CN107236692A - The molten fiber series bacillus NP1 of termite, zytase PtXyn1 and its encoding gene and application - Google Patents
The molten fiber series bacillus NP1 of termite, zytase PtXyn1 and its encoding gene and application Download PDFInfo
- Publication number
- CN107236692A CN107236692A CN201710533597.XA CN201710533597A CN107236692A CN 107236692 A CN107236692 A CN 107236692A CN 201710533597 A CN201710533597 A CN 201710533597A CN 107236692 A CN107236692 A CN 107236692A
- Authority
- CN
- China
- Prior art keywords
- ptxyn1
- zytase
- series bacillus
- gene
- termite
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/248—Xylanases
- C12N9/2482—Endo-1,4-beta-xylanase (3.2.1.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01008—Endo-1,4-beta-xylanase (3.2.1.8)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to biological technical field, and in particular to the molten fiber series bacillus NP1 of termite, zytase PtXyn1 and its encoding gene and application.The molten fiber series bacillus NP1 of termite, was preserved in China typical culture collection center (CCTCC), preserving number is M2016072 on 2 25th, 2016.The amino acid sequence of the zytase PtXyn1 is as shown in SEQ ID NO.2.Zytase PtXyn1 of the present invention has the advantages that enzymatic activity is high and highly stable under gentle high temperature, has important more practical value in terms of the commercial Application of zytase, is had broad application prospects in the industries such as food, feed.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of molten fiber series bacillus NP1 of termite, zytase
PtXyn1 and its encoding gene and application.
Background technology
Lignocellulosic is nature most abundant biomass resource, and holding to human society is comprehensively utilized to it
Supervention exhibition is significant.It is mainly some fungies and bacterium in the microorganism of nature energy lignocellulose degradation, to this
The excavation of living resources slightly will be helpful to the development and utilization to biomass.Lignocellulosic by cellulose, hemicellulose and
Lignin these three high-molecular compounds composition, can be stabilized in nature.Lignocellulose degradation needs a series of complex
The interaction of a variety of enzymes in enzyme system.The microorganism of energy lignocellulose degradation is containing abundant cellulase, hemicellulose
Enzyme etc., therefore, the screen fibre element degradation bacteria from natural environment, by with good exploitation and application prospect.
Xylan rich content in hemicellulose, structure is more complicated than cellulose, and degradable xylan needs a variety of
The synergy of hydrolase (i.e. xylanolytic enzyme system is united).Zytase (E.C 3.2.1.8) is that a class is dropped with internal-cutting way
Solve the enzyme system of β -1,4- xylose glycosidic bonds in xylan molecule.Inscribe-β -1,4- zytases are the main functions of xylan degrading
Enzyme, it can make xylan degrading be xylose or wooden poly oligosaccharide with xylobiase collective effect.In recent years, zytase exists
Wide application prospect is all show in food, weaving, feed, energy industry.Addition contains zytase in pig starter feed
Complex enzyme formulation can improve dry, thick protein crude fibre etc. apparent digestibility and reduction excrement in Escherichia coli
Number and diarrhea rate.In paper industry, carry out prebleaching using hemicellulase, help drift, the usage amount of chemicals can be reduced,
Have become a kind of technology of more maturation.During juice production, using zytase, cellulase and pectase
It is jointly processed by that the viscosity of extract solution can be reduced, is conducive to filtering and concentrates.But in actual production and application process, need
Want some stable under gentle hot conditions in and can preferably play the zytase that enzyme activity is acted on.Therefore, lived
Property it is high and the zytase of gentle high-temperature stable has important more practical value for the commercial Application of zytase in.
The content of the invention
Present invention aims at provide one plant of molten fiber series bacillus NP1 of termite with the plain digestive enzyme of multiple fiber.
Second object of the present invention is to provide the high and stable wood of Enzyme activity under a kind of hot conditions gentle in
Dextranase PtXyn1.
It is another object of the present invention to provide a kind of gene for encoding the zytase PtXyn1.
A further object of the present invention is that providing a kind of restructuring comprising the encoding xylanase PtXyn1 genes carries
Body, transformant, recombinant virus, recombinant bacterium and transgenic cell line.
It is yet a further object of the present invention to provide applications of the zytase PtXyn1 in terms of degradation of xylan.
For achieving the above object, the technical solution adopted in the present invention is：
The molten fiber series bacillus of one plant of termite, the Strain Designation is series bacillus NP1 (Paenibacillus
Termiticellulosilyticus NP1), China typical culture collection center was preserved on 2 25th, 2016, is protected
Hide unit address：China, Wuhan, Wuhan University, preserving number is CCTCC NO：M2016072.
