CN105368856B - A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living - Google Patents
A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living Download PDFInfo
- Publication number
- CN105368856B CN105368856B CN201510901182.4A CN201510901182A CN105368856B CN 105368856 B CN105368856 B CN 105368856B CN 201510901182 A CN201510901182 A CN 201510901182A CN 105368856 B CN105368856 B CN 105368856B
- Authority
- CN
- China
- Prior art keywords
- pectin lyase
- saltant type
- pelc
- type thermo
- thermo philic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria enzyme and its application than raising living, belongs to technical field of bioengineering.The deposit number of the engineering bacteria is CGMCC No.11461, and classification naming is escherichia coli Escherichia coli, and preservation address is：China Committee for Culture Collection of Microorganisms's common micro-organisms center, the deposit date is：On September 29th, 2015.The present invention mainly discloses saltant type thermo philic alkali pectin lyase, and optimal reactive temperature is 70 DEG C, most suitable Ca2+Concentration is 0.8mM, and substrate is 0.2% (w/v) polygalacturonase, pH 9.5.The enzyme is in optimal pH 9.5, Ca2+Enzyme is than living for 5300U/mg when 0.8mM, 70 DEG C；Under 70 DEG C of heat preservations, half-life period 6h；CbPelC-CD can reach 40mg/L (1L fermentation liquid) after ni-sepharose purification is handled.The Rate activity of saltant type thermo philic alkali pectin lyase of the present invention have with respect to protoenzyme CbPelC (900U/mg) it is significantly very high, more adaptation modern industrial production requirement, also provide effectively method for industrial mass production alkaline pectase.
Description
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of to split than the saltant type thermo philic alkali pectin living improved
Solve enzyme gene, engineering bacteria, enzyme and its application in depolymerized pectin substance.
Background technique
Pectin substance is mainly made of polygalacturonase (GalA), and side chain also often with trehalose, rhamnose,
Arabinose etc. is widely present in plant primary cell wall.
Pectase is a series of general name of enzymes for decomposing pectin substance, is widely distributed in higher plant and microorganism.
For plant in maturation, pectase keeps plant cell wall softer, also plays to plant tissue corruption regeneration balance important
Effect.Pectase can be divided into two major classes, i.e. esterase and depolymerase by the difference of its mode of action, and depolymerase is divided into hydrolase
And lyases.Hydrolase is by introducing hydrone hydrolyzing glucosidic bonds, and lyases is to be broken glucosides by trans-elimination
Key.
Pectin lyase is the important component of pectase, is that a kind of degrading plant cell wall and can lead to plant tissue
The even dead depolymerase of softening, it plays an important role during pectin degrading.Its mechanism of action is by β-racemization
Mode act on fracture glycosidic bond, form 4,5 unsaturated double-bond of △, generate unsaturated galacturonic acid oligosaccharide.Pectin
Lyases is also indispensable main enzyme in fiber crops material degumming tech and textile technology.Add in medicine, biotechnology, feed
Work, environmental protection aspect also have suitable status, wood preservation and in terms of be also widely used.
Pectin lyase is mainly based on alkaline enzyme at present, and is room temperature enzyme mostly, and Zimadzhunt L 340 is less, so far,
There are many report about thermophilic cellulase, and the report about thermophilic pectase is seldom.
Summary of the invention
The first object of the present invention is to provide a kind of saltant type of Caldicellulosiruptor bescii gene source
Thermo philic alkali pectin lyase enzyme engineering bacteria and construction method, the saltant type thermo philic alkali pectin lyase enzyme engineering bacteria
Escherichia coli BL21 (DE3)/pET20b (+)-PelC-CD, deposit number are CGMCC No.11461, classification
It is named as escherichia coli Escherichia coli, depositary institution is that China Committee for Culture Collection of Microorganisms is common
Microorganism center (CGMCC, address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica,
100101), the deposit date is on September 29th, 2015.
Engineering bacterium expression product is cell soluble protein, by cell ultrasonication, is heated and inactivated the miscellaneous egg of Escherichia coli
It is white, it is isolated and purified to obtain thermophilic protein, i.e. saltant type thermo philic alkali pectin lyase.
