CN107236692B - Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as a coding gene and application thereof. The termite Paenibacillus cellosolve NP1 is preserved in China Center for Type Culture Collection (CCTCC) in 2016, 2 months and 25 days, and the preservation number is M2016072. The amino acid sequence of the xylanase PtXyn1 is shown in SEQ ID NO. 2. The xylanase PtXyn1 has the advantages of high and stable enzyme activity at medium temperature and high temperature, has important practical value in the aspect of industrial application of xylanase, and has wide application prospect in the industries of food, feed and the like.

Description

Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as a coding gene and application thereof.

Background

Lignocellulose is the most abundant biomass resource in the nature, and the comprehensive utilization of the lignocellulose has important significance on the sustainable development of the human society. Microorganisms that degrade lignocellulose in nature are mainly fungi and bacteria, and the exploitation of these microbial resources will help in the development and utilization of biomass. Lignocellulose consists of three high molecular compounds, namely cellulose, hemicellulose and lignin, and can exist stably in the nature. The degradation of lignocellulose requires the interaction of multiple enzymes in a complex series of enzyme systems. The microorganisms capable of degrading lignocellulose all contain rich cellulase, hemicellulase and the like, so that the cellulose degrading bacteria screened from the natural environment have good development and application prospects.

Xylan is rich in hemicellulose, has a more complex structure than cellulose, and requires the synergistic action of various hydrolases (i.e., xylan degrading enzyme systems) for completely degrading xylan. Xylanases (E.C.2.1.8) are a class of enzyme systems that degrade the β -1, 4-xylosidic bonds in xylan molecules in an endo-manner. The endo-beta-1, 4-xylanase is a main action enzyme for degrading xylan, and can degrade the xylan into xylose or xylo-oligosaccharide by the combined action of the endo-beta-1, 4-xylanase and beta-xylosidase. In recent years, xylanase has wide application prospects in food, textile, feed and energy industries. The complex enzyme preparation containing xylanase is added into the piglet feed, so that the apparent digestibility of dry matters, crude protein, crude fibers and the like can be improved, and the number of escherichia coli and diarrhea rate in excrement can be reduced. In the paper industry, the hemicellulase is used for pre-bleaching and auxiliary bleaching, so that the use amount of chemicals can be reduced, and the method becomes a mature process technology. In the fruit juice production process, xylanase, cellulase and pectinase are adopted for processing together, so that the viscosity of the extracting solution can be reduced, and the filtering and concentration are facilitated. However, in the actual production and application processes, some xylanases which are stable under moderate temperature and high temperature and can better exert the enzyme activity are needed. Therefore, obtaining xylanases with high activity and stability at mesophilic and thermophilic temperatures is of great practical value for industrial applications of xylanases.

Disclosure of Invention

The invention aims to provide a paenibacillus cellulolyticus NP1 strain with a plurality of cellulose degrading enzymes.

The second purpose of the invention is to provide xylanase PtXyn1 with high and stable enzymatic activity under the conditions of medium temperature and high temperature.

Another object of the invention is to provide a gene encoding the xylanase PtXyn 1.

The invention also aims to provide a recombinant vector, a transformant, a recombinant virus, a recombinant bacterium and a transgenic cell line containing the gene encoding the xylanase PtXyn 1.

The invention further aims to provide application of the xylanase PtXyn1 in degrading xylan.

In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:

a strain of Paenibacillus termitis is named as Paenibacillus sp 1(Paenibacillus aceillatus NP1), which is deposited in China center for type culture Collection in 2016, 2 months and 25 days, and the deposition unit address: china, Wuhan and Wuhan university, the preservation number is CCTCC NO: m2016072.