Above-mentioned series bacillus NP1 colonial morphology and physio-biochemical characteristics be：Series bacillus NP1 bacterium colonies are rounded,
Moistening, it is smooth, thalline be in shaft-like, about 0.3-0.4 × 1.7-3.0 μm of thalline size；Gram-negative, aerobic, atrichia
Or peritricha, without motility, gemma near-end life (Fig. 1)；The growth temperature range of the bacterium is 5~50 DEG C, grows pH value range
For 4.5~9.5, growth salinity range is 0%~1.75%；Can using L-arabinose, D-ribose, D- xyloses, D- galactolipins,
D-Glucose, D-MANNOSE, methyl-β-D- xylopyranoses glucosides, cellobiose, maltose, aesculin etc. are carbon source for growth；Have
Esterase (C4), leucine arylamine enzyme, naphthols-AS-BI- phosphohydrolases, alpha-galactosidase, beta galactosidase, α-grape
The activity of the enzymes such as glycosidase, beta-glucosidase；Can assimilate arginine, urea, aesculin, to nitro-β-D- methylgalactoses
Deng the activity with enzymes such as arginine dihydrolase, urase, beta-glucosidases；Thalline aliphatic acid is mainly anteiso-
C15:0And iso-C16:0, breathing quinone main Types are MK-7, and cell membrane contains meso diaminopimelic acid (DAP).
Above-mentioned series bacillus NP1 gene sequence characteristic is：Series bacillus NP1 Genome Sizes are about 6.1Mb, base
Because group DNA G+C contents are 54.41mol%, with 5329 encoding genes；In the bacterium genome containing more than 200 with it is wooden
The related enzyme gene of cellulose degradation, including belong to 112 enzyme genes of 63 glycosyl hydrolase (GH) families, belong to 22 families
The gene of 72 encoding carbohydrate binding structural domains of race, 10 endo glucanase genes, 3 exoglucanase bases
Cause, 9 alpha-glucosidase genes, 12 xylanase genes and 5 xylobiase genes etc..Phylogenetic Analysis shows this
Pseudomonas is solution curdled milk series bacillus JCM12163 with its most close identified bacterial strain in bacillus genusT, two plants of bacterium
The similitude of 16S rRNA genes is 97% (Fig. 2).
A kind of zytase for coming from series bacillus NP1, is named as zytase PtXyn1, it is characterised in that institute
Zytase PtXyn1 amino acid sequence is stated as shown in SEQ ID NO.2.
A kind of gene for encoding above-mentioned zytase PtXyn1, the encoding gene is any above-mentioned zytase of coding
PtXyn1 DNA sequence dna.
In such scheme, the nucleotide sequence of the gene of the encoding xylanase PtXyn1 is as shown in SEQ ID NO.1.
A kind of recombinant vector comprising above-mentioned encoding xylanase PtXyn1 genes, transformant, recombinant virus, recombinant bacterium and
Transgenic cell line.
Applications of the above-mentioned zytase PtXyn1 in terms of degradation of xylan.
Beneficial effects of the present invention are as follows：Present invention screening obtains one plant of class gemma with the plain digestive enzyme of multiple fiber
Bacillus NP1, screening obtains zytase PtXyn1 encoding gene from series bacillus NP1 gene, by building weight
Group plasmid obtains zytase PtXyn1 after obtaining recombinant bacterium, encoding gene expression；Zytase PtXyn1 of the present invention
Have the advantages that Enzyme activity is high and stable under gentle hot conditions in, there is important reality in the commercial Application of zytase
Value is trampled, is had broad application prospects in the industries such as food, feed.
Brief description of the drawings
Fig. 1 is series bacillus NP1 form scanning electron microscopic picture, left：Series bacillus NP1 scanning electron microscope (SEM) photograph；It is right：
Series bacillus NP1 spore staining.
Fig. 2 is series bacillus NP1 Phylogenetic Analysis figure.
Fig. 3 is recombinant expression plasmid pET30a (+)-Ptxyn1 building process figures.
Fig. 4 analyzes for recombined xylanase PtXyn1 SDS-PAGE, wherein M：Albumen Marker；1：Zero load control；2：
Control is not induced；3：Induce 20 hours protein samples；4：The albumen of purifying.
Optimal reaction pH value (a) and pH stability (b) that Fig. 5 is zytase PtXyn1.
Fig. 6 is zytase PtXyn1 optimal reactive temperatures (a) and temperature stability (b).
Embodiment
For a better understanding of the present invention, with reference to the embodiment content that the present invention is furture elucidated, but the present invention
Content is not limited solely to the following examples.
The series bacillus NP1 of embodiment 1 (CCTCC M2016072) research
This laboratory obtains the molten fiber series bacillus of one plant of termite from as termite gut is separately cultured, and is named as class bud
Spore bacillus NP1.
