CN114574511B

CN114574511B - Extremely heat-resistant xylanase gene, extremely heat-resistant xylanase and application thereof

Info

Publication number: CN114574511B
Application number: CN202210364143.5A
Authority: CN
Inventors: 时号; 言行; 聂新玲; 李青飞; 高凤; 李相前
Original assignee: Huaiyin Institute of Technology
Current assignee: Hunan Suneast Biotechnology Co ltd
Priority date: 2021-12-31
Filing date: 2022-04-07
Publication date: 2023-09-22
Anticipated expiration: 2042-04-07
Also published as: CN114574511A

Abstract

The invention discloses a heat-resistant xylanase gene, heat-resistant xylanase and application thereof, wherein the sequence of the heat-resistant xylanase gene is shown as SEQ ID NO. 1; the amino acid sequence of the extremely heat-resistant xylanase is shown as SEQ ID NO. 2. The modified gene-encoded extremely heat-resistant xylanase has the characteristics of extremely strong heat resistance and high activity under the condition of acidic pH, has the highest enzyme activity under the condition of 95 ℃ and pH of 5.5, has the specific enzyme activity reaching 151 mu mol/mgmin, and has obviously improved heat resistance from 80 ℃ to 95 ℃. Compared with the prior xylanase, the extremely heat-resistant xylanase has greater superiority, can exert good heat-resistant and acid-resistant performances in the industries of food production, feed fermentation, paper making and the like, improves the material utilization rate and reduces the pollution to the environment.

Description

Extremely heat-resistant xylanase gene, extremely heat-resistant xylanase and application thereof

Technical Field

The invention relates to the field of genetic engineering technology and biomass utilization, in particular to a very heat-resistant xylanase gene, a very heat-resistant xylanase and application thereof.

Background

Xylan is a renewable resource with rich content, and the monosaccharide and oligosaccharide obtained after hydrolysis can be widely applied to industries such as food, papermaking, textile and the like. Xylan hydrolysis is usually carried out in production by either acid hydrolysis or enzymatic hydrolysis. Acid hydrolysis enables rapid xylose formation from xylan, which has been widely used in xylose production plants, but forms toxic substances in addition to xylose during acid hydrolysis, which is extremely environmentally unfriendly. Along with the continuous expansion of the application range of the enzymatic hydrolysis technology in the industrial field, the enzymatic hydrolysis hemicellulose xylose can maintain the original production efficiency, reduce the influence on the subsequent production, and is green, energy-saving and environment-friendly, so that the enzymatic hydrolysis hemicellulose xylose can be used as an efficient industrial enzyme preparation.

The research on the current reported literature shows that the most suitable hydrolysis condition of the existing xylanase is neutral and medium-low temperature, for example, the most suitable pH value of the xylanase from the chorifola frondosa is 7.0, and the most suitable temperature is 70 ℃; xylanase derived from Asteriomyces sp.TM76 has an optimum pH of 6.5 and an optimum temperature of 55deg.C; the xylanase derived from Talaromyces thermophilus has an optimum pH of 7 and an optimum temperature of 80 ℃. However, hemicellulose resources, especially production related to xylan hydrolysis, are mainly carried out under high-temperature and acidic conditions, and the existing xylanase resources cannot have both high-temperature resistance and acid resistance, so that the effect is poor in the actual production process, and the application potential of xylanase cannot be fully exerted under the conditions of food additives and the like.

Therefore, it is necessary to develop and construct heat-resistant and acid-resistant recombinant xylanase, and optimize the structure of the enzyme by protein engineering technology aiming at molecular transformation so as to obtain industrial enzyme with better heat stability, expand the application field and improve the application value, so that the recombinant xylanase can be used as a high-efficiency industrial enzyme preparation.

Disclosure of Invention

The invention aims to: aiming at the defects of xylanase in heat resistance and acid resistance in the prior art and under the condition of limited practical application in aspects of feed fermentation and food additives, the invention provides a very heat-resistant xylanase gene, and the very heat-resistant xylanase gene codes to obtain xylanase capable of hydrolyzing xylan at lower pH and high temperature, and the xylanase has certain heat stability and acid resistance, so that the xylanase can meet the use requirements in high-temperature acid occasions such as beer fermentation in food production.

The invention also provides the extremely heat-resistant xylanase, a recombinant vector, recombinant bacteria and application thereof.

The technical scheme is as follows: in order to achieve the above object, the present invention provides a hyperthermostable xylanase gene having a DNA sequence shown in SEQ ID NO. 1.

The amino acid sequence of the extremely heat-resistant xylanase coded by the extremely heat-resistant xylanase gene is shown as SEQ ID NO. 2.

Wherein, the derivative protein of the heat-resistant xylanase is a derivative protein with xylanase activity, which is formed by substitution, deletion and addition of one or more amino acid residues of amino acid in a sequence SEQ ID NO. 2.

The primer pair used for amplifying the extremely heat-resistant xylanase gene is shown in SEQ ID NO. 3-4:

SEQ ID NO.3：TTGGATCCATGGCAGTTGTGGCAAACTAC

SEQ ID NO.4：GCTCTAGATTAGTGATGGTGATGGTGATGCTTAGTC

AGGATCAGGTTGCCC

the recombinant vector comprises the extremely heat-resistant xylanase gene.

The recombinant bacterium comprises the extremely heat-resistant xylanase gene or the recombinant vector.

The invention relates to application of a heat-resistant xylanase gene in enzymolysis of xylan.

The invention relates to application of extremely heat-resistant xylanase coded by extremely heat-resistant xylanase genes in enzymolysis of xylan.

Wherein, the extremely heat-resistant xylanase gene and the application of the extremely heat-resistant xylanase in degrading xylan at high temperature.

Wherein the xylan-containing substrate is beech xylan or malt.

The heat-resistant xylanase gene or the application of the heat-resistant xylanase in beer making, papermaking, fruit juice production and baked food.

Preferably, the heat-resistant xylanase gene or the application of the heat-resistant xylanase in decomposing xylan in malt in beer production.

Preferably, the enzymolysis reaction temperature is 80-90 ℃ and the pH is 5.0-8.0.

Wherein, the extremely heat-resistant xylanase is added when the temperature is raised to 62-80 ℃ and the saccharification stage is started, and the usage amount of the extremely heat-resistant xylanase is 10-40U per gram of malt.

The xylanase has the characteristics of heat resistance and acid resistance, can be applied to fermentation production processes of beer and the like, and can fully decompose xylan in malt in the beer production process due to the higher heat resistance and acid resistance of the xylanase, so that the content of reducing sugar in wort and the clarity of the wort are improved, the viscosity of the wort is reduced, and meanwhile, the xylan can be decomposed to produce xylooligosaccharide and xylose, so that the beer has a certain health care effect; when the xylanase is applied to the papermaking industry, the whiteness of bleached pulp can be improved, and the consumption of chlorine is reduced; when the fruit juice is produced, xylanase is added to reduce the viscosity of the fruit juice and improve the fruit juice yield; the xylanase is added into the baked food, so that the elasticity and ductility of the dough can be improved, and the internal pore size of the product is more uniform.

According to the invention, through database comparison, a conserved sequence in a Pseudothermotoga thermarum DSM 5069 xylanase sequence is taken as a framework, a random coiled part of a non-conserved sequence in an amino acid sequence is selected as a potential modification site, a proper site is selected according to a simulated three-dimensional structure, heat-resistant amino acid is introduced to form disulfide bonds, the interaction of charges in the enzyme is optimized, and the active center of the enzyme is rigidized; the enzyme with better properties is obtained, the heat resistance and acid resistance of the enzyme are improved, the optimal temperature is improved, and the enzyme activity is improved.

The beneficial effects are that: compared with the prior art, the invention has the following advantages:

the modified gene-coded extremely heat-resistant xylanase has extremely strong heat resistance and high activity under the acidic pH condition, and has the highest enzyme activity under the conditions of 95 ℃ and pH of 5.5, and the specific enzyme activity reaches 151 mu mol/mg min; meanwhile, the extremely heat-resistant xylanase has higher enzyme activity at the temperature of 80-90 ℃ and the pH value of 5.0-8.0.

The heat resistance of the extremely heat-resistant xylanase is extremely high, and the enzyme activity can be maintained to be more than 80% after incubation for 1h in the environment with the temperature of 75 ℃ and the pH value of 4.5-7. Compared with the xylanase before transformation, the specific enzyme activity of the heat-resistant xylanase is improved by about 20 percent, and the heat resistance is obviously improved from 80 ℃ to 95 ℃. The characteristics enable the extremely heat-resistant xylanase obtained by the invention to have greater superiority than the prior xylanase, be applicable to degradation of xylan under the conditions of high temperature of 95 ℃ and acidic pH, and have potential industrial application value.

The heat-resistant acid-resistant xylanase obtained by the invention has wide application value in the industrial field, such as food production, feed fermentation, paper making and other industries, and can exert good heat-resistant acid-resistant performance in the scenes, improve the material utilization rate and reduce the environmental pollution.

Drawings

FIG. 1 is an SDS-PAGE protein electrophoresis of xylanase Tth PtXyn10A (1: crude cell extraction 2: affinity chromatography);

FIG. 2 (a) is a graph showing the optimum temperature results of Tth PtXyn 10A;

FIG. 2 (b) is a graph showing the optimum pH of Tth PtXyn 10A;

FIG. 2 (c) is a graph showing the thermal stability of Tth PtXyn 10A;

FIG. 2 (d) is a graph showing the pH stability of Tth PtXyn 10A;

FIG. 2 (e) is a graph showing the effect of salt ions of Tth PtXyn10A on enzyme activity.

FIG. 3 is a liquid chromatogram of the addition of Tth PtXyn10A protein during beer preparation.

Detailed Description

The invention is further described below with reference to examples and figures.

Materials, reagents and the like used in the following examples were obtained commercially unless otherwise specified.

Example 1

Preparation of xylanase gene Tth PtXyn10A

The amino acid sequence of Pseudothermotoga thermarum DSM 5069 xylanase is taken as a template (SEQ ID NO. 5) (NCBI number: WP_ 013932897.1), and the base sequence of the xylanase is shown as SEQ ID NO. 6; obtaining non-conservative sites of xylanase as potential transformation sites through database comparison; simultaneously, disulfide bonds are introduced by analyzing the amino acid preference of the heat-resistant xylanase and introducing a strategy for optimizing intramolecular interaction, so as to optimize the interaction of charges in the enzyme and rigidify the active center of the enzyme; and finally, setting various parameters of the modified enzyme, and modifying. The modified amino acid sequence is prepared into Tth PtXyn10A gene by codon optimization and artificial synthesis according to the codon preference of escherichia coli, and the gene sequence is shown as SEQ ID NO. 1.

Example 2

Subcloning of xylanase gene Tth PtXyn10A

The xylanase gene from example 1 was PCR amplified using the following primer pair:

Tth-1：5’–TTGGATCCATGGCAGTTGTGGCAAACTAC

Tth-2：5’-GCTCTAGATTAGTGATGGTGATGGTGATGCTTAGTCAGGATCAGGTTGCCC

in the synthesis of the above primer, tth-1 introduces a BamHI cleavage site and Tth-2 introduces an XbaI cleavage site.

PCR reaction system: 1. Mu.L of P.thermark DSM 5069 genomic DNA (purchased from DSMZ strain, germany)The center was hidden, total DNA was extracted), 1. Mu.L Tth-1, 1. Mu.L Tth-2,9.5. Mu.L ddH ₂ O，12.5μL prime STAR HS DNA Polymerase。

PCR reaction conditions: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30sec, annealing at 52℃for 30sec, extension at 72℃for 3.5min,30cycles; extending at 72 ℃ for 10min; preserving heat at 12 ℃.

The PCR products were checked for yield and specificity by 1% agarose gel electrophoresis and purified using a PCR product recovery kit (BIOMIGA, shanghai).

Example 3

Construction and verification of recombinant cloning and expression vector pET-20b-Tth PtXyn10A

The purified PCR product (prepared in example 2), pET-20b (Novagen), was digested with BamHI and XbaI, respectively, and the digested PCR and large fragment of the vector were recovered by agarose electrophoresis. The target fragment after the rubber cutting recovery was ligated with the vector by adding 1. Mu.L of 10 XLigase Buffer and 1. Mu.L of Ligase overnight at 16 ℃. Coli DH 5. Alpha. Was transformed with the ligation reaction product, and then plated on a petri dish containing 50. Mu.g/mL Amp (ampicillin), and incubated at 37℃for 10-15 hours.

A plurality of single colonies were picked from the transformation plate and plasmids were extracted using the plasmid miniprep kit of BIOMIGA. The obtained plasmid was verified by double cleavage and the obtained recombinant plasmid was sequenced. Sequencing results show that the cloned target fragment (the nucleotide length is 3474 bp) is inserted into the pET-20b vector, so that recombinant cloning and expression vectors pET-20b-Tth PtXyn10A are obtained, the DNA sequence of the Tth PtXyn10A is shown as a gene sequence shown as SEQ ID NO.1, the amino acid sequence of the expressed protein (extremely heat-resistant xylanase) is shown as a gene sequence shown as SEQ ID NO.2, and the protein is named as Tth PtXyn10A.

Example 4

Expression and purification of recombinant xylanase Tth PtXyn10A

The recombinant cloning and expression vector pET-20b-Tth PtXyn10A (prepared in example 3) is transformed into host bacterium E.coli BL21 (DE 3) (Novagen) by heat shock, and recombinant bacterium containing recombinant plasmid is obtained. Single colony recombinant bacteria were inoculated in 5mL of Luria-Bertani broth (LB) medium containing 50. Mu.g/mL ampicillin, and shaken at 200rpm at 37 ℃Culturing overnight. The 5mL of the bacterial liquid is inoculated into a 2000mL shaking flask containing 800mL of culture medium, the bacterial liquid is cultured at 37 ℃ under shaking at 200rpm, when the absorbance reaches 0.4-0.6, IPTG is added to the bacterial liquid to reach the final concentration of 0.1mM, and the bacterial liquid is induced to express for 4 hours at 220rpm at 37 ℃. The culture broth was centrifuged at 5000rpm at 4℃for 10min with a high-speed refrigerated centrifuge, and the cells were collected. Using disruption buffer (20 mM Tris, 200mM NaCl, 2mM MgCl) ₂ pH 7.4) was washed twice, resuspended in 10ml of disruption buffer and sonicated in an ice bath. Centrifuging the crushed solution at 1000rpm for 40min to obtain supernatant to obtain coarse enzyme solution.

The crude extract was purified using a Ni-NTA affinity column (see His-Band kit, novagen). The purity of the purified enzyme was identified and the molecular weight was determined by SDS-PAGE, and the results are shown in FIG. 1, wherein 2 represents purified Tth PtXyn10A protein eluted with 200mM imidazole (as pure enzyme solution for subsequent experiments). The molecular weight is about 130kDa, which is close to the theoretical value.