The colony morphology and physiological and biochemical characteristics of the bacillus like NP1 are that the bacillus like NP1 colony is round, moist and smooth, the thallus is rod-shaped, the thallus size is about 0.3-0.4 × 1.7-3.0 mu m, gram-negative, aerobic, flagellum or peritrichoum, the spore is generated proximally (figure 1), the growth temperature range of the bacillus is 5-50 ℃, the growth pH value range is 4.5-9.5, the growth salinity range is 0-1.75%, the bacillus like NP1 can grow by using L-arabinose, D-ribose, D-xylose, D-galactose, D-glucose, D-mannose, methyl- β -D-xylopyranoside, cellobiose, maltose, esculin and the like AS carbon sources, the bacillus subtilis NP 6745, the beta-galactosidase, β -galactosidase, α -glucosidase, soyase and the like AS active enzymes, the beta-glucosidase, the arginine-beta-glucosidase, the like, the arginine-beta-isozyme, the beta-alpha-glucosidase, the beta-beta_15:0And iso-C_16:0The main type of respiring quinone is MK-7, the cell wall containing meso Diaminopimelic Acid (DAP).

The gene sequence of the paenibacillus NP1 is characterized in that: the genome size of the paenibacillus NP1 is about 6.1Mb, the content of genome DNA G + C is 54.41 mol%, and the paenibacillus NP1 has 5329 coding genes; the bacterial genome contains more than 200 enzyme genes related to lignocellulose degradation, including 112 enzyme genes belonging to 63 Glycosyl Hydrolases (GH) families, 72 genes encoding carbohydrate binding domains belonging to 22 families, 10 endoglucanase genes and 3 exoglucanase genesPhylogenetic analysis shows that the bacillus belongs to the paenibacillus, and the most similar identified strain is bacillus coagulans JCM12163^TThe similarity between the 16S rRNA genes of the two strains was 97% (FIG. 2).

A xylanase from paenibacillus NP1, named xylanase PtXyn1, and characterized in that the amino acid sequence of the xylanase PtXyn1 is shown as SEQ ID NO. 2.

A gene encoding the xylanase PtXyn1, wherein the encoding gene is any DNA sequence encoding the xylanase PtXyn 1.

In the scheme, the nucleotide sequence of the gene encoding the xylanase PtXyn1 is shown as SEQ ID NO. 1.

A recombinant vector, a transformant, a recombinant virus, a recombinant bacterium and a transgenic cell line containing the gene encoding the xylanase PtXyn 1.

The xylanase PtXyn1 is applied to degrading xylan.

The invention has the following beneficial effects: the invention obtains a paenibacillus NP1 strain with a plurality of cellulose degrading enzymes by screening, obtains the coding gene of xylanase PtXyn1 from the gene of paenibacillus NP1 by screening, obtains recombinant bacteria by constructing recombinant plasmids, and obtains xylanase PtXyn1 after the coding gene is expressed; the xylanase PtXyn1 has the advantages of high and stable enzyme activity under the conditions of medium temperature and high temperature, has important practical value in industrial application of xylanase, and has wide application prospect in industries such as food, feed and the like.

Drawings

Fig. 1 is a scanning electron micrograph of paenibacillus NP1 morphology, left: scanning electron micrographs of paenibacillus NP 1; and (3) right: spore staining of paenibacillus NP 1.

FIG. 2 is a phylogenetic analysis diagram of Paenibacillus NP 1.

FIG. 3 is a diagram of the construction process of recombinant expression plasmid pET30a (+) -Ptxyn 1.

FIG. 4 is an SDS-PAGE analysis of recombinant xylanase PtXyn1, where M: a protein Marker; 1: no-load comparison; 2: no induction control; 3: inducing the protein sample for 20 hours; 4: a purified protein.

FIG. 5 shows the optimum reaction pH (a) and pH stability (b) of xylanase PtXyn 1.

FIG. 6 shows the optimal reaction temperature (a) and temperature stability (b) of xylanase PtXyn 1.

Detailed Description

In order to better understand the present invention, the following examples are further provided to illustrate the present invention, but the present invention is not limited to the following examples.

Example 1 study of Paenibacillus NP1(CCTCC M2016072)

The laboratory obtains a paenibacillus cellulolyticus strain named as paenibacillus NP1 from the intestinal tract separation culture of termite.