(1) morphological feature and growth characteristics to series bacillus NP1 makees following research：
Series bacillus NP1 in TSB culture mediums (U.S. company BD, pH value 7.2) 30 DEG C it is incubated.It is inoculated into solid
Medium culture one day, forms circular, moistening, smooth bacterium colony on flat board.Bacterium cell size about 0.3-0.4 × 1.7-3.0 μ
M, thalline, in shaft-like, is Gram-negative bacteria, aerobic, and gemma near-end is given birth to (see Fig. 1), without motility.Used with 1% inoculum concentration
TSB fluid nutrient medium culture NP1, it is 5 DEG C~50 DEG C to measure the bacteria growing temperature range, and optimum growth temperature is 30 DEG C；Growth
PH scopes are 4.5~9.5, and the most suitable growth pH is 7.0；It can grow, be more than in salinity in 0%~1.75% salinity range
Show as not growing in the case of 2%.
(2) physio-biochemical characteristics to series bacillus NP1 make following research：
(1) utilization of carbon source：Characteristics of the series bacillus NP1 to utilization of carbon source is studied using API 50CH reagent strips.As a result
Show, the bacterium can using L-arabinose, D-ribose, D- xyloses, D- galactolipins, D-Glucose, D-MANNOSE, methyl-β-
The substrate utilizations such as D- xylopyranoses glucosides, cellobiose, maltose, aesculin production acid.
(2) intracellular enzyme activity and assimilation：Using APIZYM and API20NE reagent strips research series bacillus NP1
Intracellular enzyme activity and assimilation.As a result show, the bacterium has esterase (C4), leucine arylamine enzyme, naphthols-AS-BI- phosphorus
The activity of the enzymes such as sour hydrolase, alpha-galactosidase, beta galactosidase, alpha-glucosidase, beta-glucosidase.Can be same
Change arginine, urea, aesculin, to nitro-β-D- methylgalactoses etc., with arginine dihydrolase, urase, β-glucose
The activity of the enzymes such as glycosides enzyme.
(3) other enzymatic activitys such as oxidizing ferment, catalase：With 1% isometric p- ammonia of series bacillus NP1 bacterium cytosis
The base dimethylaniline dihydrochloride aqueous solution and 1% α-how phenol ethanol solution, illustrate that the bacterium oxidizing ferment is feminine gender according to color reaction.
With bacterium cytosis 5%H2O2Bubble is produced, it is the positive to illustrate its catalase.Reduction by Thiosulfate can be by series bacillus NP1
Sulphite simultaneously discharges H2S.In addition, the bacterium is unable to hydrolyzed casein, esterase and amylolytic enzyme are feminine gender.
(4) analysis of thalline aliphatic acid, breathing a kind of jade etc.：Extract after bacterial strain NP1 aliphatic acid through gas chromatograph detection point
Analysis obtains bacterial strain NP1 aliphatic acid key component for anteiso-C15:0And iso-C16:0.Bacterial strain NP1 breathing a kind of jade is extracted, through HPLC
Analysis finds that the breathing quinone main Types of the bacterial strain are MK-7.In addition, its cell membrane contains meso diaminopimelic acid
(DAP)。
(3) to the research of series bacillus NP1 genomes
With TSB fluid nutrient medium culture series bacillus NP1, bacterium cell is collected, bacterial genomes DNA extracts reagents are utilized
Box extracts bacterial strain NP1 genomic DNA.Sample is sequenced using three generations's microarray dataset.Sequencing result is analyzed, tied
Fruit shows that series bacillus NP1 Genome Sizes are about 6.1Mb, with 5329 encoding genes.Contain more than 200 in genome
The individual enzyme gene related to ligocellulose degradation, including 10 endo glucanase genes, 3 exoglucanase genes, 9
Individual alpha-glucosidase gene, 12 xylanase genes and 5 xylobiase genes etc..
Phylogenetic Analysis shows the Pseudomonas in bacillus genus, is solution curdled milk with its most close identified bacterial strain
Series bacillus JCM12163T, the similitude of two plants of bacterium 16S rRNA genes is 97%.Series bacillus NP1, in 2016
It is preserved in China typical culture collection center (CCTCC), depositary institution address within 25 days 2 months：China, Wuhan, Wuhan University is protected
Tibetan number is M2016072.
The zytase PtXyn1 of embodiment 2 and its encoding gene
(1) zytase PtXyn1 preparation
(1) PCR amplifications obtain zytase PtXyn1 encoding gene：Using series bacillus NP1 genomic DNA as mould
Plate, performing PCR amplification is entered with primer 30a-Ptxyn1-F, 30a-Ptxyn1-R (primer sequence see the table below 1), obtains PCR amplification productions
Thing.
