result and observes

With Laica inverted fluorescence microscope observation of cell.Observation of cell illumination effect under natural light, green fluorescence and red fluorescence light source, determines gene activation result respectively.TALE-TF plasmid 1 the results are shown in Figure 3.Fig. 3 is the imaging picture of the lower 3 kinds of Different Light of the same visual field.Owing to containing tandem expression green fluorescent protein (green fluorescent protein, GFP) gene in the TALE-TF plasmid 1 of structure, when expressing TALE-TFs albumen, GFP also expresses.In the middle part of Fig. 3 and right part relatively can see 1,2,3 and other mark cell be corresponding relation, i.e. fluoresced green also red-emitting fluorescent; And the cell of part fluoresced green does not send out red fluorescence.Transfection TALE-TF plasmid 1 controlled trial, observation of cell under red fluorescence, does not manifest fluorescence, is the dark visual field; The Red gene plasmid of transfection beta-casein gene promoters driven, observation of cell under red fluorescence, does not manifest red fluorescence, is the dark visual field (picture is unlisted).Illustrate in inoblast, TALE-TF plasmid 1 can activate beta-casein gene promotor in beta-casein gene-red fluorescent protein reporter gene expression plasmid.

Contriver repeats the step in embodiment 4 and 5, replaces TALE-TF plasmid 1 to test respectively, obtain result identical with above-mentioned with TALE-TF plasmid 2,3 or 4.

Above embodiment proves in l cell, l cell beta-casein gene promotor all can be activated with TALE-TF plasmid 1,2,3 or 4, so utilize TALE-TF plasmid of the present invention, testing goal gene can be carried out in inoblast, can as a kind of alternative method of mammary epithelial cell detection system.

Execute example and be only exemplary embodiment of the present invention, be not used in restriction the present invention, protection scope of the present invention is defined by the claims.Those skilled in the art can in essence of the present invention and protection domain, and make various amendment or equivalent replacement to the present invention, this amendment or equivalent replacement also should be considered as dropping in protection scope of the present invention.

Claims (5)

1. a DNA molecular, is characterized in that, the base sequence of described DNA molecular is for shown in SEQ ID NO.1 or SEQ ID NO.2, and its a kind of TALE-TFs that can encode, described TALE-TFs can identify the 11-29 position in SEQ ID NO.5.

2. an expression vector, is characterized in that, described expression vector comprises DNA molecular according to claim 1, and it can express a kind of TALE-TFs.

3. a reconstitution cell, is characterized in that, described reconstitution cell uses the prokaryotic cell prokaryocyte or eukaryotic cell that described in claim 2, expression vector transforms.

4. detect the method that target gene is expressed, it is characterized in that,

Steps A, target gene is proceeded to mouse beta-casein gene, build the mouse beta-casein gene expression vector containing target gene;

Step B, design TALE arrangement according to mouse beta-casein gene promotor target sequence TFm1, and the expression vector of construction expression TALE-TFs; Wherein said mouse beta-casein gene promotor target sequence TFm1 is the 11-29 position in SEQ ID NO.5;

Step C, with described containing the mouse beta-casein gene expression vector of target gene and the expression vector cotransfection inoblast of described expression TALE-TFs;

Step D, in inoblast, detect the expression of target gene.

5. the method for detection target gene expression according to claim 4, it is characterized in that, the expression vector of expressing TALE-TFs described in step B comprises DNA molecular according to claim 1.