The morphological characteristics and growth characteristics of Paenibacillus NP1 were studied as follows:

paenibacillus NP1 was cultured in TSB medium (BD Co., USA, pH 7.2) at 30 ℃ at constant temperature. Inoculating the strain to a solid culture medium for culturing for one day, and forming round, wet and smooth colonies on a plate. The cell size of the bacteria is about 0.3-0.4 × 1.7-3.0 μm, the bacteria are rod-shaped, gram-negative bacteria, aerobic, spore-proximal (see figure 1), and no motility. 1 percent of inoculum size is used for culturing NP1 by TSB liquid culture medium, the growth temperature range of the strain is measured to be 5-50 ℃, and the optimal growth temperature is 30 ℃; the growth pH range is 4.5-9.5, and the optimal growth pH is 7.0; can grow in the salinity range of 0% -1.75%, and shows no growth in the salinity of more than 2%.

Secondly, the physiological and biochemical characteristics of the paenibacillus NP1 are studied as follows:

(1) carbon source utilization: the characteristics of the paenibacillus NP1 on carbon source utilization were studied by using the API 50CH reagent strip. The results show that the bacterium can utilize substrates such as L-arabinose, D-ribose, D-xylose, D-galactose, D-glucose, D-mannose, methyl-beta-D-xylopyranoside, cellobiose, maltose, esculin and the like to metabolize to generate acid.

(2) Intracellular enzymatic activity and assimilation: the intracellular enzyme activity and the assimilation of paenibacillus NP1 were studied using the APIZYM and API20NE reagent strips. As a result, the bacterium had esterase (C4), leucine arylamine enzyme, naphthol-AS-BI-phosphohydrolase, alpha-galactosidase, beta-galactosidase, alpha-glucosidase, beta-glucosidase, and other enzyme activities. Can assimilate arginine, urea, esculin, p-nitro-beta-D-methyl galactose, etc., and has the activity of enzymes such as arginine double hydrolase, urease, beta-glucosidase, etc.

(3) Other enzyme activities such as oxidase and catalase are that the bacillus Paenii NP1 bacterial cells act on 1% p-aminodimethylaniline hydrochloride aqueous solution and 1% α -naphthol ethanol solution which are equal in volume, the bacterial oxidase is negative according to the color reaction, and the bacterial cells act on 5% H₂O₂Bubbles were generated indicating that it was catalase positive. Paenibacillus NP1 can reduce sodium thiosulfate into sulfite and release H₂And S. In addition, the bacterium was unable to hydrolyze casein, and both esterase and starch hydrolase were negative.

(4) Analysis of thalli fatty acid, hydroquinone and the like: extracting fatty acid of the strain NP1, and detecting and analyzing by a gas chromatograph to obtain the main component of the fatty acid of the strain NP1, i.e. anteiso-C_15:0And iso-C_16:0. The respiratory phenol of the strain NP1 is extracted, and HPLC analysis shows that the main type of respiratory quinone of the strain is MK-7. In addition, its cell wall contains meso-Diaminopimelic Acid (DAP).

(III) study on the genome of Paenibacillus NP1

And (3) culturing the paenibacillus NP1 by using a TSB liquid culture medium, collecting bacterial cells, and extracting the genomic DNA of the strain NP1 by using a bacterial genomic DNA extraction kit. The samples were sequenced using a third generation sequencing platform. The sequencing results showed that the genome size of Paenibacillus NP1 was about 6.1Mb, and 5329 coding genes were present. The genome contains more than 200 enzyme genes related to lignocellulose degradation, including 10 endoglucanase genes, 3 exoglucanase genes, 9 glucosidase genes, 12 xylanase genes, 5 beta-xylosidase genes and the like.

Phylogenetic analysis shows that the bacillus belongs to Paenibacillus, and the identified strain which is most similar to the Paenibacillus coagulans is JCM12163^TThe similarity of the 16S rRNA genes of the two strains is 97%. Paenibacillus NP1, which has been deposited at China Center for Type Culture Collection (CCTCC) at 2016, month 2 and day 25, and the address of the deposition unit: china, Wuhan university, accession number M2016072.