The yield of saltant type thermo philic alkali pectin lyase prepared by the present invention can reach 40mg/L (1L fermentation liquid), than work
Property can reach 5300U/mg, the 900U/mg of opposite protoenzyme PelC, PelC-CD is a kind of very high alkaline pectase of specific activity, is
Industrialization place mat is further realized, also provides effectively method for industrial mass production alkaline pectase.
Saltant type thermo philic alkali pectin lyase genetic engineering bacterium of the present invention is to be derived from hot Fusobacterium
The gene of Caldicellulosiruptor bescii DSM6725 is template, and design primer is obtained by PCR reaction amplification
3 ' end containing 6 histidine tags saltant type thermo philic alkali pectin lyase PelC-CD gene (result be equivalent to cut out it is thermophilic
One section of N-terminal and catalysis pectin substance decompose unrelated sequence on alkaline pectate lyase PelC).Its nucleotide sequence such as SEQ
Shown in ID NO.1, sequencing spectrogram is as shown in Figure 1.Saltant type thermo philic alkali pectin lyase enzyme gene PelC-CD is connected to table
Recombinant expression carrier is obtained on up to carrier pET20b (+), which is transformed into E. coli BL21
(DE3) saltant type thermo philic alkali pectin lyase enzyme engineering bacteria is obtained in.
The construction method of saltant type thermo philic alkali pectin lyase enzyme engineering bacteria of the present invention is referring to document：
Overproduction of alkaline polygalacturonate lyase in recombinant Escherichia
Coli by a two-stage glycerol feeding approach.2011, Shuying Fang, Jianghua Li,
Long Liu, Guocheng Du, Jian Chen.Volume 102, Issue 22, November 2011, Pages 10671-
10678.Specific step is as follows：
(1) using 6725 complete genome DNA of Caldicellulosiruptor bescii DSM as template, design primer,
3 ' saltant type thermo philic alkali pectin lyase PelC-CDs of the end containing 6 histidine tag genes are obtained by PCR reaction amplification
Gene；
(2) after the saltant type thermo philic alkali pectin lyase enzyme gene PelC-CD digestion for obtaining step (1) with pET20b
The connection of (+) expression vector, obtains recombinant expression carrier pET20b (+)-PelC-CD；
(3) recombinant expression carrier pET20b (+)-pelC-CD is transformed into Bacillus coli expression host Escherichia
In coli BL21 (DE3), building obtains saltant type thermo philic alkali pectin lyase enzyme engineering bacteria of the present invention
Escherichia coli BL21(DE3)/pET20b(+)-PelC-CD。
PCR primer, including upstream primer and downstream primer,
Upstream primer：5'GGAATTCCATATGGGTGGTGTTTTAGTTATTACAGATACAATAATTG 3',
Downstream primer：5'CCGCTCGAGTCAGTGGTGGTGGTGGTGGTGCTCGAGGTATTGATG 3',
The CATATG at the end upstream primer 5' is I restriction enzyme site of Nde, protects bases G GAATTC；The end downstream primer 5'
CTCGAG is I restriction enzyme site of Xhol, protects base CCG.
Described recombinant expression carrier pET20b (+)-PelC-CD is by saltant type thermo philic alkali pectin lyase enzyme gene
PelC-CD is obtained between being inserted into I site Nde I and Xhol of expression vector pET20b (+).
The engineering bacteria is to obtain recombinant expression carrier importing competent cell E.coli BL21 (DE3).
A second object of the present invention is to provide a kind of saltant type using engineering bacterium fermentation of the present invention production is thermophilic
Heated alkaline pectin lyase, amino acid sequence is as shown in SEQ ID NO.2.It is by saltant type thermo philic alkali pectin lyase
Engineering bacteria is inoculated with (inoculum concentration 2 ‰~5 ‰ (v/v)) into the 50mL conical flask equipped with 20mL seed culture medium, 37 DEG C, 170r/
Min shaken cultivation is to OD600=6.0, obtain seed liquor；Then seed liquor is seeded to the fermented and cultured containing 50 μ g/mL ammonia benzyls
In base, connecing bacterium amount is 2 ‰~5 ‰ (v/v), and liquid amount is that (2L refers to fermentation culture volume to 2L/5L, and 5L refers to taper
The volume of bottle), in 37 DEG C, 170r/min oscillation training to OD600Final concentration 0.5mM IPTG is added when=0.6 to be induced, simultaneously
Temperature is adjusted to 25~28 DEG C, revolving speed is adjusted to 100~120r/min, induction fermentation 18~for 24 hours, to obtain engineering bacteria hair
Zymotic fluid.By cell ultrasonication, it is heated and inactivated Escherichia coli foreign protein, affinity chromatography method obtains saltant type thermo philic alkali
Pectin lyase.Saltant type thermo philic alkali pectin lyase content can reach 40mg/L (1L fermentation after ni-sepharose purification is handled
Liquid).
In the above-mentioned methods, the solvent of the seed culture medium is water, solute and its end in the seed culture medium
Concentration is respectively：Tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L；The pH value of culture medium is 7.0-7.2；Fermentation
The composition of culture medium is as follows：The solvent of culture medium is water, solute and its final concentration of in the fermentation medium：Tryptose
Peptone 10g/L, yeast extract 5g/L, NaCl 10g/L；The pH value of culture medium is 7.0~7.2；
Third purpose of the present invention is to provide the saltant type thermo philic alkali pectin lyase in depolymerized pectin substance
Application.
In present invention application, the pectin substance is polygalacturonase.
Saltant type thermo philic alkali pectin lyase of the present invention, 70 DEG C degrade polygalacturonases enzyme activity be
5300U/mg；Thermostabilization is preferable, under 70 DEG C of heat preservations, half-life period 6h；Optimal reactive temperature is 70 DEG C, most suitable Ca2+Concentration is
0.8mM, substrate are 0.2% (w/v) pH=9.5.Saltant type thermo philic alkali pectin lyase in engineering bacteria provided by the present invention
Amount of fermentation is greatly improved than wild strain Caldicellulosiruptor bescii DSM 6725, more adaptation work
Industry production requirement provides effectively method for industrial mass production alkaline pectase.
Detailed description of the invention
Fig. 1 is saltant type thermo philic alkali pectin lyase gene sequencing map.
Fig. 2 is saltant type thermo philic alkali pectin lyase SDS-PAGE protein electrophoresis figure；Wherein, 1 is Marker, 2
Albumen after dialysis in solution.
Fig. 3 is the optimal pH curve of thermo philic alkali pectin lyase of the present invention.
Fig. 4 is the optimal reactive temperature curve of thermo philic alkali pectin lyase of the present invention.
Fig. 5 is the most suitable Ca of thermo philic alkali pectin lyase of the present invention2+Concentration curve.
Fig. 6 is the thermal stability curve of thermo philic alkali pectin lyase of the present invention.
PelC-CD and protoenzyme PelC Rate activity comparison diagram when Fig. 7 is 70 DEG C.
Specific embodiment
Experimental method used in following embodiments is routine experiment method unless otherwise specified.
Consumptive material as used in the following examples, reagent, instrument, are commercially available unless otherwise specified.
The instrument that the measurement of protein content uses in following embodiments is that Nano Drop microspectrophotometer detects albumen
Concentration.
Embodiment 1：The building of thermophilic engineering bacteria and the expression of enzyme
(1) design of primers and with PCR method obtain thermo philic alkali pectin lyase enzyme gene PelC
Using the genome of hot Fusobacterium Caldicellulosiruptor bescii DSM6725 as template, design primer,
PelC-CD gene is expanded by PCR method, amplified production is subjected to agarose gel electrophoresis, table is sequenced in recovery purifying 600bp
Bright, the size of the segment is 603bp, and sequence is as shown in sequence table SEQ ID NO.1.
The sequence of upstream primer is as follows：
Upstream primer 1：
5'GGAATTCCATATGGGTGGTGTTTTAGTTATTACAGATACAATAATTG 3'
(underscore base is I restriction endonuclease recognition sequence of Nde)；
The sequence of downstream primer is as follows：
Downstream primer 2:
5'CCGCTCGAGTCAGTGGTGGTGGTGGTGGTGCTCGAGGTATTGATG 3'
(underscore base is I restriction endonuclease recognition sequence of Xhol).
PCR reaction system is as follows：(primer concentration is 20 μm of ol/L)
PCR reaction condition：94 DEG C of initial denaturation 10min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 30
72 DEG C of extension 10min, 4 DEG C of preservations obtain DNA fragmentation shown in sequence after circulation.By the DNA piece of sequence
Section, with I double digestion of Nde I and Xhol, with by the skeleton segment of Nde I and the carrier pET20b (+) of I double digestion of Xhol into
Row connection overnight, obtains recombinant vector pET20b (+)-PelC-CD, confirms by sequencing, and recombinant vector is in carrier pET20b
Sequence is inserted between I site Nde I and Xhol of (+).
Digestion system is following (20 μ L)：
Linked system is following (20 μ L)：
The building side of pET20b (+)-pelC-CD (pET20b (+) is purchased from EMD Biosciences (Novagen) company)
Method bibliography：Overproduction of alkaline polygalacturonate lyase in recombinant
Escherichia coli by a two-stage glycerol feeding approach.2011, ShuyingFang,
Jianghua Li, Long Liu, Guocheng Du, Jian Chen.Volume 102, Issue 22, November 2011,
Pages 10671–10678。
(2) preparation engineering bacterium
The preparation of competent cell：Picking single colonie, inoculation on streak plate culture medium by E.coli BL21 (DE3)
Into LB culture medium.37 DEG C of shaken cultivations.Measure OD600Value, works as OD600It (is about cultivated 3-4 hours, this is real when value reaches 0.3
Test successful key).It takes above-mentioned bacterial culture fluid in 50mL centrifuge tube, places 10min on ice.4 DEG C of centrifugation 10min
(4000r/min), pours out culture medium, and nozzle is inverted so that culture medium is flow to end.With the 0.1mol/L of ice-cold (4 DEG C)
CaCl210mL suspension cell precipitating, places 30min on ice.4 DEG C of centrifugation 10min (4000r/min).Supernatant is poured out, use is ice-cold
0.1mol/L CaCl22mL suspension cell precipitates (must be placed on ice).Cell is dispensed, pre-cooling is added contains 30% (v/v)
Glycerol, every 200 μ L of pipe packing, -80 DEG C of refrigerators save, this cell is competent cell.This permissive cell is used directly for DNA
Transformation experiment, can also be saved in -80 DEG C of refrigerators, in case use later.When -80 DEG C of refrigerators save, can effectively save
1 year or more, but it is unable to multigelation, once freeze thawing, cannot save carrying out -80 DEG C of refrigerators.
The amplification of expression vector is verified：The DNA conversion of competent cell is that the competent cell for saving -80 DEG C of refrigerators is set
Yu Bingzhong melts 5min.2 μ L (50ng) of recombinant expression carrier pET20b (+)-PelC-CD is added, is placed on ice after mixing gently
30min.After placing 90s in 42 DEG C of water-baths, 3min is placed in ice immediately.The LB culture medium of 980 μ L pre-temperatures of every pipe addition, 37
DEG C culture 1h (160r/min).Appropriate spread plate is taken, plate is inverted in 37 DEG C of incubators and cultivates a night.
(3) expression (preparation of albumen) of saltant type thermo philic alkali pectin lyase
Prepare seed liquor：Engineering bacteria Escherichia coli BL21 (DE3)/pET20b (+)-that step (2) are obtained
PelC is seeded in the 50mL conical flask equipped with 20mL seed culture medium with 4 ‰ (v/v), 37 DEG C, 170r/min oscillation 8h extremely
OD600=6.0, obtain seed liquor；The solvent of the seed culture medium is water, solute and its dense at the end of the seed culture medium
Degree is respectively：Tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L；The pH value of culture medium is 7.0.
Fermented and cultured：Seed liquor is taken to be seeded to the conical flask of the 5L equipped with 2L fermentation medium with the inoculum concentration of 4 ‰ (v/v)
In；First 37 DEG C, 170r/min shaken cultivation to OD600=0.6, IPTG is then added, and (inducer induces destination protein saltant type
The expression of thermo philic alkali pectin lyase) extremely final concentration of 0.5mM, 25 DEG C, 110r/min continuation shaken cultivation 20h are sent out
Zymotic fluid.
The fermentation medium identical as mentioned-above seed culture based component (is LB culture medium, seed culture medium
20mL, fermentation medium 2L).
Fermentation liquid 6000r/min obtained in above-mentioned steps is centrifuged 10min, abandons supernatant, collects thallus (500mL bacterium solution
A pipe is collected, -20 DEG C of preservations are put into)；The segregation mutant thermo philic alkali pectin lyase from the thallus, the specific method is as follows：
The formula of 10 × Tris-HCl of buffer (200mM)：It takes 24.2g Tris-base to be placed in 1L beaker, is added about
Dissolution is sufficiently stirred in 800mL deionized water, and with 1mol/L HCl tune pH to 8.0, by solution volumetric flask constant volume to 1L, 4 DEG C are protected
It deposits.10 times are diluted when use.
Saltant type thermo philic alkali pectin lyase purification process：By the engineering bacteria of step (2) acquisition according to the ratio of 1g/10mL
Example is dissolved in 20mM, in pH 8.0Tris-HCl buffer, ultrasonication 30min on ice is placed in, when bacterium solution is become from viscous pasty state
Bright, 4 DEG C, 12000r/min centrifugation 15min collect supernatant protein liquid；Supernatant protein liquid is put into 72 DEG C of water-baths
30min is kept the temperature, 4 DEG C, 12000r/min centrifugation 15min collect supernatant protein liquid；Supernatant protein liquid is passed through into affinity chromatography
Method processing, is eluted by 50mM imidazoles-Tris-HCl, obtains elution protein liquid；The albumen that elution protein liquid dialysed overnight obtains
Liquid, that is, saltant type of the present invention thermo philic alkali pectin lyase, amino acid sequence is as shown in SEQ ID NO.2.
Embodiment 2：Saltant type thermo philic alkali pectin lyase characteristic
The enzyme activity determination method of saltant type thermo philic alkali pectin lyase described in embodiment 1 is specific as follows：
The preparation of substrate：It weighs 0.2g polygalacturonase to be placed in 100mL beaker, addition is about dissolved in 80mL, 50mM
Dissolution is sufficiently stirred in Gly, and solution volumetric flask constant volume to 100mL is made into 0.2% (w/ with 1mol/L NaOH tune pH to 9.5
V) substrate.
Control group：100 μ L, 0.8mM, CaCl are added in 800 μ L substrates2, 70 DEG C of preheating 1min, 100 μ L of addition,
The absorbance value of measurement 235nm in the Tris-HCl of 20mM, pH8.0,2min；
Experimental group：100 μ L, 0.8mM, CaCl are added in 800 μ L substrates2, 70 DEG C of preheating 1min, addition 100 μ L, 20 μ
The saltant type thermo philic alkali pectin lyase enzyme solutions of g/mL, the absorbance value of the interior measurement 235nm of 2min.
One standard enzyme activity unit (1U) of saltant type thermo philic alkali pectin lyase is defined as：Under the above conditions,
Enzyme amount needed for making polygalacturonase generate the unsaturated polygalacturonase of 1 μm of ol in the 1min reaction time.
Saltant type thermo philic alkali pectin lyase enzyme activity (U/mL) calculation formula is as follows：
In formula：4600(L·mol-1·cm-1) it is molar absorption coefficient of the unsaturated polygalacturonic acid at 235nm
The property research of the surveyed saltant type thermo philic alkali pectin lyase of the present invention, unless otherwise specified, after being all dialysis
Saltant type thermo philic alkali pectin lyase protein liquid；It unless otherwise specified using measuring method for activity, is all ultraviolet suction at 235nm
It receives.
(1) optimal pH
Method：Using obtained by embodiment 1, saltant type thermo philic alkali pectin lyase enzyme solution is as solution to be measured, according to embodiment
Method in 2 is detected in 70 DEG C of progress saltant type thermo philic alkali pectin lyase activities, and difference is only that will be in reaction system
Substrate is dissolved in 50mM Gly buffer, and 1M NaOH tune pH value (3.5~12.0, survey different enzyme activity every 0.5) are added dropwise.
Highest enzyme activity is denoted as 100%, calculates saltant type thermo philic alkali pectin lyase under the buffer of different pH
Opposite enzyme activity (%), as a result as shown in Figure 3；With Gly-NaOH buffer solution substrate, measuring opposite enzyme activity when pH is 9.5 is
100%.Saltant type thermo philic alkali pectin lyase of the present invention is more sensitive to the variation of pH, in acid condition basic inspection
Vigor is not detected, vigor is larger under alkaline condition.Work as pH<8 or pH>When 12, it is substantially not detectable enzyme activity；When 8<pH<12
When, in pH=9.5, enzyme activity is maximum, and when pH=8.5 or pH=11.5, enzyme activity is maximum when vigor is less than pH 9.5
20%.
The result shows that the optimum pH of saltant type thermo philic alkali pectin lyase of the present invention is 9.5, pH<8 or pH>
When 12, enzyme activity is almost lost.
(2) optimum temperature
Method：Using obtained by embodiment 1, saltant type thermo philic alkali pectin lyase enzyme solution is as solution to be measured, according to embodiment
Method in 2, carries out the detection of saltant type thermo philic alkali pectin lyase activity at different temperatures, and difference is only that reaction condition
It is middle to use different reaction temperatures (35~90 DEG C, survey different enzyme activity every 5 DEG C).
Highest enzyme activity is denoted as 100%, calculates the opposite enzyme activity for using other different temperatures.As a result as shown in figure 4,70 DEG C
Opposite enzyme activity be 100%.The raising of the activity with temperature of saltant type thermo philic alkali pectin lyase and increase, temperature is at 65 DEG C
Enzyme activity is all bigger at~70 DEG C, retains 80% or more of maximum enzyme activity；At 70 DEG C, enzyme activity is maximum；When being higher than 70 DEG C,
Enzyme activity declines rapidly.
The result shows that：The optimum temperature of saltant type thermo philic alkali pectin lyase is 70 DEG C, the enzyme activity at 65 DEG C~70 DEG C
Keep 80% or more.
(3)Ca2+Concentration
Method：Using obtained by embodiment 1, saltant type thermo philic alkali pectin lyase enzyme solution is as solution to be measured, according to embodiment
Method in 2 is detected in 70 DEG C of progress saltant type thermo philic alkali pectin lyase activities, and difference is only that Ca in reaction condition2+
Concentration (between 0~1 every between 0.1mM, 1~3 every 1mM) is different.
By Ca2+Enzyme activity highest is denoted as 100% when concentration is 0.8mM, calculates and uses other differences Ca2+The opposite enzyme of concentration
It is living.As a result as shown in Figure 5：Saltant type thermo philic alkali pectin lyase of the present invention is to be completely dependent on Ca2+Type works as reactant
There is no Ca in system2+In the presence of, which does not show vigor.Ca2+Concentration enzyme activity in 0.5~1.0mM is all bigger, retains maximum
The 80% of enzyme activity；In 0.8mM, enzyme activity is maximum；When concentration is greater than 1mM, enzyme activity declines rapidly.
The result shows that：The most suitable Ca of saltant type thermo philic alkali pectin lyase2+Concentration is 0.8mM, in 0.5~1.0mM
Enzyme activity retains 80% or more.
(4) thermal stability
Method：Using obtained by embodiment 1, saltant type thermo philic alkali pectin lyase enzyme solution is as solution to be measured, according to embodiment
Method in 2 detects in 70 DEG C of progress saltant type thermo philic alkali pectin lyase activities, detects its enzyme activity every 1h.
(0min) is used as enzyme activity highest 100%, half life of enzyme when calculating 70 DEG C when will start.As a result as shown in fig. 6,
Enzyme activity declines slower, half-life period 6h at 70 DEG C；Enzyme activity there remains 30% or so after 10h.
The result shows that：Saltant type thermo philic alkali pectin lyase has good thermal stability, half-life period at 70 DEG C or less
For 6h.
PelC-CD and the comparison of protoenzyme PelC Rate activity at (5) 70 DEG C
Method：By the obtained saltant type thermo philic alkali pectin lyase PelC-CD of embodiment 1 and thermo philic alkali pectin
Lyases PelC is (referring to patent《A kind of thermo philic alkali pectin lyase enzyme gene, engineering bacteria and thermo philic alkali pectin lyase》)
70 DEG C of progress alkaline pectase viability examinations, and it is converted into Rate activity (U/mg).
Saltant type thermo philic alkali pectin lyase PelC-CD is 5300U/mg in 70 DEG C of Rate activities, and thermo philic alkali pectin
Lyases PelC Rate activity is 900U/mg, as shown in Figure 7.
The result shows that：Saltant type thermo philic alkali pectin lyase PelC-CD is than thermo philic alkali pectin lyase PelC 70
DEG C Rate activity greatly improves.
Content disclosed in this invention, it is believed that those skilled in the art can be to the maximum extent using the present invention.Therefore front
Preferred embodiment should be understood to be merely illustrative of, rather than limit the scope of the invention in any way.Ability
Domain researcher can make various changes and change to the present invention in the case where without departing from its spirit with range.
Claims (8)
1. a kind of than the saltant type thermo philic alkali pectin lyase PelC-CD gene living improved, nucleotide sequence such as SEQ ID
Shown in NO.1.
2. a kind of than the saltant type thermo philic alkali pectin lyase PelC-CD genetic engineering bacterium living improved, it is characterised in that：The work
The deposit number of journey bacterium is CGMCC No.11461, and classification naming is escherichia coli Escherichia coli, preservation list
Position is China Committee for Culture Collection of Microorganisms's common micro-organisms center, and the deposit date is on September 29th, 2015.
3. as claimed in claim 2 a kind of than the saltant type thermo philic alkali pectin lyase PelC-CD genetic engineering bacterium living improved
Construction method, its step are as follows：
(1) using 6725 complete genome DNA of Caldicellulosiruptor bescii DSM as template, design primer passes through
PCR reaction amplification obtains 3 ' the end saltant types as shown in SEQ ID NO.1 of the nucleotide sequence containing 6 histidine tag genes
Thermo philic alkali pectin lyase PelC-CD gene；
(2) after the saltant type thermo philic alkali pectin lyase enzyme gene PelC-CD digestion for obtaining step (1) with pET20b (+) table
It is connected up to carrier, obtains recombinant expression carrier pET20b (+)-PelC-CD；
(3) recombinant expression carrier pET20b (+)-pelC-CD is transformed into Bacillus coli expression host Escherichia coli
In BL21 (DE3), building is obtained than the saltant type thermo philic alkali pectin lyase PelC-CD genetic engineering bacterium living improved.
4. as claimed in claim 3 a kind of than the saltant type thermo philic alkali pectin lyase PelC-CD genetic engineering living improved
The construction method of bacterium, it is characterised in that：Primer described in step (1) includes upstream primer and downstream primer,
Upstream primer：5'GGAATTCCATATGGGTGGTGTTTTAGTTATTACAGATACAATAATTG 3',
Downstream primer：5'CCGCTCGAGTCAGTGGTGGTGGTGGTGGTGCTCGAGGTATTGATG 3',
The CATATG at the end upstream primer 5' is I restriction enzyme site of Nde, protects bases G GAATTC；The CTCGAG at the end downstream primer 5' is
I restriction enzyme site of Xhol protects base CCG.
5. a kind of than the saltant type thermo philic alkali pectin lyase PelC-CD, amino acid sequence such as SEQ ID NO.2 living improved
It is shown.
6. a kind of preparation method than the saltant type thermo philic alkali pectin lyase PelC-CD living improved described in claim 5,
It is characterized in that：It is by as claimed in claim 2 than the saltant type thermo philic alkali pectin lyase PelC-CD gene work living improved
Journey bacterium is seeded in the 50mL conical flask equipped with 20mL seed culture medium, 37 DEG C, 170r/min shaken cultivation to OD600=6.0,
Obtain seed liquor, inoculum concentration 2 ‰~5 ‰ (v/v)；Then seed liquor is seeded to the fermentation medium containing 50 μ g/mL ammonia benzyls
In, connecing bacterium amount is 2 ‰~5 ‰ (v/v), and liquid amount 2L/5L, 2L refer to fermentation culture volume, and 5L refers to conical flask
Volume, in 37 DEG C, 170r/min oscillation training to OD600Final concentration 0.5mM IPTG is added when=0.6 to be induced, simultaneously will
Temperature is adjusted to 25~28 DEG C, and revolving speed is adjusted to 100~120r/min, and induction fermentation 18~for 24 hours, to obtain engineering bacterium fermentation
Liquid；Again by cell ultrasonication, it is heated and inactivated Escherichia coli foreign protein, affinity chromatography method is obtained than the mutation living improved
Type thermo philic alkali pectin lyase.
7. described in claim 5 than the saltant type thermo philic alkali pectin lyase PelC-CD living improved in depolymerized pectin substance
Application.
8. as claimed in claim 7 than the saltant type thermo philic alkali pectin lyase PelC-CD living improved in depolymerized pectin substance
In application, it is characterised in that：Pectin substance is polygalacturonase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510901182.4A CN105368856B (en) | 2015-12-09 | 2015-12-09 | A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510901182.4A CN105368856B (en) | 2015-12-09 | 2015-12-09 | A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105368856A CN105368856A (en) | 2016-03-02 |
| CN105368856B true CN105368856B (en) | 2018-11-30 |
Family
ID=55371484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510901182.4A Expired - Fee Related CN105368856B (en) | 2015-12-09 | 2015-12-09 | A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368856B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113549608B (en) * | 2021-05-24 | 2022-03-08 | 中国农业科学院麻类研究所 | Pectin lyase mutant delta PelG403 and encoding gene, preparation method and application thereof |
| CN115772531A (en) * | 2022-11-11 | 2023-03-10 | 吉林农业大学 | Pectate lyase gene mutant and cloning method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206658A (en) * | 2011-04-08 | 2011-10-05 | 天津科技大学 | Alkalic xylanase gene and engineering bacterium containing same |
| CN102559638A (en) * | 2010-12-17 | 2012-07-11 | 武汉新华扬生物股份有限公司 | Alkaline pectinase poly lactic acid (PLA) and gene and application thereof |
-
2015
- 2015-12-09 CN CN201510901182.4A patent/CN105368856B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559638A (en) * | 2010-12-17 | 2012-07-11 | 武汉新华扬生物股份有限公司 | Alkaline pectinase poly lactic acid (PLA) and gene and application thereof |
| CN102206658A (en) * | 2011-04-08 | 2011-10-05 | 天津科技大学 | Alkalic xylanase gene and engineering bacterium containing same |
Non-Patent Citations (2)
| Title |
|---|
| 耐热果胶裂解酶基因pel9A的克隆和表达;甄东晓 等;《食品与生物技术学报》;20060331;第25卷(第2期);112-115 * |
| 耐热碱性果胶酶产生菌的筛选及鉴定;梅艳珍 等;《生物产业技术 增刊C13》;20091231;119-121 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105368856A (en) | 2016-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103740618A (en) | Novel bacillus-like strain as well as culture method and application thereof | |
| CN103361326B (en) | Partial glyceride lipase mutant with improved thermal resistance, mutant plasmid, recombination strain and preparation method | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN103333839B (en) | Mannanase, and gene and applications thereof | |
| WO2021232840A1 (en) | TRUNCATION MUTANT OF α-L-RHAMNOSIDASE AND APPLICATION THEREOF | |
| Chen et al. | Production of MBP–HepA fusion protein in recombinant Escherichia coli by optimization of culture medium | |
| CN102965361B (en) | Pullulanase XWPu2 and gene thereof | |
| CN105368856B (en) | A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living | |
| CN105062992A (en) | Endolysin and polynucleotide for encoding the same | |
| CN109609524A (en) | Protein and the application of a kind of lactobacillus plantarum nitrite reductase gene and its coding | |
| CN101372693A (en) | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use | |
| CN103614303B (en) | A kind of Li's Trichoderma strains of expressing saccharifying enzyme | |
| CN102732539A (en) | Novel esterase and its application | |
| CN105441467B (en) | A kind of thermo philic alkali pectin lyase enzyme gene, engineering bacteria, thermo philic alkali pectin lyase and its application | |
| CN103436506A (en) | Alkaline thermal-stable esterase K91 Est8 and gene thereof | |
| CN102787129B (en) | Amidase gene of Variovorax boronicumulans CGMCC 4969, and its application in biological degradation of acrylamide | |
| CN109022406A (en) | It is a kind of with the algin catenase AlgA1 of acclimatization to cold characteristic and its application | |
| CN110760532B (en) | Starch branching enzyme and gene thereof, engineering bacterium containing gene and application of engineering bacterium | |
| CN107236692A (en) | The molten fiber series bacillus NP1 of termite, zytase PtXyn1 and its encoding gene and application | |
| CN101407820B (en) | Gene of encoding glycosyl hydrolase family 32 sucrase and use thereof | |
| CN103409397B (en) | High-temperature-resistant acid arabinosidase as well as coding gene and application thereof | |
| Chao et al. | Cloning and characterization of an alginate lyase from marine Vibrio. sp. QD-5 | |
| CN107217065B (en) | Endo glucanase gene and its coding albumen | |
| CN103184204A (en) | Xylanase SoxB and coding gene thereof | |
| CN114045241B (en) | Bacillus subtilis HKS018 and application thereof in production of beta-mannase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181130 Termination date: 20211209 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |