CN113122561B - Expression vector of membrane protein SohB and expression and purification method thereof - Google Patents

Abstract

The invention discloses an expression vector of membrane protein SohB and an expression and purification method thereof. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and comprises: phage T7 promoter; an E.coli ribosome binding site comprising the sequence CCATGG of NcoI, the sequence SohB of E.coli membrane protein shown in SEQ ID NO.1 and the BamHI site GGATCC; tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; ndeI restriction enzyme site CATATG; a super-folded Venus fluorescent protein coding sequence; xhoI cleavage site CTCGAG;6 histidine sites and stop codon TAG. The invention uses the fluorescent protein with molecular rigidity as a screening mark and an expression progress indicator, and the fluorescent protein can be rapidly folded due to the molecular level rigid structure, so that the nitrogen end membrane protein SohB can be helped to stabilize the conformation. The expression vector constructed by the invention can realize the mass expression of membrane protein SohB, and can be used for the subsequent high-throughput screening of novel antibiotics.

Description

Expression vector of membrane protein SohB and expression and purification method thereof

Technical Field

The invention belongs to the technical field of protein production, and relates to an expression vector of a functional unknown transport protein (SohB) and an expression and purification method thereof.

Background

Cell membranes are the boundary between the inside and outside of cells, and are the most important organelles, carrying important functions of information transfer, energy transfer and mass exchange. Targets for drug action are often located on cell membranes. It is currently known that more than 50% of the targets of drug action are membrane proteins. Therefore, the method has very important significance for researching membrane proteins.

However, membrane proteins have a structure of multiple transmembrane processes due to their scarce content in their natural state, and thus are prone to errors in folding and have a complex structure, so that large-scale production of membrane proteins has been a difficulty and a hot spot. In China, no biological company can express more than 12 times of transmembrane proteins, and only one or two companies can express four times of transmembrane proteins.

Coli has been the first choice for protein expression as a commonly used expression host, however, even the E.coli self-protein is difficult to express in large quantities in E.coli. At present, the abuse of antibiotics faces the embarrassment of being unable to fight drug-resistant bacteria in the next 50 years. Therefore, the method provides a pilot technical support for the high-throughput screening of the follow-up non-denaturing mass spectrum by using a large amount of expressed membrane proteins as the acting targets of antibiotics.

Disclosure of Invention

The invention aims to provide an expression vector for expressing a large amount of membrane protein SohB and an expression and purification method thereof. The invention establishes a high-efficiency fusion expression system aiming at escherichia coli membrane protein SohB, and can be used for subsequent further protein non-denaturation real-time monitoring mass spectrum research.

The technical scheme for realizing the purpose of the invention is as follows:

the membrane protein SohB expression vector of the invention takes the hyper-folding Venus fluorescent protein (Chinese patent application 201910347575.3) for positioning the chlamydomonas reinhardtii protein obtained in the laboratory as an initial protein skeleton, and obtains a fluorescent protein expression tag with molecular rigidity by further optimizing codon composition used for sequence expression, and is suitable for large-scale expression of escherichia coli membrane protein. The invention uses the fluorescent protein with molecular rigidity as a screening mark and an expression progress indicator, and the fluorescent protein can be rapidly folded due to the molecular level rigid structure, and helps the nitrogen end membrane protein SohB to stabilize the conformation thereof.

The expression vector of the membrane protein SohB is expression plasmid pLy077-SohB (SEQ ID NO. 2), and comprises: phage T7 promoter; an E.coli ribosome binding site comprising the sequence NcoI, CCATGG, the E.coli membrane protein SohB sequence (SEQ ID NO. 1) and the BamHI site GGATCC; tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; ndeI restriction enzyme site CATATG; a super-folded Venus fluorescent protein coding sequence; xhoI cleavage site CTCGAG;6 histidine sites and stop codon TAG.

The invention also provides an expression and purification method of the membrane protein SohB expression vector, which comprises the following specific steps:

step 1, preparation of an escherichia coli membrane protein SohB expression vector mutant strain: transforming an expression vector of membrane protein SohB, namely expression plasmid pLy077-SohB, into host escherichia coli, coating the host escherichia coli with an antibiotic-containing and 0.1mM IPTG agar plate, and selecting yellow-green positive monoclonal bacteria for amplification culture and induced expression;

step 2, inoculating the selected mutant strain transformant into a culture medium for expansion culture, and using 1mM IPTG to induce and express membrane protein SohB on a large scale.

Preferably, in step 1, the E.coli is E.coli DH 5. Alpha. Or E.coli BL21 (DE 3).

Preferably, in step 2, the culture medium is LB culture medium or TB culture medium.