Example 2 xylanase PtXyn1 and genes encoding same

Preparation of xylanase PtXyn1

(1) Obtaining the coding gene of xylanase PtXyn1 by PCR amplification: the genome DNA of the paenibacillus NP1 is used as a template, and primers 30a-Ptxyn1-F and 30a-Ptxyn1-R (the primer sequences are shown in the following table 1) are used for PCR amplification to obtain a PCR amplification product.

TABLE 1 primers for cloning of xylanase PtXyn1

Primer name	Primer sequence (5 '-3')
		30a-Ptxyn1-F	CCCATATGCACCATCATCATCATCATGCAACGACGATCACGTCCAATC
30a-Ptxyn1-R	CCCTCGAGGTTAATTTCCAAATAATCGAGG

(2) Enzyme digestion and connection: the PCR amplification product was double-digested with Xho I and Nde I, ligated with pET-30a (+) (purchased from Novagen, Cat. 69909-3) previously double-digested with Xho I and Nde I by T4DNA ligase to construct a recombinant expression vector, which was then transformed into E.coli DH 5. alpha. competent cells, according to the following transformation procedure:

a) putting 3 μ L of the ligation product into 50 μ L of competent cells, gently and uniformly mixing, and standing on ice for 30 min;

b) accurately heat shocking at 42 deg.C for 90sec, without shaking, and immediately placing on ice;

c) adding 800 mu L LB (or SOC) culture medium, shaking and culturing at 200rpm and 37 ℃ for 1-1.5 hours;

d) centrifuging at 4000rpm for 3min, discarding a proper amount of supernatant, lightly suspending the thallus, uniformly coating 100 mu L of bacterial liquid on an agar plate containing 50 mu g/mL Kana, and inverting the plate to culture at 37 ℃ for 12-16 h after the bacterial liquid is fully absorbed.

(3) Screening and identifying positive recombinants: selecting a single colony to perform PCR amplification by using a Ptxyn1 gene primer, verifying a recon containing a forward inserted target gene fragment, selecting a colony which is successfully verified to perform amplification culture and plasmid extraction, performing double digestion and sequencing verification, wherein primers for sequencing are a T7promoter primer (5'-TAATACGACTCACTATAGGG-3') and a T7terminator primer (5'-GCTAGTTATTGCTCAGCGG-3'), and the obtained sequence (namely the PtXyn1 encoding gene) is shown as a sequence 1 in a sequence table.

The construction process of the recombinant expression plasmid pET30a (+) -Ptxyn1 is shown in figure 3, and the target gene fragment is obtained by PCR amplification with the genome DNA of paenibacillus NP1 as a template. The gene Ptxyn1 is connected with an expression vector pET30a (+), and transformed into an escherichia coli DH5 alpha competent cell, and whether the vector is successfully constructed is verified through colony PCR amplification and double enzyme digestion.

(4) Induced expression of recombinant xylanase PtXyn 1: the recombinant plasmid pET30a (+) -Ptxyn1 was transformed into E.coli BL21(DE3) to obtain a recombinant strain. A single colony of the recombinant strain was picked up and inoculated into 5mL of LB medium containing Kana (50. mu.g/mL), and activated by culturing overnight in a constant temperature shaker at 37 ℃ at 200 r/min. Transferring the activated bacterial liquid into LB liquid culture medium containing Kana (50 mug/ml) according to the transfer amount of 1%, culturing at 37 ℃ for 3-4 h at 200r/min to enable OD₆₀₀IPTG was added to a final concentration of 0.2mmol/L at 16 ℃ for induction. Meanwhile, uninduced recombinant plasmid pET30a (+) -Ptxyn1 and E.coli BL21(DE3) containing the empty plasmid were used as controls. After the induction expression is finishedTaking 1mL of bacterial liquid, centrifuging at 10,000rpm for 1min, removing supernatant, adding 50 mu L of deionized water into bacterial precipitates to resuspend the bacterial, adding 50 mu L of 2 × SDS-PAGE loading buffer solution, boiling for 10min after mixing uniformly, centrifuging at 10,000rpm for 5min, cooling, loading, taking 20 mu L of SDS-PAGE gel electrophoresis, wherein the gel electrophoresis adopts 5% concentrated gel and 12% separation gel.