Table 1 is used for the primer for cloning zytase PtXyn1
| Primer | Primer sequence (5 ' -3 ') |
| 30a-Ptxyn1-F | CCCATATGCACCATCATCATCATCATGCAACGACGATCACGTCCAATC |
| 30a-Ptxyn1-R | CCCTCGAGGTTAATTTCCAAATAATCGAGG |
(2) digestion, connection：With Xho I and Nde I double digestion pcr amplification products, with using Xho I and Nde I double in advance
The pET-30a (+) (being purchased from Novagen, catalog number is 69909-3) of digestion is attached by T4DNA ligases, is built
Recombinant expression carrier, then Transformed E .coli DH5 α competent cells are obtained, step of converting is as follows：
A) take 3 μ L connection products in 50 μ L competent cells, flick mixing, 30min is placed on ice；
B) 42 DEG C of accurate heat shock 90sec, should not rock, be immediately placed on ice；
C) 800 μ L LB (or SOC) culture mediums, 200rpm, 37 DEG C of shaken cultivations 1~1.5 hour are added；
D) 4000rpm centrifuges 3min, abandons after appropriate supernatant, gently suspension thalline, takes 100 μ L bacterium solutions even spreads to containing 50
On μ g/mL Kana agar plate, after bacterium solution is fully absorbed, 37 DEG C of 12~16h of culture of plate are inverted.
(3) screening and identification of positive recombinant：Picking single bacterium colony is entered performing PCR using Ptxyn1 gene primers and expanded, and tests
Recon of the card containing positive insertion target gene fragment, selects the bacterium colony being proved to be successful and is enlarged culture and extracts plasmid,
Double digestion and sequence verification are carried out, sequencing is T7promoter primer (5 '-TAATACGACTCACTATAGGG- with primer
3 ') and T7terminator primer (5 '-GCTAGTTATTGCTCAGCGG-3 '), (i.e. PtXyn1 encodes base to the sequence of acquisition
Cause) as shown in sequence 1 in sequence table.
Recombinant expression plasmid pET30a (+)-Ptxyn1 building process is as shown in figure 3, with series bacillus NP1 genome
DNA is that template enters performing PCR amplification, obtains target gene fragment.By gene Ptxyn1 connection expression vector pET30a (+), conversion
Bacillus coli DH 5 alpha competent cell, and whether successfully constructed by colony PCR amplification, double digestion checking carrier.
(4) recombined xylanase PtXyn1 induced expression：Recombinant plasmid pET30a (+)-Ptxyn1 is transformed into
In E.coli BL21 (DE3), recombinant bacterial strain is obtained.Picking recombinant bacterial strain single bacterium colony, is inoculated into containing Kana's (50 μ g/ml)
In 5mL LB culture mediums, 200r/min, 37 DEG C of constant temperature oscillator incubated overnights are activated.By the bacterium solution after activation by 1%
Switching amount, is transferred in the LB fluid nutrient mediums containing Kana (50 μ g/ml), 200r/min, 37 DEG C of 3~4h of culture, makes OD600=
0.6, add IPTG to final concentration of 0.2mmol/L, 16 DEG C of inductions.Meanwhile, with do not induce recombinant plasmid pET30a (+)-
Ptxyn1 and E.coli BL21 (DE3) the conduct controls containing empty plasmid.After induced expression terminates, 1mL bacterium solutions are taken, 10,
000rpm centrifuges 1min, goes in supernatant, bacterial sediment to add 50 μ L deionized waters resuspension thalline, adds 50 2 × SDS- of μ L
Boiled after PAGE sample-loading buffers, mixing 10 minutes, 10,000rpm centrifugation 5min, loading after cooling takes 20 μ L to carry out SDS-
PAGE gel electrophoresises, gel electrophoresis uses 5% concentration glue, 12% separation gel.
(2) zytase PtXyn1 purifying
1. the preparation of crude enzyme liquid：After a large amount of induced expression destination proteins, thalline is collected by centrifugation, appropriate buffer B are dissolved in
In, it is uniform that cryogenic high pressure cell crushing instrument smudge cells after thalline is resuspended.Gained crushes liquid in 4 DEG C, 10000g, centrifuges 30min,
Gained supernatant is filtered through 0.45 μm of filter membrane, obtains crude enzyme liquid.
2. destination protein is purified
Purified using affinity chromatography, supernatant, supernatant are purified with HisPur Ni NTA Resin (Thermo)
Filtered with 0.45 μm of filter.The destination protein with His labels is divided using Ni-Agarose-Resin protein purifications post
From purifying, step is as follows：
A adds chromatographic column after 1mL Ni-Agarose-Resin fillers are mixed, and is stored at room temperature in 10min, outflow post
The aseptic deionized water that 10 times of column volumes are added after ethanol is clean by alcohol flushing；
B. buffer B (Binding Buffer) the balance pillars of 10 times of column volumes are added；
C. crude enzyme liquid is added in pillar, 4 DEG C are rocked and combine 2h；
D. rinsed with the buffer B of 10 times of column volumes and sequentially add imidazole concentration after pillar and gradually rise (5-500mM)
Buffer is eluted, eluting peak is collected；
E. after eluting, pillar is washed using the buffer B of 5 times of column volumes and the aseptic deionized water of 5 times of column volumes；
F. 20% ethanol of 5 times of column volumes, 2-8 DEG C of preservation nickel post are eventually adding.
The Buffer B (Binding Buffer, pH8.0)：50mM NaH2PO4, 300mM NaCl.