The invention introduces the target gene and the super-folding Venus fluorescent protein with molecular rigidity which is optimized by codons into the expression vector through the total synthesis of the expression vector, and greatly improves the transcription and translation efficiency of the target gene through optimizing the nucleic acid coding primary sequence. In addition, by controlling the folding rate of the carboxy-terminal rigid fluorescent protein, the target membrane protein is helped to fold correctly and insert into the membrane. The rigid fluorescent protein can be used for monitoring the real-time expression process of the protein and protecting the carboxyl end of the protein, so that the target protein is enriched. The invention realizes high-flux screening of novel antibiotics by expressing a large amount of escherichia coli membrane protein and purifying the escherichia coli membrane protein in the later period, and has important commercialized prospect.

Drawings

FIG. 1 is a diagram showing the result of PCR agarose gel electrophoresis of the coding sequence of SohB nucleic acid.

FIG. 2 is a schematic diagram of the structure of the pLy077-SohB plasmid.

FIG. 3 is a graph showing the results of PCR assay of pLy077-SohB colonies.

FIG. 4 is a graph showing the result of single-cut double-cut agarose gel electrophoresis of NcoI and BamHI of plasmid pLy 077-SohB.

FIG. 5 is a fluorescent image of colonies on a transformation agar plate.

FIG. 6 is a graph showing fluorescence imaging after induction and comparing whole mycoproteins before and after induction.

Detailed Description

The invention is further described below with reference to specific examples and figures, but is not limited thereto. The procedures, conditions, reagents, experimental methods, etc. for carrying out the present invention are common knowledge and common knowledge in the art, except for those specifically mentioned below, and the present invention is not particularly limited.

The materials used in the examples are as follows:

1. cell origin

Coli DH 5. Alpha., BL21 (DE 3), C41 (DE 3), C43 (DE 3) strains were purchased from Wuhan Ling vast Biocompany.

2. Plasmid origin

pLy077 plasmid and SohB coding sequence were synthesized by Shanghai Biotechnology Inc., pLy077 plasmid comprises: phage T7 promoter; an E.coli ribosome binding site comprising the NcoI sequence CCATGG and the BamHI site GGATCC; tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; ndeI restriction enzyme site CATATG; a super-folded Venus fluorescent protein coding sequence; xhoI cleavage site CTCGAG;6 histidine sites and stop codon TAG. The pLy077 plasmid and SohB coding sequence are shown in the sequence table.

3. Primer source

The synthetic primers were all from Beijing Optimu Biotechnology Co.

4. Main reagent

Tryptone, yeast extract, naCl, tris-base were all purchased from Sigma company; restriction endonucleases, phusion enzymes were purchased from Thermo Fisher company; rTaq enzyme, T4 ligase was purchased from Takara. Plasmid miniprep kit and gel recovery kit were purchased from Axygen company. NTP, DEPC water, RNase inhibitor were purchased from Shanghai Biotechnology Inc.

EXAMPLE 1 Gene cloning of SohB

Cloning of SohB

a) A brand new SohB coding sequence (SEQ ID NO. 1) is designed and synthesized according to the codon usage frequency of the SohB sequence and the Escherichia coli codon usage frequency under the Kazusa online database (http:// www.kazusa.or.jp/codon /). And then amplified by a PCR method. The PCR reaction system configuration is shown in Table 1.

TABLE 1 preparation of PCR reaction System Table

The PCR results are shown in FIG. 1. The length of the target fragment is 1068bp, and the optimal annealing temperature is 52 ℃.

b) Recovering target DNA, cutting target fragment and pLy077 vector with NcoI and BamHI, performing agarose gel electrophoresis, and recovering enzyme cutting product; the recovered target fragment and pLy077 vector fragment were added to a small centrifuge tube at a molar ratio of 5:1, T4 ligase was added, and ligation was performed overnight at 16 ℃.

c) 20. Mu.L of the above ligation product was transformed into 80. Mu.L of DH 5. Alpha. Competent cells by a heat shock method at 42℃and placed in a shaker at 37℃after 700. Mu.L of LB medium, followed by culturing at 200 rpm for 45 minutes.

d) Centrifuging the bacterial liquid at 4000 rpm for 1 minute, and sucking 700 mu L of supernatant; after the residual medium was gently sucked by pipetting, it was spread on LB solid plates containing ampicillin, inverted and incubated in an incubator at 37℃for 12 hours.

e) The single colony in the flat plate is selected, a plasmid is extracted after a small amount of amplification, the extracted plasmid is subjected to single enzyme digestion and double enzyme digestion by using NcoI and BamHI, then agarose gel electrophoresis identification is carried out, sequencing identification is carried out correctly, and the expression vector pLy077-SohB of membrane protein SohB is obtained, and the structural schematic diagram of the plasmid is shown in figure 2. FIG. 3 is a graph showing the results of PCR assay of pLy077-SohB colonies. FIG. 4 is a graph showing the result of single-cut double-cut agarose gel electrophoresis of NcoI and BamHI of plasmid pLy 077-SohB.

EXAMPLE 2SohB expression

Induction expression of fusion protein SohB-super folding fluorescent protein

Transferring the pLy077-SohB plasmid which is identified correctly into an escherichia coli expression host BL21 (DE 3) and DH5 alpha, and coating the escherichia coli expression host BL21 and DH5 alpha on a colony containing 0.1mM isopropyl thiogalactoside (IPTG) to obtain stable transformation; by detecting fluorescence of colonies, FIG. 5 is a graph showing fluorescence of colonies on a transformation agar plate, and it can be seen that a large amount of mutants expressing a target protein were obtained, since the presence or absence of fluorescence can be used to determine whether the colonies contain a recombinant plasmid, and the colonies containing the recombinant plasmid exhibit fluorescence.

Single colonies were inoculated into LB and TB liquid media containing 100. Mu.g/ml ampicillin, and cultured overnight at 37℃at 200 rpm to give overnight bacteria. Inoculating overnight bacteria into 750mL LB and TB culture medium at a ratio of 1:250, culturing at 30deg.C to OD at 230 rpm ₆₀₀ Reaching 0.8-1.0, adding IPTG with final concentration of 0.5mM, and culturing at 25deg.C for 2-6 hr. The cells were collected by centrifugation at 4000 rpm for 15 minutes. And (3) suspending the strain in PBS buffer solution, and centrifuging for 15 minutes at 4000 rpm to obtain the strain containing the SohB fusion expression protein. FIG. 6 is a graph showing fluorescence imaging after induction and comparing whole mycoproteins before and after induction. As can be seen from FIG. 6, the E.coli BL21 (DE 3) was used as the expression strain, and after 4 hours of induction in TB medium, the SohB protein expression level was the highest.

Sequence listing

<110> university of Nanjing's science

<120> expression vector of membrane protein SohB and expression purification method thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1047

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggaactgc tgagcgaata tggcctgttt ctggcgaaaa ttgtgaccgt ggtgctggcg 60

attgcggcga ttgcggcgat tattgtgaac gtggcgcagc gcaacaaacg ccagcgcggc 120

gaactgcgcg tgaacaacct gagcgaacag tataaagaaa tgaaagaaga actggcggcg 180

gcgctgatgg atagccatca gcagaaacag tggcataaag cgcagaaaaa aaaacataaa 240

caggaagcga aagcggcgaa agcgaaagcg aaactgggcg aagtggcgac cgatagcaaa 300

ccgcgcgtgt gggtgctgga ttttaaaggc agcatggatg cgcatgaagt gaacagcctg 360

cgcgaagaaa ttaccgcggt gctggcggcg tttaaaccgc aggatcaggt ggtgctgcgc 420

ctggaaagcc cgggcggcat ggtgcatggc tatggcctgg cggcgagcca gctgcagcgc 480

ctgcgcgata aaaacattcc gctgaccgtg accgtggata aagtggcggc gagcggcggc 540

tatatgatgg cgtgcgtggc ggataaaatt gtgagcgcgc cgtttgcgat tgtgggcagc 600

attggcgtgg tggcgcagat gccgaacttt aaccgctttc tgaaaagcaa agatattgat 660

attgaactgc ataccgcggg ccagtataaa cgcaccctga ccctgctggg cgaaaacacc 720

gaagaaggcc gcgaaaaatt tcgcgaagaa ctgaacgaaa cccatcagct gtttaaagat 780

tttgtgaaac gcatgcgccc gagcctggat attgaacagg tggcgaccgg cgaacattgg 840

tatggccagc aggcggtgga aaaaggcctg gtggatgaaa ttaacaccag cgatgaagtg 900

attctgagcc tgatggaagg ccgcgaagtg gtgaacgtgc gctatatgca gcgcaaacgc 960

ctgattgatc gctttaccgg cagcgcggcg gaaagcgcgg atcgcctgct gctgcgctgg 1020

tggcagcgcg gccagaaacc gctgatg 1047

<210> 2

<211> 7042

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggcatgg aactgctgag cgaatatggc 5100

ctgtttctgg cgaaaattgt gaccgtggtg ctggcgattg cggcgattgc ggcgattatt 5160

gtgaacgtgg cgcagcgcaa caaacgccag cgcggcgaac tgcgcgtgaa caacctgagc 5220

gaacagtata aagaaatgaa agaagaactg gcggcggcgc tgatggatag ccatcagcag 5280

aaacagtggc ataaagcgca gaaaaaaaaa cataaacagg aagcgaaagc ggcgaaagcg 5340

aaagcgaaac tgggcgaagt ggcgaccgat agcaaaccgc gcgtgtgggt gctggatttt 5400

aaaggcagca tggatgcgca tgaagtgaac agcctgcgcg aagaaattac cgcggtgctg 5460

gcggcgttta aaccgcagga tcaggtggtg ctgcgcctgg aaagcccggg cggcatggtg 5520

catggctatg gcctggcggc gagccagctg cagcgcctgc gcgataaaaa cattccgctg 5580

accgtgaccg tggataaagt ggcggcgagc ggcggctata tgatggcgtg cgtggcggat 5640

aaaattgtga gcgcgccgtt tgcgattgtg ggcagcattg gcgtggtggc gcagatgccg 5700

aactttaacc gctttctgaa aagcaaagat attgatattg aactgcatac cgcgggccag 5760

tataaacgca ccctgaccct gctgggcgaa aacaccgaag aaggccgcga aaaatttcgc 5820

gaagaactga acgaaaccca tcagctgttt aaagattttg tgaaacgcat gcgcccgagc 5880

ctggatattg aacaggtggc gaccggcgaa cattggtatg gccagcaggc ggtggaaaaa 5940

ggcctggtgg atgaaattaa caccagcgat gaagtgattc tgagcctgat ggaaggccgc 6000

gaagtggtga acgtgcgcta tatgcagcgc aaacgcctga ttgatcgctt taccggcagc 6060

gcggcggaaa gcgcggatcg cctgctgctg cgctggtggc agcgcggcca gaaaccgctg 6120

atgggatccg gactgcagga gaacctgtac ttccaatccc accatatgtc taaaggtgaa 6180

gaactgttca ccggtgttgt tccgatcctg gttgaactgg acggtgacgt taacggtcac 6240

aaattctctg ttcgtggtga aggtgaaggt gacgctacca acggtaaact gaccctgaaa 6300

ttcatctgca ccaccggtaa actgccggtt ccgtggccga ccctggttac caccctgacc 6360

tacggtgttc agtgcttctc tcgttacccg gaccacatga aacgtcacga cttcttcaaa 6420

tctgctatgc cggaaggtta cgttcaggaa cgtaccatct ctttcaaaga cgacggtacc 6480

tacaaaaccc gtgctgaagt taaattcgaa ggtgacaccc tggttaaccg tatcgaactg 6540

aaaggtatcg acttcaaaga agacggtaac atcctgggtc acaaactgga atacaacttc 6600

aactctcaca acgtttacat caccgctgac aaacagaaaa acggtatcaa agctaacttc 6660

aaaatccgtc acaacgttga agacggttct gttcagctgg ctgaccacta ccagcagaac 6720

accccgatcg gtgacggtcc ggttctgctg ccggacaacc actacctgtc tacccagtct 6780

gttctgtcta aagacccgaa cgaaaaacgt gaccacatgg ttctgctgga attcgttacc 6840

gctgctggta tcacccacgg tatggacgaa ctgtacaaac tcgagcacca ccaccaccac 6900

cactgagatc cggctgctaa caaagcccga aaggaagctg agttggctgc tgccaccgct 6960

gagcaataac tagcataacc ccttggggcc tctaaacggg tcttgagggg ttttttgctg 7020

aaaggaggaa ctatatccgg at 7042

Claims (4)

1. The expression vector of the membrane protein SohB is characterized in that the expression vector is an expression plasmid pLy077-SohB, the nucleotide sequence of which is shown as SEQ ID NO.2, and comprises: phage T7 promoter; e.coli ribosome binding sites; an NcoI sequence CCATGG, an escherichia coli membrane protein SohB sequence shown in SEQ ID NO.1 and a BamHI site GGATCC; tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; ndeI restriction enzyme site CATATG; a super-folded Venus fluorescent protein coding sequence; xhoI cleavage site CTCGAG;6 histidine sites and stop codon TAG.

2. The method for purifying the expression vector of the membrane protein SohB according to claim 1, which is characterized by comprising the following specific steps:

step 1, preparation of an escherichia coli membrane protein SohB expression vector mutant strain: transforming an expression vector of membrane protein SohB, namely expression plasmid pLy077-SohB, into host escherichia coli, coating the host escherichia coli with an antibiotic-containing and 0.1mM IPTG agar plate, and selecting yellow-green positive monoclonal bacteria for amplification culture and induced expression;

step 2, inoculating the selected mutant strain transformant into a culture medium for expansion culture, and using 1mM IPTG to induce and express membrane protein SohB on a large scale.

3. The expression purification method according to claim 2, wherein in step 1, the E.coli is E.coli DH 5. Alpha. Or E.coli BL21 (DE 3).

4. The expression purification method according to claim 2, wherein in step 2, the medium is LB medium or TB medium.