Purification of (II) xylanase PtXyn1

1. Preparation of crude enzyme solution: after a large amount of induction expression target protein, centrifugally collecting thalli, dissolving in a proper amount of buffer B, uniformly resuspending the thalli, and then crushing cells by a low-temperature high-pressure cell crusher. The resulting crushed solution was centrifuged at 4 ℃ at 10000g for 30min, and the resulting supernatant was filtered through a 0.45 μm filter to obtain a crude enzyme solution.

2. Purification of target protein

Purification was performed by nickel column affinity chromatography, and the supernatant was purified by HisPur Ni NTA Resin (Thermo), and the supernatant was filtered through a 0.45 μm filter. The method comprises the following steps of (1) separating and purifying the target protein with the His tag by using a Ni-Agarose-Resin protein purification column:

a, uniformly mixing 1mL of Ni-Agarose-Resin filler, adding the mixture into a chromatographic column, standing the chromatographic column for 10min at room temperature, flowing out ethanol in the chromatographic column, and adding 10 times of sterile deionized water to wash the ethanol;

b. adding 10 column volumes of Buffer B (Binding Buffer) to equilibrate the column;

c. adding the crude enzyme solution into the column, and shaking and combining for 2h at 4 ℃;

d. washing the column with 10 times column volume of buffer B, sequentially adding elution buffers with gradually increased imidazole concentration (5-500mM), and collecting elution peaks;

e. after elution, the column was washed with 5 column volumes of buffer B and 5 column volumes of sterile deionized water;

f. finally, 20% ethanol with 5 times of column volume is added, and the nickel column is preserved at the temperature of 2-8 ℃.

The Buffer B (Binding Buffer, pH8.0): 50mM NaH₂PO₄，300mM NaCl。

3. Detection and concentration of recombinase PtXyn 1: the purification effect of the target protein is detected by SDS-PAGE gel electrophoresis. The purified target protein is concentrated using an ultrafiltration tube with a molecular weight cut-off of 10kDa, and the imidazole-containing buffer is displaced using the buffer used for detecting the enzyme activity to remove imidazole from the protein solution.

After the recombinant expression plasmid pET30a (+) -Ptxyn1 is induced by 0.2mM IPTG, a recombinant protein with the molecular weight of about 40kDa is generated, which is consistent with the theoretical predicted value, as shown in figure 4, after Ni-NTA-Sefiniose purification, SDS-PAGE shows a single band (figure 4 lane 4), and the obtained electrophoretically pure target protein can be used for subsequent enzymological characteristic analysis.

Characterization of (tri) xylanase TmXyn1

1. Detection of activity of recombinase PtXyn 1: the xylanase enzyme activity is determined by DNS method, 50 mul of enzyme solution diluted properly is taken, 100 mul of 1% xylan (Sigma beechwood xylan) solution is added, the temperature is raised for 5min at 55 ℃, after 200 mul of DNS solution is added, boiling water bath is carried out for 10min, after the temperature is cooled to room temperature, 1ml of deionized water is added, and the light absorption value is determined at 540 nm. And (3) drawing a standard curve by taking 1mg/ml xylose as a standard sample, and calculating the amount of the obtained reducing sugar according to the standard curve.

Definition of enzyme activity: the amount of enzyme that hydrolyzes xylan to produce 1. mu. mol of xylose per minute is defined as one unit of enzyme activity.

Composition of 1% xylan (Sigma beechwood xyloan) solution: dissolving 1g xylan in 100mL of 0.1M acetic acid-sodium acetate buffer (pH6.0), heating in boiling water bath for 5min, centrifuging the obtained xylan suspension at 10,000 Xg for 5min, and discarding the precipitate to obtain xylan solution, and storing at 4 deg.C.

Composition of DNS solution: 185g of sodium potassium tartrate is weighed and added into 500ml of deionized water, after the sodium potassium tartrate is stirred on a magnetic stirrer until the sodium potassium tartrate is completely dissolved, 20.96g of NaOH is added, 6.3g of 3, 5-dinitrosalicylic acid (protected from light) is added, agglomeration is easy to form, and the color gradually becomes dark red after continuous stirring. After the solution was completely dissolved, 5g of anhydrous sodium sulfite and 5g of crystalline phenol (the crystalline phenol was dissolved in a 55 ℃ water bath in advance, and 4.673ml was added by density calculation) were added in this order. The brown bottle is stored at room temperature and can be used after being placed for more than one week.

2. Optimum reaction pH and pH tolerance determination

Buffers at different pH ranges: acetic acid-sodium acetate buffer (pH 3.0-5.0), citric acid-sodium citrate buffer (pH5.0-7.0), Tris-HCl buffer (pH 7.0-9.0), glycine-sodium hydroxide buffer (pH 9.0-11.0), with a gradient of 0.5. Measuring the enzyme activity of recombinase PtXyn1 in different pH ranges at 55 ℃ to determine the optimal reaction pH value; mixing the enzyme solution and a buffer solution with the pH value of 3.0-11.0 according to the ratio of 1:10, placing the mixture in a refrigerator at 4 ℃ for 2 days, and respectively measuring the activity of the recombinase under the optimal reaction pH value to determine the pH tolerance of the mixture.

The activity of the recombinase PtXyn1 was detected under different pH conditions, and the optimum reaction pH of the enzyme was found to be 6.0 (FIG. 5 a). The recombinase is diluted in buffers with different pH values, placed at 4 ℃ for 2d, then the residual enzyme activity of the recombinase is measured, and the measured tolerance curve of the recombinase PtXyn1pH shows that the recombinase has the best tolerance at the pH value of 7.5, and the enzyme activity after treatment in the whole pH range is kept above 60 percent, which indicates that the recombinase has wide pH tolerance. However, the residual enzyme activity was higher than that under acidic conditions at pH 7.0-11.0, indicating that the enzyme was more resistant to alkaline conditions (FIG. 5 b).

3. Determination of optimum reaction temperature and temperature stability

Detecting the enzyme activities of the recombinant plasmid in different temperature ranges (25-65 ℃) under the condition of the optimum reaction pH value, and determining the optimum reaction temperature of the recombinase PtXyn 1; and (3) respectively preserving the recombinant protein solution at 45, 50, 55 and 60 ℃ for different times, and quickly placing on ice after the preservation is finished. Reacting at 55 deg.C for 10min to determine residual enzyme activity and determine its thermal stability. Taking the xylanase activity without heat treatment as a reference, and taking the percentage of the residual enzyme activity and the reference enzyme activity as relative enzyme activity.

The determination result shows that the optimum reaction temperature of the recombinase PtXyn1 is 55 ℃, the enzyme activity is kept above 40% within the temperature range of 25-65 ℃, and the enzyme has a wider enzyme activity temperature range (figure 6 a). Keeping the temperature at 45, 50, 55 and 60 ℃ for different times respectively, and measuring the residual enzyme activity at 55 ℃ to determine the thermal stability. The result shows that the enzyme has good temperature stability at the temperature of less than 45 ℃, and almost has no influence on the enzyme activity after 30min of warm bath at the temperature of 45 ℃. After 30min of heat preservation at 50 ℃, the enzyme activity is kept about 70% (figure 6 b).

4. Determination of kinetic parameters of enzymatic reactions

And calculating the Km value of the Michaelis constant and the Vmax value of the maximum reaction rate by adopting a Lineweaver-Burk double reciprocal method. Preparing beech xylan substrate with concentration of 1-10mg/mL by using 0.2mol/L citric acid-sodium citrate buffer solution (pH6.0), reacting equivalent protease solution and substrate with different concentrations for 10min under the optimal reaction condition, and respectively calculating enzyme activity, namely reaction speed V. Km and Vmax were determined by plotting 1/[ S ] as the abscissa and 1/V as the ordinate to obtain a straight line having an intercept of-1/Km on the abscissa, an intercept of 1/Vmax (maximum reaction rate) on the ordinate, and a slope of Km/Vmax.

The determination result shows that the Km value of the Mie constant and the maximum reaction rate Vmax of the recombinase PtXyn1 are determined by a Lineweaver-Burk mapping method. The Km and Vmax of recombinase PtXyn1 to beech xylan are 6.2mg/mL and 3765.1. mu. mol mg respectively^-1min^-1。

5. Determination of substrate specificity

Under the optimum reaction conditions for the enzymatic reaction, the enzyme activity of the recombinant protein was determined using beech xylan (beechwood xylan 1%), corn cob xylan (corn cob xylan, 1%), sodium carboxymethylcellulose (CMC-Na, 1%), microcrystalline cellulose (Avicel PH-101, 1%), 4-nitrophenyl- β -D-glucopyranoside (pNPG, 10mM), 4-nitrophenyl- β -D-glucopyranoside (pNPC, 10mM), 4-nitrophenyl- β -D-xylopyranoside (pNPX, 10mM) as substrates, each of which was formulated with 0.2mol/L citric acid-sodium citrate buffer (pH 6.0).

The DNS method and the pNP method are respectively used for detecting the enzyme activity reaction of the recombinant xylanase PtXyn1 on different substrates, and the result shows that the recombinant xylanase PtXyn1 only has activity on beech xylan, and the specific activity is 2118.7U/mg. No activity was shown for other substrates. The result shows that the recombinant xylanase PtXyn1 has stronger substrate specificity.

It is apparent that the above embodiments are only examples for clearly illustrating and do not limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications are therefore intended to be included within the scope of the invention as claimed.

Sequence listing

<110> university of Master in China

<120> termite Paenibacillus cellulolyticus NP1, xylanase PtXyn1, and coding gene and application thereof

<160>2

<210>1

<211>1095bp

<212>DNA

<213> Paenibacillus sp NP1(Paenibacillus termiticellulosiyticus NP1)

＜400＞ 1

atgaaagtaa ccaaatcgaa attattgttg gcgttagtgc ttagctttac gcttgctatg 60

cctgtaggag tcgcgaatgc ggcaacgacg atcacgtcca atcaaacggg tacgcaagac 120

ggctacgact acgagctgtg gaaagattcc ggcacgacga gcatgacgct caacagcggc 180

ggcgcgttca gcgcaacgtg gagcaatatt aataacgcct tgttccgtaa gggcaaaaag 240

ttcaatgcca cccaaacgca ccagcaaatc ggcaacatct ccatcaatta cgctgcaacg 300

ttcaatccgg gcggcaactc ttatctgacg gtatacggct ggacgaagag ctcgctcatc 360

gagtactaca tcatggataa ctggggaacg taccgcccgt ccggcacgaa taaaggttcg 420

ttctcggttg acggcggcac gtacgatatt tacgagacga cccgggttaa ccagccgtct 480

atcgaaggta cggcgacgtt caaacaatat tggagcatcc ggacggccaa acgttcgagc 540

ggtacgatct cggtaagcga gcacttcaag aagtgggaaa gcctgggcat gtcgctcggc 600

aaactgtacg aagtagcgct tacggttgag ggctatcaaa gcagcggcaa tgcgaacgtg 660

acgacgaacgtgctgacgat cggcggaagc ggaagcggcg gcggcggcgg tacaacgacc 720

cctccaagct cgggcgctac gaaagtggaa gcggagagca tgtcgaagag cggccaatac 780

acgggcaaca tcagctcgcc gttctcgggc gttgcactgt acgcgaataa cgatctggtc 840

aaatttacgc aaaacttcac gtccggcacg cacagcttct cgcttcgcgg cgcttcgaac 900

aactccagca cggctagagt cgatctgaaa atcggcggcg tgaccaaagg cagcttctac 960

ttcaccggta cgactcctgc cgtctcgacg atcagcaacg tcagcacggg aaccggtaat 1020

caagaaatcc agctcgtcgt cacgaccgat aacgggcaat gggacgcttt cctcgattat 1080

ttggaaatta actag 1095

<210>2

<211>337

<212>PRT

<213> Paenibacillus sp NP1(Paenibacillus termiticellulosiyticus NP1)

＜400＞ 2

Ala Thr Thr Ile Thr Ser Asn Gln Thr Gly Thr Gln Asp Gly Tyr Asp Tyr Glu Leu Trp

5 10 15 20

Lys Asp Ser Gly Thr Thr Ser Met Thr Leu Asn Ser Gly Gly Ala Phe Ser Ala Thr Trp

25 30 35 40

Ser Asn Ile Asn Asn Ala Leu Phe Arg Lys Gly Lys Lys Phe Asn Ala Thr Gln Thr His

45 50 55 60

Gln Gln Ile Gly Asn Ile Ser Ile Asn Tyr Ala Ala Thr Phe Asn Pro Gly Gly Asn Ser

65 70 75 90

Tyr Leu Thr Val Tyr Gly Trp Thr Lys Ser Ser Leu Ile Glu Tyr Tyr Ile Met Asp Asn

85 90 95 100

Trp Gly Thr Tyr Arg Pro Ser Gly Thr Asn Lys Gly Ser Phe Ser Val Asp Gly Gly Thr

105 110 115 120

Tyr Asp Ile Tyr Glu Thr Thr Arg Val Asn Gln Pro Ser Ile Glu Gly Thr Ala Thr Phe

125 130 135 140

Lys Gln Tyr Trp Ser Ile Arg Thr Ala Lys Arg Ser Ser Gly Thr Ile Ser Val Ser Glu

145 150 155 160

His Phe Lys Lys Trp Glu Ser Leu Gly Met Ser Leu Gly Lys Leu Tyr Glu Val Ala Leu

165 170 175 180

Thr Val Glu Gly Tyr Gln Ser Ser Gly Asn Ala Asn Val Thr Thr Asn Val Leu Thr Ile

185 190 195 200

Gly Gly Ser Gly Ser Gly Gly Gly Gly Gly Thr Thr Thr Pro Pro Ser Ser Gly Ala Thr

205 210 215 220

Lys Val Glu Ala Glu Ser Met Ser Lys Ser Gly Gln Tyr Thr Gly Asn Ile Ser Ser Pro

225 230 235 240

Phe Ser Gly Val Ala Leu Tyr Ala Asn Asn Asp Leu Val Lys Phe Thr Gln Asn Phe Thr

245 250 255 260

Ser Gly Thr His Ser Phe Ser Leu Arg Gly Ala Ser Asn Asn Ser Ser Thr Ala Arg Val

265 270 275 280

Asp Leu Lys Ile Gly Gly Val Thr Lys Gly Ser Phe Tyr Phe Thr Gly Thr Thr Pro Ala

285 290 295 300

Val Ser Thr Ile Ser Asn Val Ser Thr Gly Thr Gly Asn Gln Glu Ile Gln Leu Val Val

305 310 315 320

Thr Thr Asp Asn Gly Gln Trp Asp Ala Phe Leu Asp Tyr Leu Glu Ile Asn

325 330 335

Claims (6)

1. A paenibacillus cellulolyticus strain of termite is characterized in that the strain is named as paenibacillus NP1

（Paenibacillus termiticellulosilyticusNP1), which has been deposited in the chinese culture collection center at 25.2.2016 with a deposition number of CCTCC NO: m2016072.

2. A xylanase, designated xylanase PtXyn1, derived from the Paenibacillus sp of claim 1

The amino acid sequence of the bacterial NP1 and the xylanase PtXyn1 is shown as SEQ ID NO. 2.

3. A gene encoding the xylanase PtXyn1 of claim 2.

4. The gene as claimed in claim 3, wherein the nucleotide sequence of the gene encoding xylanase PtXyn1 is shown as SEQ ID No. 1.

5. Recombinant vectors, transformants, recombinant viruses, recombinant bacteria and transgenic cell lines comprising the gene encoding xylanase PtXyn1 according to claims 3-4.

6. Use of the xylanase PtXyn1 according to claim 2 for degrading xylan.

Images