3. recombinase PtXyn1 detection and concentration：Imitated using the purifying of PAGE gel electrophoresis testing goal albumen
Really.Destination protein after purification is concentrated using the super filter tube of retention 10kDa molecular weight, and using used in detection enzyme activity
Buffer replaces the buffer containing imidazoles, to remove the imidazoles in protein solution.
By recombinant expression plasmid pET30a (+)-Ptxyn1 after 0.2mM IPTG inductions, a molecular weight is generated about
For 40kDa recombinant protein, it is consistent with theoretical expectation values, as shown in figure 4, through Ni-NTA-Sefinose SDS- after purification
PAGE electrophoresis showed bands are single (Fig. 4 swimming lanes 4), obtain with electrophoretically pure destination protein, can be for the follow-up enzyme of progress
Learn specificity analysis.
(3) zytase TmXyn1 characteristic research
1. recombinase PtXyn1 Activity determinations：Xylanase activity, the enzyme for taking 50 μ l suitably to dilute are determined using DNS methods
Liquid, adds the xylans of 100 μ L 1% (Sigma beechwood xylan) solution, and 55 DEG C of incubation 5min add 200 μ l DNS
After solution, boiling water bath 10min is cooled to after room temperature, adds and light absorption value is determined at 1ml deionized waters, 540nm.With 1mg/ml's
Xylose is that standard sample draws standard curve, and the amount of gained reduced sugar is calculated according to standard curve.
Enzyme activity is defined：The enzyme amount that hydrolyzed xylan per minute produces 1 μm of ol xylose is defined as an enzyme-activity unit.
The composition of 1% xylan (Sigma beechwood xylan) solution：1g xylans are dissolved in 100mL 0.1M second
In acid-sodium acetate buffer (pH6.0), it is placed in boiling water bath and heats 5min, by gained xylan suspension 10,000 × g centrifugations
5 minutes, abandon precipitation after 4 DEG C of xylan solution save backup.
The composition of DNS solution：Weigh 185g sodium potassium tartrate tetrahydrates to be added in 500ml deionized waters, stirred on magnetic stirring apparatus
Mix to after being completely dissolved, plus 20.96g NaOH, 6.3g 3 is then added, 5- dinitrosalicylic acids (lucifuge) easily form knot
Block, is stirred continuously, and color can gradually become dark red.Add 5g anhydrous sodium sulfites, 5g crystalline phenols (crystalline phenol thing after being completely dissolved again
First it is put into 55 DEG C of water-baths and dissolves, is calculated by density and add 4.673ml), add in order.Brown bottle room temperature storage, is placed
Just it can use after more than one week.
2. optimal reaction pH and pH tolerance are determined
Different pH range buffers liquid：Acetic acid-sodium acetate buffer solution (pH 3.0-5.0), citric acid-sodium citrate buffer solution
(pH5.0-7.0), Tris-HCl buffer solutions (pH 7.0-9.0), Glycine-NaOH buffer solution (pH 9.0-11.0), with
0.5 is a gradient.Recombinase PtXyn1 is determined at 55 DEG C in the enzyme activity of different pH scopes, its optimal reaction pH value is determined；By enzyme
The buffer solution of liquid and pH 3.0~11.0 presses 1:10 ratio is with mixing, and 4 DEG C of refrigerators place 2d, under optimal reaction pH value respectively
Restructuring enzyme activity is determined, its pH tolerance is determined.
Recombinase PtXyn1 activity is detected under condition of different pH, it is 6.0 (Fig. 5 a) to find enzyme optimal reaction pH.Will
Recombinase is diluted in different pH buffer solution, 4 DEG C of placement 2d, then determines the remnant enzyme activity of recombinase, the recombinase measured
PtXyn1pH tolerability curves show that recombinase tolerance is best in pH 7.5, and after processing in the range of whole pH
Enzyme activity is held in more than 60%, illustrates that the recombinase has very wide pH tolerances.But in the range of pH 7.0~11.0
Residual enzyme activity be higher than acid condition, illustrate that the enzyme is stronger (Fig. 5 b) to the tolerance of alkalescence condition.
3. optimal reactive temperature and temperature stability are determined
Its enzyme activity in different temperatures scope (25-65 DEG C) is detected under the conditions of its optimal reaction pH value, recombinase is determined
PtXyn1 optimal reactive temperatures；Recombinant protein solution is incubated different time 45, at 50,55,60 DEG C respectively, after the completion of insulation
It is immediately placed on ice.10min is reacted at 55 DEG C and determines residual enzyme activity, its heat endurance is determined.With the wood not being heat-treated
Enzyme is used as relative enzyme activity as control, remnant enzyme activity and the percentage for compareing enzyme activity.