Example 5

Enzymatic Property analysis of recombinant xylanase Tth Ptxyn10A

The enzyme activity is defined as: under optimal conditions, the amount of enzyme required to enzymatically hydrolyze xylan to 1. Mu. Mol xylose in 1min is 1U.

(1) Optimum temperature

The pure enzyme solution obtained in example 4 was diluted with 50mM citrate buffer having pH of 5.5, and the enzyme activity was measured using the enzyme solution diluted 10 times. The enzyme activity measurement reaction system is 200 mu L, and consists of 100 mu L of 5mg/ml xylan solution (Shanghai-derived leaf organism), 90 mu L of pH5.5 50mM citric acid buffer solution and 10 mu L of diluted enzyme solution; the pH of the reaction system was 5.5. Incubating the reaction system at 60-100deg.C (interval gradient set to 5deg.C) for 10min, adding 300 μL DNS reagent, boiling in electromagnetic pot for 5min, cooling in ice bath for 5min, adding 500 μL sterile water to dilute to 1mL, and measuring OD with ultraviolet spectrophotometer ₅₄₀ Absorbance at nm. Three groups of the enzyme-catalyzed reaction were arranged in parallel, and the mixed solution under the same treatment conditions was used as a blank control. Determination of OD ₅₄₀ Absorbance at nm, relative enzyme activity at each temperature was calculated with the highest enzyme activity as 100%, realThe test is repeated for 3 times, the average value is drawn, and the research result shows that the xylanase prepared by the invention has the highest enzyme activity at 95 ℃ and is 151 mu mol/mg min; the absorbance of the enzyme activity reaction system at this temperature was set to 100% relative activity, and the absorbance of the enzyme activity reaction system at the other temperature and the absorbance of the highest enzyme activity system were set as relative activities, and the results are shown in FIG. 2 (a). Wherein the enzyme activity is higher in the reaction system with the temperature of 80-100 ℃.

(2) Optimum pH

The pure enzyme solution obtained in example 4 was diluted with 50mM citrate buffer having pH of 5.5, and the enzyme activity was measured using the enzyme solution diluted 10 times. The enzyme activity assay system was 200. Mu.L, consisting of 100. Mu.L of 5mg/ml xylan solution, 90. Mu.L of 50mM citrate buffer pH 4.0-9.0 (interval gradient set to 0.5) and 10. Mu.L of diluted enzyme solution. Incubating the reaction system at 95deg.C for 10min, adding 300 μL DNS reagent, boiling in electromagnetic pot for 5min, taking out, cooling in ice bath for 5min, diluting with 500 μL sterile water to 1mL, and measuring OD with ultraviolet spectrophotometer ₅₄₀ Absorbance at nm. Three groups of the enzyme-catalyzed reaction were arranged in parallel, and the mixed solution under the same treatment conditions was used as a blank control. Determination of OD ₅₄₀ The absorbance value at nm is calculated by taking the highest enzyme activity as 100%, the experiment is repeated for three times, the average value is taken, and the research result shows that when the pH value is 5.5, the xylanase has the highest enzyme activity and is 151 mu mol/mg min; the relative activity of the enzyme activity reaction system at this pH was 100%, and the ratio of the absorbance of the enzyme activity reaction system at the other pH to the absorbance of the highest enzyme activity system was shown in FIG. 2 (b). The enzyme activity is higher under the condition of pH 5.0-8.0.

(3) Thermal stability of recombinant enzymes

The pure enzyme solution obtained in example 4 was diluted with 50mM citrate buffer having pH of 5.5, and the enzyme activity was measured using the enzyme solution diluted 10 times. The temperature range is set to 75-85 ℃, and a temperature gradient is set at intervals of 5 ℃. The enzyme activity reaction system was set to 200. Mu.L, and 10. Mu.L of the purified enzyme solution diluted 10-fold and 90. Mu.L of 50mm were added to the centrifuge tubePlacing the solution in constant temperature metal baths with different temperature gradients and with temperature of 0.5-2.0h (a time gradient is set every 0.5 h), taking out the solution according to the set different heat preservation time, adding 100 mu L of 5mg/mL xylan solution, reacting in 90 ℃ water bath for 10min, adding 300 mu L of DNS to terminate the reaction, boiling in an electromagnetic pot for 5min, cooling on ice for 5min, adding 500 mu L of sterile water to dilute to 1mL, and diluting at OD ₅₄₀ Absorbance values were measured at nm. Three groups of the enzyme-catalyzed reaction were arranged in parallel, and the mixed solution under the same treatment conditions was used as a blank control. The enzyme activity of the diluted enzyme solution which is not subjected to heat preservation and reacts for 10min at 95 ℃ and pH5.5 is used as 100 percent of relative activity. The results of the study show that the enzyme activity is not obviously reduced after the xylanase is treated for 1h at 75 ℃, and the results are shown in the figure 2 (c), so that the xylanase has better heat stability at the temperature of 75-80 ℃.

(4) Recombinant enzyme pH stability

The pure enzyme solution obtained in example 4 was diluted with 50mM citrate buffer having pH of 5.5, and the enzyme activity was measured using the enzyme solution diluted 10 times. The pH range was set to 4.0-9.0, with a pH gradient set every 0.5. The enzyme activity reaction system is set to 200 mu L,90 mu L of citric acid buffer solution with the concentration of 50mmol/L and different pH values and 10 mu L of purified enzyme solution diluted to proper concentration are respectively added into a centrifuge tube, the mixture is kept at a constant temperature of 37 ℃ for 1h in a metal bath kettle, 100 mu L of 5mg/ml xylan solution is added, and the mixture is placed into a water bath kettle with the temperature of 95 ℃ for reaction for 10min. After the reaction, adding 300. Mu.L of DNS to terminate the reaction, boiling in an electromagnetic pot for 5min, cooling on ice for 5min, adding 500. Mu.L of sterile water to dilute to 1mL, and concentrating at OD ₅₄₀ Absorbance values were measured at nm. Three groups of the enzyme-catalyzed reaction were arranged in parallel, and the mixed solution under the same treatment conditions was used as a blank control. The enzyme activity of the diluted enzyme solution which is not subjected to pH adjustment and reacts for 10min at 95 ℃ and pH5.5 is used as 100% of the relative activity. The results of the study show that the enzyme activity in the buffer system with pH of 5.0-8.0 is not obviously reduced after water bath at 37 ℃ for 1h, and the result is shown as figure 2 (d), and the xylanase has very good acid resistance under the condition of pH of 5.0-8.0.

The xylanase before modification (template sequence was prepared as in examples 2-4) was also determined by the method described above, and the results are shown in Table 1.

Table 1 results of comparison of Tth PtXyn10A with xylanase before modification

As shown in Table 1, compared with the xylanase before transformation, the specific enzyme activity of the xylanase is improved by about 20%, the heat resistance is obviously improved from 80 ℃ to 95 ℃, and meanwhile, the temperature stability, the pH qualitative property and the like are improved to a certain extent, so that the xylanase has better industrial application value.

Example 6

The results of specific studies of the degradation of CMC-Na, dextran, filter paper and beech xylan by the recombinant xylanase Tth PtXyn10A are shown in Table 2.

Recombinant xylanase Tth PtXyn10A is further acted on CMC-Na, glucan, filter paper and beech xylan respectively, (at the optimal pH temperature, according to the system of example 5), and the enzyme has no obvious degradation effect on CMC-Na, glucan and filter paper after the enzyme activity determination experiment in example 5. The specificity of the enzyme was found to be high.

TABLE 2 degradation of CMC-Na, dextran, filter paper and Mao Jumu xylan by recombinant xylanase Tth PtXyn10A

Example 7

Determination of the Effect of cations on recombinase Activity

The effect of cations on recombinase activity was determined and the experiment was performed in two gradients, 1mM and 10mM cation concentration. The pure enzyme solution obtained in example 4 was diluted with 50mM citrate buffer having pH of 5.5, and the enzyme activity was measured using the enzyme solution diluted 10 times.

The enzyme activity assay was 200. Mu.L, consisting of 5mg/ml xylan solution 100. Mu.L, 88. Mu.L Ph5.5 mM citric acid 50mMBuffer and 2. Mu.L of cationic solution (K) with final concentration of 1mM and 10mM ⁺ 、Ba ²⁺ 、Zn ²⁺ 、Ni ²⁺ 、Ca ²⁺ 、Co ²⁺ 、Mn ²⁺ 、Mg ²⁺ 、Cu ²⁺ 、Fe ²⁺ 、Fe ³⁺ Tris, SDS, tween 80, EDTA) and 10. Mu.L of diluted enzyme solution; after incubating the reaction system at 80℃for 10min, the reaction was terminated by adding 300. Mu.L of DNS reagent, and after 5min in boiling water, the absorbance at 550nm was measured. The experiment was repeated 3 times and the average value was plotted as shown in FIG. 2 (e), and the results of the study showed that K was found from the measurement results at the final concentrations of 1mM and 10mM of the metal ion or the organic reagent ⁺ 、Ni ²⁺ 、Ca ²⁺ 、Co ²⁺ 、Mg ²⁺ 、Fe ²⁺ Tris, tween 80 has a certain activating effect on enzyme activity, and Fe at a final concentration of 10mM metal ions ²⁺ 、Mn ²⁺ The enzyme activity can be improved to 3 times; cu at final concentrations of 1mM and 10mM metal ion or organic reagent ²⁺ 、Fe ³⁺ SDS has obvious inhibiting effect on enzyme activity, fe at 1mM ³⁺ Inhibiting enzyme activity to 12 times of enzyme activity without adding metal ion, wherein at 10mM metal ion final concentration, cu ²⁺ 、Ba ² ⁺ The enzyme activities were respectively inhibited to 10 and 33 times of the enzyme activities without metal ions.

Example 8

Preparation of xylose beer

According to the xylanase obtained in the examples 1-4, a 300L scale beer production test is carried out, barley malt is used as a raw material, a single mash leaching saccharification method is adopted, malt is specifically crushed after being wetted, purified water is added according to a material-water ratio of 1:3.8, mixed heat preservation is carried out for 1h at 62-70 ℃ for saccharification, wort preparation is carried out according to 16U/g raw material extremely heat-resistant xylanase during saccharification at 65 ℃, the xylanase prepared in the invention example 4 is not added in a comparison group, the prepared wort is used for preparing functional beer rich in xylose according to a fermentation process of ordinary beer, an HPLC detection related index is used for the obtained sample, a liquid phase detection diagram is shown in figure 3, and a detection result is shown in table 3.

TABLE 3 xylose beer sample detection index

As shown in Table 3, the modified xylanase can be added in the saccharification stage of beer production, so that the beer contains a certain amount of xylose, the xylose has a certain regulation effect on human intestinal flora, and a certain health care effect is achieved while other indexes of the beer are ensured.

Sequence listing

<110> Huaiyin institute of technology

<120> extremely thermostable xylanase gene, extremely thermostable xylanase and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3474

<212> DNA

<213> Artificial sequence (Tth Ptxyn10AArtificial Sequence)

<400> 1

atggcagttg tgaagtggta cgattttgag accacctacg gtcttggacg cggttgtggc 60

gctgcgtata tcgctctgtc ccctgcggtt gctactggcg gctctgaata tctgcttgtg 120

tctggtagaa cccttggttg gcaccttgcg tccctggatc tgcttgcagt gctgaaaaga 180

acccgtgctt ataaggctga gggttgggtg gctcagaaca ttggatccga acagggaaat 240

catatcactt gtcagtctac tgtttttggt acttcttatg gtagagactg tatttctcag 300

aataagggtc cgtccggcaa atggactaaa atcgaaggca cctataccgt tcgtgcatct 360

gcggatgaac tgctgttcta ctttgagtcc gaaaacgcga ctctggattt ctatatcgac 420

gacgtgctgg atactgacct gcctggtctt atgatcttta gattcgaaaa tgaccctggc 480

ctttggcaga ttcgtggtat ggcggctatt gaaactgata ctgcagttgc gcaccttggt 540

gataagactc tgtatattaa tggccgttat tctggctggc atggtcctca gcttgttctg 600

actgacatcc tgatgccgac tgatcagtac aagggagagg gccaagttag acagggatct 660

ggctctgacc agcttatctc tattaccacc cagagagtgt acgcaggcga agaacgtacc 720

tggattcgca tggcgactgc tactgcaccg attggcaagt gggtgaagga agagggtgtt 780

tacaccgtgg gagcaccgaa tgaggaaaat gttttctatt ttgaatccaa taacgcagat 840

agagactttt atgttgacaa tgtgatgatc attgatccta gcgcaccggt tggcgaagca 900

attgcgcagt ttgaatttgt ggcgaaattt gaggacaacc tgaacggttt tgcgccgatt 960

ggtcgcgcag agctgtctat taccgacgtg gttcaatcct ttggcaagta ttctctgaaa 1020

atctccggcc gtgcgctgct gtacgacggc tgcattgtgg acatgactaa gttcgcaaaa 1080

gatctggtgg attccaacat gatggttatc gcaaacgtgt accacgattg cgacgaaccg 1140

aagccgttcg catttctgct gtataccaaa accaagaagg cagagaacta cagctacatt 1200

ggctacaaga tcgctatgcc gaagacttgg tccaccgctg tgggttactt caacctgaag 1260

gctgacgact acgaaaaggt ggcgatcctg attgtttccc cgaacgcagt ggactacaac 1320

ttctacatcg ataacttcca ggtgctgggc cgtcagaaag ctgcacaggt gaaaattccg 1380

ccggacttcg gtccggtggc actgaaagaa ctgttcgctg agcacttcaa gattggtgtt 1440

gctctgccgg ttcgcgtgtt cagcaactct atggacgtgg agctgattac caagcacttt 1500

aactccatga ccgctgaaaa cgagatgaag ccggaaagca tcctgcgtcg tgacgcaagc 1560

ggcaagatct attacgactt caccgttgcg gaccgctata ttgaattcgc acagaagcac 1620

ggtatggtgg ttcgtggtca taccctggtt tggcattccc agaccccgga gtggttcttc 1680

aaagacgaga aaggtaacct gctgtcccgt gaggcgatga ttgaacgtat gcgcgaatac 1740

atccacactg ttgttggccg ttaccgcggc aaagtttacg cttgggatgt ggtgaacgaa 1800

gctgtggatg agaaccagcc ggacggtctg cgtcgctccc tgtggtatca ggtgattggt 1860

ccggattaca tcgagctggc gttcaagttc gcgcacgaag cagacccgga cgcactgctg 1920

ttttataacg actacaacga gtaccatcag aagaagcgcg acgttatcta caacatggtg 1980

aaaaacatga aggaaaaggg tatcccgatc catggtatcg gtatgcagca gcatatcaac 2040

atcggcacct ctatcgaaca gattgaacag gcaatcgcac tgtacgcgac cattccgggt 2100

attgtgatcg aaattaccga actggacgtt aacatctacc gtgataacgc aaccaaatac 2160

gagattccgc cgatcgacct gctgatccag caggcaaact tctatcgtcg cctgtttgag 2220

gtgtacaaga agtacagcga cgtgattaac aacgtgacct tttggggtct gaaagacgac 2280

tattcttggc tgcgtggtta cccggtgcgc aataacaaga agccgctgct gtttgatcat 2340

aactataact ctaagcctgc atattgggct caagttaagc cggagctgat tcctgctaat 2400

tctaaagaag gcactatcaa tccgggtgag gctaagatcg ctggcactat ggacgactct 2460

ttcctgcagt ccccgccgac taagatcgtg gtggacggta acgataaact gattgcgcgt 2520

attatttggg gcgagcctaa actgtatatc tacgcgattg tttacgatat ttctcgtaac 2580

ccgcataaag acggtgttca tatcttcaat gatccgcaaa acttcaaggc gccgtttctg 2640

cacgaccagg cggcgtatgt gattttctgg tacaaccgtg agattgagaa gagcgaaaac 2700

gctgaggtgg agcgcttcct gggtccggcg taccgtcgct attccgttga agcggcgatc 2760

tctatgccgg gtgtgaaatt ctctcgtgac cagctgatcg gtttcgacat cgcagttatc 2820

gacgatggca agtggtattc ctggtccgac aatactaacc agcaggattt cagcaccctg 2880

gcgtacggta ctctgaagct ggaaggcatt aaaaccggta aacttatgta cggcaccccg 2940

gttcttgacg gcgaaaatga cgacatcact aacaaagcgg aagaggctga gactaatgtg 3000

gttgttatgg gttccctgca gaacaagtct gcgaagtttc gtgtgctgtg ggacgaagaa 3060

tacctgtatg tgagagcgat cgtgaaagat ccgggactga acaaggacaa cagcgctgca 3120

tgggagcagg accttattga gattttcatt agcgagacca ctcacaagac tccgccggat 3180

cgtgatggtg aaggtcaggg acgtgttaac actactaagc agcagaattt tggcactggc 3240

gcgtctgcag cacgcaagaa gaccgcgact aagatttttg agggcggcgg actgcatgag 3300

gctggagtga attggactgt gatctgtccg cagcctggta tgaccgatgg cttcgacaag 3360

cagactaacg atgcaaacgc gcagggcaga gaagttggta tcctggaata ttgcgatccg 3420

accgacaaca cctggcagaa catgtccaaa gctggcaacc tgatcctgac taag 3474

<210> 2

<211> 1158

<212> PRT

<213> Artificial sequence (Tth Ptxyn10AArtificial Sequence)

<400> 2

Met Ala Val Val Lys Trp Tyr Asp Phe Glu Thr Thr Tyr Gly Leu Gly

1 5 10 15

Arg Gly Cys Gly Ala Ala Tyr Ile Ala Leu Ser Pro Ala Val Ala Thr

20 25 30

Gly Gly Ser Glu Tyr Leu Leu Val Ser Gly Arg Thr Leu Gly Trp His

35 40 45

Leu Ala Ser Leu Asp Leu Leu Ala Val Leu Lys Arg Thr Arg Ala Tyr

50 55 60

Lys Ala Glu Gly Trp Val Ala Gln Asn Ile Gly Ser Glu Gln Gly Asn

65 70 75 80

His Ile Thr Cys Gln Ser Thr Val Phe Gly Thr Ser Tyr Gly Arg Asp

85 90 95

Cys Ile Ser Gln Asn Lys Gly Pro Ser Gly Lys Trp Thr Lys Ile Glu

100 105 110

Gly Thr Tyr Thr Val Arg Ala Ser Ala Asp Glu Leu Leu Phe Tyr Phe

115 120 125

Glu Ser Glu Asn Ala Thr Leu Asp Phe Tyr Ile Asp Asp Val Leu Asp

130 135 140

Thr Asp Leu Pro Gly Leu Met Ile Phe Arg Phe Glu Asn Asp Pro Gly

145 150 155 160

Leu Trp Gln Ile Arg Gly Met Ala Ala Ile Glu Thr Asp Thr Ala Val

165 170 175

Ala His Leu Gly Asp Lys Thr Leu Tyr Ile Asn Gly Arg Tyr Ser Gly

180 185 190

Trp His Gly Pro Gln Leu Val Leu Thr Asp Ile Leu Met Pro Thr Asp

195 200 205

Gln Tyr Lys Gly Glu Gly Gln Val Arg Gln Gly Ser Gly Ser Asp Gln

210 215 220

Leu Ile Ser Ile Thr Thr Gln Arg Val Tyr Ala Gly Glu Glu Arg Thr

225 230 235 240

Trp Ile Arg Met Ala Thr Ala Thr Ala Pro Ile Gly Lys Trp Val Lys

245 250 255

Glu Glu Gly Val Tyr Thr Val Gly Ala Pro Asn Glu Glu Asn Val Phe

260 265 270

Tyr Phe Glu Ser Asn Asn Ala Asp Arg Asp Phe Tyr Val Asp Asn Val

275 280 285

Met Ile Ile Asp Pro Ser Ala Pro Val Gly Glu Ala Ile Ala Gln Phe

290 295 300

Glu Phe Val Ala Lys Phe Glu Asp Asn Leu Asn Gly Phe Ala Pro Ile

305 310 315 320

Gly Arg Ala Glu Leu Ser Ile Thr Asp Val Val Gln Ser Phe Gly Lys

325 330 335

Tyr Ser Leu Lys Ile Ser Gly Arg Ala Leu Leu Tyr Asp Gly Cys Ile

340 345 350

Val Asp Met Thr Lys Phe Ala Lys Asp Leu Val Asp Ser Asn Met Met

355 360 365

Val Ile Ala Asn Val Tyr His Asp Cys Asp Glu Pro Lys Pro Phe Ala

370 375 380

Phe Leu Leu Tyr Thr Lys Thr Lys Lys Ala Glu Asn Tyr Ser Tyr Ile

385 390 395 400

Gly Tyr Lys Ile Ala Met Pro Lys Thr Trp Ser Thr Ala Val Gly Tyr

405 410 415

Phe Asn Leu Lys Ala Asp Asp Tyr Glu Lys Val Ala Ile Leu Ile Val

420 425 430

Ser Pro Asn Ala Val Asp Tyr Asn Phe Tyr Ile Asp Asn Phe Gln Val

435 440 445

Leu Gly Arg Gln Lys Ala Ala Gln Val Lys Ile Pro Pro Asp Phe Gly

450 455 460

Pro Val Ala Leu Lys Glu Leu Phe Ala Glu His Phe Lys Ile Gly Val

465 470 475 480

Ala Leu Pro Val Arg Val Phe Ser Asn Ser Met Asp Val Glu Leu Ile

485 490 495

Thr Lys His Phe Asn Ser Met Thr Ala Glu Asn Glu Met Lys Pro Glu

500 505 510

Ser Ile Leu Arg Arg Asp Ala Ser Gly Lys Ile Tyr Tyr Asp Phe Thr

515 520 525

Val Ala Asp Arg Tyr Ile Glu Phe Ala Gln Lys His Gly Met Val Val

530 535 540

Arg Gly His Thr Leu Val Trp His Ser Gln Thr Pro Glu Trp Phe Phe

545 550 555 560

Lys Asp Glu Lys Gly Asn Leu Leu Ser Arg Glu Ala Met Ile Glu Arg

565 570 575

Met Arg Glu Tyr Ile His Thr Val Val Gly Arg Tyr Arg Gly Lys Val

580 585 590

Tyr Ala Trp Asp Val Val Asn Glu Ala Val Asp Glu Asn Gln Pro Asp

595 600 605

Gly Leu Arg Arg Ser Leu Trp Tyr Gln Val Ile Gly Pro Asp Tyr Ile

610 615 620

Glu Leu Ala Phe Lys Phe Ala His Glu Ala Asp Pro Asp Ala Leu Leu

625 630 635 640

Phe Tyr Asn Asp Tyr Asn Glu Tyr His Gln Lys Lys Arg Asp Val Ile

645 650 655

Tyr Asn Met Val Lys Asn Met Lys Glu Lys Gly Ile Pro Ile His Gly

660 665 670

Ile Gly Met Gln Gln His Ile Asn Ile Gly Thr Ser Ile Glu Gln Ile

675 680 685

Glu Gln Ala Ile Ala Leu Tyr Ala Thr Ile Pro Gly Ile Val Ile Glu

690 695 700

Ile Thr Glu Leu Asp Val Asn Ile Tyr Arg Asp Asn Ala Thr Lys Tyr

705 710 715 720

Glu Ile Pro Pro Ile Asp Leu Leu Ile Gln Gln Ala Asn Phe Tyr Arg

725 730 735

Arg Leu Phe Glu Val Tyr Lys Lys Tyr Ser Asp Val Ile Asn Asn Val

740 745 750

Thr Phe Trp Gly Leu Lys Asp Asp Tyr Ser Trp Leu Arg Gly Tyr Pro

755 760 765

Val Arg Asn Asn Lys Lys Pro Leu Leu Phe Asp His Asn Tyr Asn Ser

770 775 780

Lys Pro Ala Tyr Trp Ala Gln Val Lys Pro Glu Leu Ile Pro Ala Asn

785 790 795 800

Ser Lys Glu Gly Thr Ile Asn Pro Gly Glu Ala Lys Ile Ala Gly Thr

805 810 815

Met Asp Asp Ser Phe Leu Gln Ser Pro Pro Thr Lys Ile Val Val Asp

820 825 830

Gly Asn Asp Lys Leu Ile Ala Arg Ile Ile Trp Gly Glu Pro Lys Leu

835 840 845

Tyr Ile Tyr Ala Ile Val Tyr Asp Ile Ser Arg Asn Pro His Lys Asp

850 855 860

Gly Val His Ile Phe Asn Asp Pro Gln Asn Phe Lys Ala Pro Phe Leu

865 870 875 880

His Asp Gln Ala Ala Tyr Val Ile Phe Trp Tyr Asn Arg Glu Ile Glu

885 890 895

Lys Ser Glu Asn Ala Glu Val Glu Arg Phe Leu Gly Pro Ala Tyr Arg

900 905 910

Arg Tyr Ser Val Glu Ala Ala Ile Ser Met Pro Gly Val Lys Phe Ser

915 920 925

Arg Asp Gln Leu Ile Gly Phe Asp Ile Ala Val Ile Asp Asp Gly Lys

930 935 940

Trp Tyr Ser Trp Ser Asp Asn Thr Asn Gln Gln Asp Phe Ser Thr Leu

945 950 955 960

Ala Tyr Gly Thr Leu Lys Leu Glu Gly Ile Lys Thr Gly Lys Leu Met

965 970 975

Tyr Gly Thr Pro Val Leu Asp Gly Glu Asn Asp Asp Ile Thr Asn Lys

980 985 990

Ala Glu Glu Ala Glu Thr Asn Val Val Val Met Gly Ser Leu Gln Asn

995 1000 1005

Lys Ser Ala Lys Phe Arg Val Leu Trp Asp Glu Glu Tyr Leu Tyr Val

1010 1015 1020

Arg Ala Ile Val Lys Asp Pro Gly Leu Asn Lys Asp Asn Ser Ala Ala

1025 1030 1035 1040

Trp Glu Gln Asp Leu Ile Glu Ile Phe Ile Ser Glu Thr Thr His Lys

1045 1050 1055

Thr Pro Pro Asp Arg Asp Gly Glu Gly Gln Gly Arg Val Asn Thr Thr

1060 1065 1070

Lys Gln Gln Asn Phe Gly Thr Gly Ala Ser Ala Ala Arg Lys Lys Thr

1075 1080 1085

Ala Thr Lys Ile Phe Glu Gly Gly Gly Leu His Glu Ala Gly Val Asn

1090 1095 1100

Trp Thr Val Ile Cys Pro Gln Pro Gly Met Thr Asp Gly Phe Asp Lys

1105 1110 1115 1120

Gln Thr Asn Asp Ala Asn Ala Gln Gly Arg Glu Val Gly Ile Leu Glu

1125 1130 1135

Tyr Cys Asp Pro Thr Asp Asn Thr Trp Gln Asn Met Ser Lys Ala Gly

1140 1145 1150

Asn Leu Ile Leu Thr Lys

1155

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ttggatccat ggcagttgtg gcaaactac 29

<210> 4

<211> 51

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gctctagatt agtgatggtg atggtgatgc ttagtcagga tcaggttgcc c 51

<210> 5

<211> 1158

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 5

Met Ala Val Val Ala Asn Tyr Asp Phe Glu Thr Thr Tyr Gly Asp Trp

1 5 10 15

Arg Gly Arg Gly Ala Ala Ser Ile Ala Leu Ser Asp Ala Val Ala His

20 25 30

Gly Gly Ser Lys Ser Leu Tyr Val Ser Gly Arg Thr Ala Gly Trp His

35 40 45

Gly Ala Ser Leu Asp Leu Thr Ala Val Leu Lys Pro Thr Arg Gln Tyr

50 55 60

Lys Phe Glu Gly Trp Val Tyr Gln Asn Ser Gly Ser Asp Gln Val Met

65 70 75 80

Ile Ile Thr Met Gln Arg Thr Tyr Ser Gly Glu Ser Arg Gly Trp Asp

85 90 95

Arg Ile Ala Gln Val Val Ala Pro Ser Gly Lys Trp Thr Lys Ile Glu

100 105 110

Gly Thr Tyr Thr Val Arg Ala Ser Ala Asp Glu Leu Leu Phe Tyr Phe

115 120 125

Glu Ser Glu Asn Ala Thr Leu Asp Phe Tyr Ile Asp Asp Val Leu Ile

130 135 140

Val Asp Leu Thr Gly Ala Met Ile Phe Asp Phe Glu Lys Asp Leu Gly

145 150 155 160

Asn Trp Gln Asn Arg Gly Ala Ala Lys Ile Glu Leu Ser Ser Ala Val

165 170 175

Ala His Ser Gly Ser Lys Ser Leu Tyr Ile Ser Gly Arg Thr Ser Gly

180 185 190

Trp His Gly Ala Gln Leu Val Leu Thr Asp Ile Leu Lys Pro Thr Arg

195 200 205

Gln Tyr Lys Phe Glu Gly Trp Val Tyr Gln Asn Ser Gly Ser Asp Gln

210 215 220

Pro Ile Ile Ile Thr Met Gln Arg Val Tyr Ala Gly Glu Ser Arg Gly

225 230 235 240

Trp Asp Arg Ile Ala Thr Val Thr Ala Pro Ser Gly Lys Trp Val Lys

245 250 255

Ile Glu Gly Val Tyr Thr Val Arg Ala Pro Ala Glu Glu Leu Val Phe

260 265 270

Tyr Phe Glu Ser Asp Asn Ala Thr Leu Asp Phe Tyr Val Asp Asp Val

275 280 285

Met Ile Ile Asp Leu Ser Ala Pro Val Gly Glu Ala Ala Ala Gln Phe

290 295 300

Glu Phe Val Ala Lys Phe Glu Asp Asn Leu Asn Gly Phe Ala Pro Phe

305 310 315 320

Gly Arg Ala Glu Leu Ser Arg Thr Asp Val Val Ala Ser Glu Gly Lys

325 330 335

Tyr Ser Leu Lys Ile Ser Gly Arg Ala Leu Leu Tyr Asp Gly Cys Ile

340 345 350

Val Asp Met Thr Lys Phe Ala Lys Asp Leu Val Asp Ser Asn Met Met

355 360 365

Val Ile Ala Asn Val Tyr His Asp Cys Asp Glu Pro Lys Pro Phe Ala

370 375 380

Phe Leu Leu Tyr Thr Lys Thr Lys Lys Ala Glu Asn Tyr Ser Tyr Ile

385 390 395 400

Gly Tyr Lys Ile Ala Met Pro Lys Thr Trp Ser Thr Ala Val Gly Tyr

405 410 415

Phe Asn Leu Lys Ala Asp Asp Tyr Glu Lys Val Ala Ile Leu Ile Val

420 425 430

Ser Pro Asn Ala Val Asp Tyr Asn Phe Tyr Ile Asp Asn Phe Gln Val

435 440 445

Leu Gly Arg Gln Lys Ala Ala Gln Val Lys Ile Pro Pro Asp Phe Gly

450 455 460

Pro Val Ala Leu Lys Glu Leu Phe Ala Glu His Phe Lys Ile Gly Val

465 470 475 480

Ala Leu Pro Val Arg Val Phe Ser Asn Ser Met Asp Val Glu Leu Ile

485 490 495

Thr Lys His Phe Asn Ser Met Thr Ala Glu Asn Glu Met Lys Pro Glu

500 505 510

Ser Ile Leu Arg Arg Asp Ala Ser Gly Lys Ile Tyr Tyr Asp Phe Thr

515 520 525

Val Ala Asp Arg Tyr Ile Glu Phe Ala Gln Lys His Gly Met Val Val

530 535 540

Arg Gly His Thr Leu Val Trp His Ser Gln Thr Pro Glu Trp Phe Phe

545 550 555 560

Lys Asp Glu Lys Gly Asn Leu Leu Ser Arg Glu Ala Met Ile Glu Arg

565 570 575

Met Arg Glu Tyr Ile His Thr Val Val Gly Arg Tyr Arg Gly Lys Val

580 585 590

Tyr Ala Trp Asp Val Val Asn Glu Ala Val Asp Glu Asn Gln Pro Asp

595 600 605

Gly Leu Arg Arg Ser Leu Trp Tyr Gln Val Ile Gly Pro Asp Tyr Ile

610 615 620

Glu Leu Ala Phe Lys Phe Ala His Glu Ala Asp Pro Asp Ala Leu Leu

625 630 635 640

Phe Tyr Asn Asp Tyr Asn Glu Tyr His Gln Lys Lys Arg Asp Val Ile

645 650 655

Tyr Asn Met Val Lys Asn Met Lys Glu Lys Gly Ile Pro Ile His Gly

660 665 670

Ile Gly Met Gln Gln His Ile Asn Ile Gly Thr Ser Ile Glu Gln Ile

675 680 685

Glu Gln Ala Ile Ala Leu Tyr Ala Thr Ile Pro Gly Ile Val Ile Glu

690 695 700

Ile Thr Glu Leu Asp Val Asn Ile Tyr Arg Asp Asn Ala Thr Lys Tyr

705 710 715 720

Glu Ile Pro Pro Ile Asp Leu Leu Ile Gln Gln Ala Asn Phe Tyr Arg

725 730 735

Arg Leu Phe Glu Val Tyr Lys Lys Tyr Ser Asp Val Ile Asn Asn Val

740 745 750

Thr Phe Trp Gly Leu Lys Asp Asp Tyr Ser Trp Leu Arg Gly Tyr Pro

755 760 765

Val Arg Arg Asn Asn Trp Pro Leu Leu Phe Asp Glu Asn Tyr Asn Ala

770 775 780

Lys Leu Ala Tyr Trp Ala Leu Val Lys Pro Glu Leu Ile Pro Ala Ser

785 790 795 800

Ser Lys Glu Gly Ser Ile Val Pro Gly Glu Ala Ile Ile Ala Gly Thr

805 810 815

Met Asp Asp Ser Phe Leu Gln Ser Pro Pro Ile Lys Ile Val Val Asp

820 825 830

Gly Asn Asp Lys Leu Ile Ala Arg Val Ile Trp Gly Glu Asp Lys Leu

835 840 845

Tyr Ile Tyr Ala Asp Val Tyr Asp Ala Thr Arg Asn Pro Asp Lys Asp

850 855 860

Gly Val Ala Ile Phe Val Asp Pro Lys Asn Phe Lys Ala Pro Phe Leu

865 870 875 880

His Asp Gln Ala Ala Tyr Val Ile Phe Trp Tyr Asn Arg Glu Ile Glu

885 890 895

Lys Ser Glu Asn Val Glu Val Glu Arg Phe Leu Gly Pro Ala Tyr Arg

900 905 910

Arg Tyr Ser Val Glu Ala Ala Ile Ser Met Pro Gly Val Lys Phe Ser

915 920 925

Arg Asp Gln Leu Ile Gly Phe Asp Ile Ala Val Ile Asp Asp Gly Lys

930 935 940

Trp Tyr Ser Trp Ser Asp Thr Thr Asn Gln Gln Lys Phe Ser Thr Leu

945 950 955 960

Ala Tyr Gly Thr Leu Lys Leu Glu Gly Ile Lys Thr Gly Lys Ala Met

965 970 975

Tyr Gly Thr Pro Val Ile Asp Gly Glu Ile Asp Asp Ile Trp Asn Lys

980 985 990

Ala Glu Glu Leu Glu Thr Asp Val Val Val Met Gly Ser Leu Gln Asn

995 1000 1005

Ala Ser Ala Lys Phe Arg Val Leu Trp Asp Glu Glu Tyr Leu Tyr Val

1010 1015 1020

Leu Ala Ile Val Lys Asp Pro Val Leu Asn Lys Asp Asn Ser Asn Ala

1025 1030 1035 1040

Trp Glu Gln Asp Ser Ile Glu Ile Phe Ile Ser Glu Thr Asn His Lys

1045 1050 1055

Thr Pro Pro Tyr Arg Asp Gly Asp Gly Gln Phe Arg Val Asn Phe Thr

1060 1065 1070

Asn Gln Gln Ser Phe Gly Thr Gly Ala Ser Ala Ala Arg Phe Lys Thr

1075 1080 1085

Ala Thr Lys Ile Val Glu Gly Gly Tyr Leu Val Glu Ala Ala Val Lys

1090 1095 1100

Trp Ser Val Ile Lys Pro Gln Ala Gly Met Thr Ile Gly Phe Asp Phe

1105 1110 1115 1120

Gln Val Asn Asp Ala Asn Ala Gln Gly Arg Arg Val Gly Ile Leu Lys

1125 1130 1135

Trp Cys Asp Pro Thr Asp Asn Thr Trp Gln Asn Met Ser Lys Val Gly

1140 1145 1150

Asn Leu Ile Leu Thr Lys

1155

<210> 6

<211> 3474

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atggcagttg tggcaaacta cgattttgag accacctacg gtgactggcg cggtcgtggc 60

gctgcgtcca tcgctctgtc cgatgcggtt gctcatggcg gctctaaaag cctgtatgtg 120

tctggtcgca ccgcaggttg gcacggcgcg tccctggatc tgaccgcagt gctgaaaccg 180

acccgtcagt ataagtttga gggttgggtg tatcagaact ccggttccga tcaggttatg 240

attatcacta tgcagcgtac ttattctggt gagtctcgcg gttgggaccg cattgcgcag 300

gtggtggctc cgtccggcaa atggactaaa atcgaaggca cctataccgt tcgtgcatct 360

gcggatgaac tgctgttcta ctttgagtcc gaaaacgcga ctctggattt ctatatcgac 420

gacgtgctga tcgttgacct gactggtgct atgatctttg acttcgaaaa agacctgggc 480

aactggcaga accgtggtgc agcgaaaatt gaactgtcct ctgcagttgc gcactctggt 540

agcaagtctc tgtatattag cggccgtact tctggctggc atggtgcgca gctggttctg 600

actgacatcc tgaagccgac tcgccagtac aagttcgagg gctgggttta ccagaactct 660

ggctctgacc agccgatcat tattaccatg cagcgtgtgt acgcaggcga atctcgtggc 720

tgggatcgca tcgcgactgt tactgcaccg tctggcaagt gggtgaagat cgagggtgtt 780

tacaccgtgc gtgcaccggc tgaggaactg gttttctatt ttgaatccga taacgcaacc 840

ctggactttt atgttgacga tgtgatgatc attgatctga gcgcaccggt tggcgaagca 900

gcggcgcagt ttgaatttgt ggcgaaattt gaggacaacc tgaacggttt tgcgccgttt 960

ggtcgcgcag agctgtctcg taccgacgtg gttgcatccg agggcaagta ttctctgaaa 1020

atctccggcc gtgcgctgct gtacgacggc tgcattgtgg acatgactaa gttcgcaaaa 1080

gatctggtgg attccaacat gatggttatc gcaaacgtgt accacgattg cgacgaaccg 1140

aagccgttcg catttctgct gtataccaaa accaagaagg cagagaacta cagctacatt 1200

ggctacaaga tcgctatgcc gaagacttgg tccaccgctg tgggttactt caacctgaag 1260

gctgacgact acgaaaaggt ggcgatcctg attgtttccc cgaacgcagt ggactacaac 1320

ttctacatcg ataacttcca ggtgctgggc cgtcagaaag ctgcacaggt gaaaattccg 1380

ccggacttcg gtccggtggc actgaaagaa ctgttcgctg agcacttcaa gattggtgtt 1440

gctctgccgg ttcgcgtgtt cagcaactct atggacgtgg agctgattac caagcacttt 1500

aactccatga ccgctgaaaa cgagatgaag ccggaaagca tcctgcgtcg tgacgcaagc 1560

ggcaagatct attacgactt caccgttgcg gaccgctata ttgaattcgc acagaagcac 1620

ggtatggtgg ttcgtggtca taccctggtt tggcattccc agaccccgga gtggttcttc 1680

aaagacgaga aaggtaacct gctgtcccgt gaggcgatga ttgaacgtat gcgcgaatac 1740

atccacactg ttgttggccg ttaccgcggc aaagtttacg cttgggatgt ggtgaacgaa 1800

gctgtggatg agaaccagcc ggacggtctg cgtcgctccc tgtggtatca ggtgattggt 1860

ccggattaca tcgagctggc gttcaagttc gcgcacgaag cagacccgga cgcactgctg 1920

ttttataacg actacaacga gtaccatcag aagaagcgcg acgttatcta caacatggtg 1980

aaaaacatga aggaaaaggg tatcccgatc catggtatcg gtatgcagca gcatatcaac 2040

atcggcacct ctatcgaaca gattgaacag gcaatcgcac tgtacgcgac cattccgggt 2100

attgtgatcg aaattaccga actggacgtt aacatctacc gtgataacgc aaccaaatac 2160

gagattccgc cgatcgacct gctgatccag caggcaaact tctatcgtcg cctgtttgag 2220

gtgtacaaga agtacagcga cgtgattaac aacgtgacct tttggggtct gaaagacgac 2280

tattcttggc tgcgtggtta cccggtgcgc cgtaacaact ggccgctgct gtttgatgaa 2340

aactataacg ctaagctggc atattgggct ctggttaagc cggagctgat tccggctagc 2400

tctaaagaag gctccatcgt tccgggtgag gctattatcg ctggcactat ggacgactct 2460

ttcctgcagt ccccgccgat taagatcgtg gtggacggta acgataaact gattgcgcgt 2520

gttatttggg gcgaggacaa actgtatatc tacgcggacg tttacgatgc gactcgtaac 2580

ccggataaag acggtgttgc gatcttcgtt gatccgaaaa acttcaaggc gccgtttctg 2640

cacgaccagg cggcgtatgt gattttctgg tacaaccgtg agattgagaa gagcgaaaac 2700

gtggaggtgg agcgcttcct gggtccggcg taccgtcgct attccgttga agcggcgatc 2760

tctatgccgg gtgtgaaatt ctctcgtgac cagctgatcg gtttcgacat cgcagttatc 2820

gacgatggca agtggtattc ctggtccgac accactaacc agcagaaatt cagcaccctg 2880

gcgtacggta ctctgaagct ggaaggcatt aaaaccggta aagcaatgta cggcaccccg 2940

gttattgacg gcgaaattga cgacatctgg aacaaagcgg aagagctgga gactgacgtg 3000

gttgttatgg gttccctgca gaacgcatct gcgaagtttc gtgtgctgtg ggacgaagaa 3060

tacctgtatg tgctggcgat cgtgaaagat ccggttctga acaaggacaa cagcaacgca 3120

tgggagcagg acagcattga gattttcatt agcgagacca accacaagac tccgccgtat 3180

cgtgatggtg acggtcagtt ccgtgttaac tttactaacc agcagtcttt tggcactggc 3240

gcgtctgcag cacgctttaa gaccgcgact aagattgttg agggcggcta tctggttgag 3300

gctgcggtga agtggtctgt gatcaaaccg caggcgggta tgaccattgg cttcgacttt 3360

caggttaacg atgcaaacgc gcagggccgt cgtgttggta tcctgaaatg gtgcgatccg 3420

accgacaaca cctggcagaa catgtccaaa gtgggcaacc tgatcctgac taag 3474

Claims

1. A kind of extremely heat-resistant xylanase gene, characterized in that its DNA sequence is shown in SEQ ID NO. 1.

2. A hyperthermostable xylanase encoded by the hyperthermostable xylanase gene of claim 1, wherein the amino acid sequence is as shown in SEQ ID No. 2.

3. A primer for amplifying the hyperthermostable xylanase gene of claim 1, wherein the primer pair used is shown in SEQ ID No. 3-4:

SEQ ID NO.3： TTGGATCCATGGCAGTTGTGGCAAACTAC；

SEQ ID NO.4：GCTCTAGATTAGTGATGGTGATGGTGATGCTTAGTCAGGATCAGGTTGCCC。

4. a recombinant vector comprising the hyperthermostable xylanase gene of claim 1.

5. A recombinant bacterium comprising the hyperthermostable xylanase gene of claim 1 or the recombinant vector of claim 4.

6. Use of the hyperthermostable xylanase gene of claim 1 or the hyperthermostable xylanase of claim 2 for enzymatic hydrolysis of xylan.

7. The use according to claim 6, characterized in that the hyperthermostable xylanase gene and the hyperthermostable xylanase are used for degrading xylan at high temperature.

8. The use according to claim 6 or 7, wherein the xylan comprises a xylan-containing substrate which is beech xylan or malt.

9. Use of the hyperthermostable xylanase gene of claim 1 or the hyperthermostable xylanase of claim 2 in beer making, paper making, juice production, baked goods.