Measurement result shows that recombinase PtXyn1 optimal reactive temperatures are 55 DEG C, the enzyme activity in 25~65 DEG C of temperature ranges
Power is maintained at more than 40%, illustrates that the enzyme has wider enzyme activity temperature range (Fig. 6 a).Respectively 45, at 50,55,60 DEG C
It is incubated at different time, 55 DEG C and determines residual enzyme activity, determines its heat endurance.As a result the enzyme is shown when less than 45 DEG C,
Temperature stability is good, and after 45 DEG C of warm bath 30min, enzymatic activity is had little to no effect.70% is kept after being incubated 30min at 50 DEG C
The enzyme activity (Fig. 6 b) of left and right.
4. the measure of enzyme kinetics parameter
Milosevic constant km value and maximum reaction rate Vmax values are calculated using the double counting backward techniques of Lineweaver-Burk.With
0.2mol/L citric acid-sodium citrate buffer solutions (pH 6.0) are configured to the beech xylan substrate of 1-10mg/mL concentration, will
The liquid of protease of equivalent and the substrate of various concentrations react 10min under optimum reaction conditionses, and enzyme activity is calculated respectively, i.e., anti-
Answer speed V.Using 1/ [S] be abscissa, 1/V as ordinate map, obtain straight line, its transverse axis intercept be -1/Km, the longitudinal axis cut
Away from for 1/Vmax (maximum reaction velocity), slope is Km/Vmax, thus obtains Km and Vmax.
Measurement result shows that recombinase PtXyn1 milosevic constant km value and maximum reaction rate Vmax measure are used
Lineweaver-Burk graphing methods.Recombinase PtXyn1 be respectively to the Km and Vmax of beech wood glycan 6.2mg/mL and
3765.1μmol mg-1min-1。
5. the measure of substrate specificity
Under enzymatic reaction optimum reaction conditionses, recombinant protein is determined with beech wood glycan (beechwood xylan
1%), Corncob Xylan (corncob xylan, 1%), sodium carboxymethylcellulose (CMC-Na, 1%), microcrystalline cellulose
(Avicel PH-101,1%), 4- nitrobenzophenone-β-D- glucopyranosides (pNPG, 10mM), 4- nitrobenzophenone-β-D- pyrroles
Enzyme activity when muttering cellobioside (pNPC, 10mM), 4- nitrobenzophenone-β-D- xylopyranoses glucosides (pNPX, 10mM) for substrate,
Above substrate is prepared by 0.2mol/L citric acid-sodium citrate buffer solutions (pH 6.0).
The enzyme activity of different substrates is reacted with DNS methods and pNP methods detection recombined xylanase PtXyn1 respectively, as a result shown
Recombined xylanase PtXyn1 is only active to beech wood glycan, measures its Rate activity for 2118.7U/mg.To other substrates
Activity is not shown.Show that recombined xylanase PtXyn1 has stronger Substratspezifitaet.
Obviously, above-described embodiment is only intended to clearly illustrate made example, and the not limitation to embodiment.It is right
For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of change or
Change.There is no necessity and possibility to exhaust all the enbodiments.And the obvious change or change therefore amplified
Move within still in the protection domain of the invention.
Sequence table
<110>Central China Normal University
<120>The molten fiber series bacillus NP1 of termite, zytase PtXyn1 and its encoding gene and application
<160> 2
<210> 1
<211> 1095bp
<212> DNA
<213>Series bacillus NP1（Paenibacillus termiticellulosilyticus NP1）
The ＞ 1 of ＜ 400
atgaaagtaa ccaaatcgaa attattgttg gcgttagtgc ttagctttac gcttgctatg 60
cctgtaggag tcgcgaatgc ggcaacgacg atcacgtcca atcaaacggg tacgcaagac 120
ggctacgact acgagctgtg gaaagattcc ggcacgacga gcatgacgct caacagcggc 180
ggcgcgttca gcgcaacgtg gagcaatatt aataacgcct tgttccgtaa gggcaaaaag 240
ttcaatgcca cccaaacgca ccagcaaatc ggcaacatct ccatcaatta cgctgcaacg 300
ttcaatccgg gcggcaactc ttatctgacg gtatacggct ggacgaagag ctcgctcatc 360
gagtactaca tcatggataa ctggggaacg taccgcccgt ccggcacgaa taaaggttcg 420
ttctcggttg acggcggcac gtacgatatt tacgagacga cccgggttaa ccagccgtct 480
atcgaaggta cggcgacgtt caaacaatat tggagcatcc ggacggccaa acgttcgagc 540
ggtacgatct cggtaagcga gcacttcaag aagtgggaaa gcctgggcat gtcgctcggc 600
aaactgtacg aagtagcgct tacggttgag ggctatcaaa gcagcggcaa tgcgaacgtg 660
acgacgaacg tgctgacgat cggcggaagc ggaagcggcg gcggcggcgg tacaacgacc 720
cctccaagct cgggcgctac gaaagtggaa gcggagagca tgtcgaagag cggccaatac 780
acgggcaaca tcagctcgcc gttctcgggc gttgcactgt acgcgaataa cgatctggtc 840
aaatttacgc aaaacttcac gtccggcacg cacagcttct cgcttcgcgg cgcttcgaac 900
aactccagca cggctagagt cgatctgaaa atcggcggcg tgaccaaagg cagcttctac 960
ttcaccggta cgactcctgc cgtctcgacg atcagcaacg tcagcacggg aaccggtaat 1020
caagaaatcc agctcgtcgt cacgaccgat aacgggcaat gggacgcttt cctcgattat 1080
ttggaaatta actag 1095
<210> 2
<211> 337
<212> PRT
<213>Series bacillus NP1（Paenibacillus termiticellulosilyticus NP1）
The ＞ 2 of ＜ 400
Ala Thr Thr Ile Thr Ser Asn Gln Thr Gly Thr Gln Asp Gly Tyr Asp Tyr Glu Leu Trp
5 10 15 20
Lys Asp Ser Gly Thr Thr Ser Met Thr Leu Asn Ser Gly Gly Ala Phe Ser Ala Thr Trp
25 30 35 40
Ser Asn Ile Asn Asn Ala Leu Phe Arg Lys Gly Lys Lys Phe Asn Ala Thr Gln Thr His
45 50 55 60
Gln Gln Ile Gly Asn Ile Ser Ile Asn Tyr Ala Ala Thr Phe Asn Pro Gly Gly Asn Ser
65 70 75 90
Tyr Leu Thr Val Tyr Gly Trp Thr Lys Ser Ser Leu Ile Glu Tyr Tyr Ile Met Asp Asn
85 90 95 100
Trp Gly Thr Tyr Arg Pro Ser Gly Thr Asn Lys Gly Ser Phe Ser Val Asp Gly Gly Thr
105 110 115 120
Tyr Asp Ile Tyr Glu Thr Thr Arg Val Asn Gln Pro Ser Ile Glu Gly Thr Ala Thr Phe
125 130 135 140
Lys Gln Tyr Trp Ser Ile Arg Thr Ala Lys Arg Ser Ser Gly Thr Ile Ser Val Ser Glu
145 150 155 160
His Phe Lys Lys Trp Glu Ser Leu Gly Met Ser Leu Gly Lys Leu Tyr Glu Val Ala Leu
165 170 175 180
Thr Val Glu Gly Tyr Gln Ser Ser Gly Asn Ala Asn Val Thr Thr Asn Val Leu Thr Ile
185 190 195 200
Gly Gly Ser Gly Ser Gly Gly Gly Gly Gly Thr Thr Thr Pro Pro Ser Ser Gly Ala Thr
205 210 215 220
Lys Val Glu Ala Glu Ser Met Ser Lys Ser Gly Gln Tyr Thr Gly Asn Ile Ser Ser Pro
225 230 235 240
Phe Ser Gly Val Ala Leu Tyr Ala Asn Asn Asp Leu Val Lys Phe Thr Gln Asn Phe Thr
245 250 255 260
Ser Gly Thr His Ser Phe Ser Leu Arg Gly Ala Ser Asn Asn Ser Ser Thr Ala Arg Val
265 270 275 280
Asp Leu Lys Ile Gly Gly Val Thr Lys Gly Ser Phe Tyr Phe Thr Gly Thr Thr Pro Ala
285 290 295 300
Val Ser Thr Ile Ser Asn Val Ser Thr Gly Thr Gly Asn Gln Glu Ile Gln Leu Val Val
305 310 315 320
Thr Thr Asp Asn Gly Gln Trp Asp Ala Phe Leu Asp Tyr Leu Glu Ile Asn
325 330 335
Claims (6)
1. the molten fiber series bacillus of one plant of termite, it is characterised in that be named as series bacillus NP1
（Paenibacillus termiticellulosilyticusNP1）, it was preserved in Chinese allusion quotation on 2 25th, 2016
Type culture collection, preserving number is CCTCC NO：M2016072.
2. a kind of zytase, is named as zytase PtXyn1, it is characterised in that come from class gemma described in claim 1
Bar
Bacterium NP1, the zytase PtXyn1 amino acid sequence are as shown in SEQ ID NO.2.
3. encode the gene of zytase PtXyn1 described in claim 2.
4. gene according to claim 3, it is characterised in that the nucleotides of the gene of the encoding xylanase PtXyn1
Sequence is as shown in SEQ ID NO.1.
5. comprising the recombinant vector of encoding xylanase PtXyn1 gene described in claim 3 ~ 4, transformant, recombinant virus,
Recombinant bacterium and transgenic cell line.
6. applications of the zytase PtXyn1 in terms of degradation of xylan described in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710533597.XA CN107236692B (en) | 2017-07-03 | 2017-07-03 | Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710533597.XA CN107236692B (en) | 2017-07-03 | 2017-07-03 | Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107236692A true CN107236692A (en) | 2017-10-10 |
| CN107236692B CN107236692B (en) | 2020-09-29 |
Family
ID=59991452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710533597.XA Active CN107236692B (en) | 2017-07-03 | 2017-07-03 | Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107236692B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108004186A (en) * | 2018-01-09 | 2018-05-08 | 北京工商大学 | A kind of bacterial strain and application produced hydrolyzable and prepare high polymerization degree XOS zytases |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105368740A (en) * | 2015-11-13 | 2016-03-02 | 华中师范大学 | Termitidicoccus mucosus TSB47, xylanase TmXyn1 as well as encoding genes and applications thereof |
-
2017
- 2017-07-03 CN CN201710533597.XA patent/CN107236692B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105368740A (en) * | 2015-11-13 | 2016-03-02 | 华中师范大学 | Termitidicoccus mucosus TSB47, xylanase TmXyn1 as well as encoding genes and applications thereof |
Non-Patent Citations (3)
| Title |
|---|
| 包怡红 等: "木聚糖酶产生菌-类芽孢杆菌的筛选及其酶学研究", 《中国食品学报》 * |
| 徐荣: "木食性高等白蚁肠道内纤维素降解菌的筛选及酶活性分析", 《中国优秀硕士论文全文数据库 基础科学辑》 * |
| 王学敏: "海南象白蚁两株类芽孢杆菌共生菌的多相分类学鉴定", 《中国优秀硕士论文全文数据库 基础科学辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108004186A (en) * | 2018-01-09 | 2018-05-08 | 北京工商大学 | A kind of bacterial strain and application produced hydrolyzable and prepare high polymerization degree XOS zytases |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107236692B (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Orpin et al. | The rumen anaerobic fungi | |
| Zhu et al. | Characterization of a family 5 glycoside hydrolase isolated from the outer membrane of cellulolytic Cytophaga hutchinsonii | |
| CN109182360B (en) | Micromolecular cellulose endonuclease gene and protein and application thereof | |
| CN112725311B (en) | Xylanase mutant with high specific activity and heat resistance at animal body temperature and application thereof | |
| Sun et al. | Adsorption of Clostridium stercorarium xylanase A to insoluble xylan and the importance of the CBDs to xylan hydrolysis | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN104178472B (en) | The enzyme and its structure of degraded cellulose and application | |
| CN104745612A (en) | Genes of high temperature resistant xylanase and high temperature resistant xylosidase and protein expression and application thereof | |
| Badejo et al. | Biochemical properties of partially purified surfactant-tolerant alkalophilic endo beta-1, 4 xylanase and acidophilic beta-mannanase from bacteria resident in ruminants’ guts | |
| CN102559567A (en) | Construction of thermophilic endo-xylanase gene engineering strain and application of endo-xylanase of strain | |
| CN107236692A (en) | The molten fiber series bacillus NP1 of termite, zytase PtXyn1 and its encoding gene and application | |
| CN102816728A (en) | Construction of beta-1,4-endoxylanase engineering bacterium, and application of enzyme of beta-1,4-endoxylanase engineering bacterium | |
| CN101134949B (en) | Beta-glucanase, encoding gene thereof, recombinant plasmid and bacterial strain and uses thereof | |
| CN104313000B (en) | A kind of genetic engineering zytase and its preparation and application | |
| CN105368740B (en) | Stick-slip termite coccus TSB47, zytase TmXyn1 and its encoding gene and application | |
| CN109554355A (en) | Enhance active polypeptide and its application with cellulose degradation | |
| Kalawong et al. | Comparison and characterization of purified cellulase and xylanase from Bacillus amyloliquefaciens CX1 and Bacillus subtilis B4 | |
| CN101701213A (en) | Dual-function xylanase XYNBE18 and gene and application thereof | |
| CN101701214A (en) | Xylanase XYNA4 with wide pH applicability and gene and application thereof | |
| CN102174494B (en) | Marine cryophilic endo beta-xylanase XynB as well as expressing gene xynB and application thereof | |
| CN104560833A (en) | Basophilic micrococcus and alkaline xylanase produced from basophilic micrococcus and application | |
| CN106148369A (en) | High-temperature alkaline transelminase Pel-863 and encoding gene thereof and application | |
| CN103290039B (en) | Alpha-amylase derived from animal feces metagenome and gene of the alpha-amylase | |
| Matsui et al. | Studies on carboxymethyl cellulase and xylanase activities of anaerobic fungal isolate CR4 from the bovine rumen | |
| Brumm et al. | Identification, cloning and characterization of Dictyoglomus turgidum CelA, an endoglucanase with cellulase and mannanase activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |