KR20240086762A - Microorganisms that simultaneously produce 1,3-propanediol and 3-hydroxypropionic acid from glycerol, and their uses - Google Patents

Abstract

The present specification relates to microorganisms into which dhaB, gdrAB, aldH and/or yqhD genes have been introduced and/or their uses, and can simultaneously produce 1,3-PDO and 3-HP.

Description

Microorganisms that simultaneously produce 1,3-propanediol and 3-hydroxypropionic acid from glycerol and their uses {Microorganisms that simultaneously produce 1,3-propanediol and 3-hydroxypropionic acid from glycerol, and their uses}

The present specification relates to microorganisms into which dhaB, gdrAB, aldH and/or yqhD genes have been introduced and/or uses thereof.

1,3-propanediol (1,3-PDO), an aliphatic diol, is an organic chemical substance with a relatively simple structure, also called trimethylene glycol or 1,3-dihydroxypropane, and is used for various purposes including polymers, cosmetics, and lubricants. Polytrimethylene terephthalate (PTT), which is commercially produced by the polymerization reaction of 1,3-PDO and terephthalic acid, is receiving great attention due to its superior properties compared to polyester and nylon in terms of elasticity and optical stability.

3-Hydroxypropionic Acid (3-HP) is a platform compound that can be converted into various chemicals such as Acrylic Acid, Methyl Acrylate, and Acrylamide. It has been used in academia and industry since it was selected as a Top 12 Value-added Bio-chemical by the U.S. Department of Energy in 2004. It is being actively researched.

A variety of microorganisms are being developed to simultaneously biosynthesize 1,3-PDO and 3-HP, which are high value-added monomers. However, existing strains have low titers or a method of mixing two types of microorganisms is used, which limits their applicability to actual processes.

Under the above background, the present inventors conducted repeated studies on microorganisms to simultaneously biosynthesize 1,3-PDO and 3-HP, and as a result, microorganisms into which dhaB, gdrAB, aldH, and yqhD genes were introduced were able to produce 1,3-PDO and 3-HP from glycerol. , The present invention was completed by confirming the simultaneous production of 3-PDO and 3-HP.

An example of the present specification provides a microorganism into which one or more (two or more or three or more) genes selected from the group consisting of dhaB, gdrAB, aldH and yqhD have been introduced.

Another example provides a composition for producing 1,3-PDO and/or 3-HP, comprising the above microorganisms.

Another example provides a recombinant vector for producing 1,3-PDO and/or 3-HP, containing one or more (two or more or three or more) genes selected from the group consisting of dhaB, gdrAB, aldH and yqhD. do.

Another example provides a method for producing 1,3-PDO and/or 3-HP, comprising culturing the microorganism.

Another example provides a fermentation broth composition obtained by fermenting a microorganism with production activity of 1,3-PDO and 3-HP and containing 1,3-PDO and 3-HP.

An example of the present specification provides a microorganism into which one or more (two or more or three or more) genes selected from the group consisting of dhaB, gdrAB, aldH and yqhD have been introduced.

The microorganism may have all of the dhaB, gdrAB, aldH, and yqhD genes introduced into it, but is not limited thereto.

The microorganism can produce the 1,3-propanediol (1,3-PDO) and/or 3-hydroxypropionic acid (3-HP), and can simultaneously produce 1,3-PDO and 3-HP, but is limited thereto. It doesn't work.

The microorganism may have the activity of producing 1,3-propanediol (1,3-PDO) and/or 3-hydroxypropionic acid (3-HP), and may produce 1,3-propanediol (1,3-PDO) and 3-HP. -hydroxypropionic acid (3-HP) may have simultaneous production activity, but is not limited thereto.

The microorganisms provided herein can produce 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP) from glycerol, but are not limited thereto.

Another example provides a composition for producing 1,3-PDO and/or 3-HP, comprising the microorganisms provided herein.

Another example provides a recombinant vector containing one or more (two or more or three or more) genes selected from the group consisting of dhaB, gdrAB, aldH and yqhD.

The recombinant vector may include, but is not limited to, dhaB, gdrAB, aldH, and yqhD genes.

Another example provides a method for producing 1,3-PDO and/or 3-HP, including culturing the microorganism provided herein.

Hereinafter, this application will be described in more detail.

In this specification, “microorganism” refers to a very small organism that cannot be seen with the naked eye. Microorganisms herein may have the ability to synthesize organic compounds, such as 1,3-propanediol (1,3-PDO) and/or 3-hydroxypropionic acid (3-HP). It may have the ability to synthesize (or, the ability to produce 1,3-PDO and/or the ability to produce 3-HP). The microorganism according to one example may be a strain that is genetically engineered to produce organic compounds by including genes involved in the production of organic compounds, or to have the ability to produce organic compounds, or to have an enhanced ability to produce organic compounds. Production of the organic compound includes production within the strain, production within the cell and secretion outside the cell, or a combination thereof.

The microorganism of the present specification may further include, but is not limited to, the characteristic of weakened or inactivated activity of one or more genes selected from the group consisting of yqhD, glpK, ldhA, ack-pta, gldA, and ptsG.

Microorganisms of the present disclosure include microorganisms of the genus Escherichia (e.g., E. coli, E. albertii, E. fergusonii, E. hermannii, and E. marmotae), microorganisms of the genus Klebsiella (e.g., K pneumoniae, K. aerogenes, K. granulomatis, K. grimontii, K. huaxiensis) and/or Lactobacillus genus (e.g., L. reuteri, L. acetotolerans, L. acidophilus, L. thermophilus). However, it is not limited to this.

The microorganisms provided herein may have 1,3-propanediol (1,3-PDO) production ability and/or 3-HP production ability, but are not limited thereto.

As used herein, “having the ability to produce 1,3-propanediol (1,3-PDO)” means cells and/or microorganisms that naturally have the ability to produce 1,3-PDO, or parent cells that do not have the ability to produce 1,3-PDO. It may refer to a microorganism endowed with the ability to produce 1,3-PDO. When the microorganism has the ability to produce 1,3-PDO by introducing a mutation according to an example, and/or when the mutation according to an example is introduced into a microorganism without the ability to produce 1,3-PDO, the microorganism produces 1,3 -Can be used to mean a case where PDO production capacity is obtained. For example, microorganisms of the Escherichia genus that have the ability to produce 1,3-PDO are either the natural microorganism itself or an improved 1 by inserting an external gene related to the 1,3-PDO production mechanism or by enhancing or inactivating the activity of an intrinsic gene. , It may refer to microorganisms of the genus Escherichia that have the ability to produce 3-PDO.

As used herein, “having the ability to produce 3-HP” may mean cells and/or microorganisms that naturally have the ability to produce 3-HP, or microorganisms that are endowed with the ability to produce 3-HP in a parent strain without the ability to produce 3-HP. there is. When the microorganism has the ability to produce 3-HP by introducing a mutation according to an example, and/or when a mutation according to an example is introduced into a microorganism that does not have the ability to produce 3-HP, the microorganism has the ability to produce 3-HP It can be used to mean a case where something happens. For example, Escherichia genus microorganisms with 3-HP production ability are those that have improved 3-HP production ability by inserting the natural microorganism itself or an external gene related to the 3-HP production mechanism, or by enhancing or inactivating the activity of an intrinsic gene. It may refer to microorganisms of the genus Escherichia that have .

In one example, the microorganism may have the ability to produce 1,3-PDO and/or 3-HP, or may be a strain genetically engineered to have the ability to produce 1,3-PDO and/or 3-HP. there is. The production of 1,3-PDO and/or 3-HP includes production within the strain, production within the cell and secretion outside the cell, or a combination thereof.

The microorganism (or recombinant cell) may additionally include a mutation that increases 1,3-PDO production and/or 3-HP production, and the location of the mutation and/or the gene and/or protein subject to the mutation. Types may be included without limitation as long as they increase 1,3-PDO production and/or 3-HP production. The microorganism can be used without limitation as long as it is a cell capable of transformation.

In the present application, a mutation according to an example is introduced into a microorganism before a mutation according to an example is introduced, and the 1,3-PDO production ability and/or 3-HP production ability is increased or the 1,3-PDO production ability and/or In order to distinguish from microorganisms endowed with the ability to produce 3-HP, the microorganism before the mutation according to one example is introduced may be expressed as a host microorganism (or parent strain).

As used herein, “glycerol dehydratase” or “diol dehydratase” refers to an enzyme having an enzyme activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA). It may refer to a polypeptide. Glycerol dehydratase or diol dehydratase may be coenzyme B12 dependent or independent. The enzyme is Klebsiella pneumoniae, Citrobacter freundii, Clostridium pasteurianum, Salmonella typhimurium, Klebsiella oxy It may be derived from Klebsiella oxytoca, and/or Clostridium butyricum, but is not limited thereto. Regardless of its origin, the enzyme may be included in the scope of the present application as long as it has an enzymatic activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA), for example, the gene encoding it may be dhaB.

As used herein, “glycerol dehydratase reactivase” refers to an enzyme that maintains catalytic activity by reactivating irreversibly inactivated glycerol dehydratase during its action. You can. Any commonly known glycerol dehydratase reactibase can be used, for example, Klebsiella sp. (e.g. Klebsiella pneumoniae), Citrobacter sp. .), Lactobacillus sp., Salmonella sp., etc., but is not limited thereto. The glycerol dehydratase reactibase may be DhaFG, GdrAB, DdrAB, etc., for example, the gene encoding it may be dhaFG, gdrAB, and/or ddrAB.

In this specification, "yqhD" is a gene encoding alcohol dehydrogenase and encodes an enzyme that converts 3-hydroxypropanal into 1,3-PDO when glycerol is decomposed into 3-hydroxypropanal and water by glycerol dehydratase. do.

As used herein, “aldehyde dehydrogenase” is an enzyme that catalyzes the oxidation of aldehyde. The enzyme can convert aldehyde (R-C(=O)-H) to carboxylic acid (R-C(=O)-O-H). The enzyme may be encoded by the aldH gene, and the gene may be the aldH (GenBank Accession no. U00096.3; EaldH) gene derived from Escherichia coli or E. coli K12 MG1655 18-3 cell line, Klebsi It may be, but is not limited to, the puuC gene derived from K. pneumoniae, and/or the KGSADH gene derived from Azospirillum brasilense. The aldehyde dehydrogenase protein and the gene encoding it may include mutations in the gene and/or amino acid sequence within the range of maintaining the activity for producing 3-HP from 3-HPA.

As used herein, “activity enhancement” or “activity enhancement” not only includes the introduction or enhancement of the activity of the protein itself, resulting in effects beyond the original function, but also includes increased gene expression, increased intrinsic gene activity, Endogenous gene amplification from internal or external factors, deletion of repressive regulators of said gene expression, increase in gene copy number, introduction of genes from outside, modification of expression control sequences, and/or replacement or modification of promoters and enzymes by intragenic mutations. It may mean a state in which the activity of a microorganism after manipulation is increased compared to the activity of the microorganism before manipulation, such as an increase in activity, is performed.

Enhancing the activity of proteins and/or enzymes (e.g., dhaB, gdrAB, aldH and/or yqhD) herein can be achieved by application of various methods well known in the art. To enhance or increase the activity of the protein and/or enzyme, various methods well known in the art can be applied. For example, but not limited to this, an enzyme (or This may include a method of increasing the copy number of the base sequence encoding the protein, a method of replacing the promoter capable of expressing the polynucleotide with a strong promoter, and a method of introducing a mutation into the promoter, and an enzyme with strong activity due to genetic mutation. There are ways to mutate it into (or protein). The method of inserting the polynucleotide (e.g., dhaB, gdrAB, aldH and/or yqhD) into the host cell genome (chromosome) can be performed by appropriately selecting a known method by a person skilled in the art, for example, (a) RNA -Guide endonuclease (e.g., Cas9 protein, etc.), the gene encoding it, or a vector containing the gene; and (b) a guide RNA (e.g., single guide RNA (sgRNA), etc.), its coding DNA, or a mixture containing a vector containing the DNA (e.g., a mixture of an RNA-guide endonuclease protein and a guide RNA, etc. ), complexes (e.g., ribonucleic acid fusion protein (RNP), recombinant vectors (e.g., vectors containing together an RNA-guide endonuclease encoding gene and guide RNA encoding DNA, etc.), etc. ), but is not limited to this.

As used herein, “weakened activity” means that the level of activity of proteins and/or enzymes (e.g., yqhD, glpK, ldhA, ack-pta, gldA, and/or ptsG) in the host cell, such as a wild-type strain or a strain before modification, is It may mean a decrease compared to (or the parent strain). The weakening occurs when the activity of the enzyme (or protein) itself is reduced compared to the activity of the enzyme originally possessed by the microorganism due to mutation of the gene encoding the enzyme (or protein), inhibition of transcription of the gene encoding the enzyme, and / Or when the expression level of the enzyme (or protein) is lowered due to inhibition of translation, etc., and the overall enzyme (or protein) activity within the cell is lower than that of the wild-type strain or the strain before modification, a combination thereof is also included. It's a concept. also,

As used herein, “inactivation” refers to the expression of genes encoding proteins and/or enzymes (e.g., yqhD, glpK, ldhA, ack-pta, gldA, and/or ptsG) in a host cell (such as a wild-type strain or a strain before modification). It may mean that it is not expressed at all compared to the parent strain, or that even if it is expressed, it is inactive.

Attenuation or inactivation of the activity of proteins and/or enzymes (e.g., yqhD, glpK, ldhA, ack-pta, gldA and/or ptsG) herein can be achieved by application of various methods well known in the art. For example, a method of replacing the gene encoding the enzyme on the chromosome with a mutated gene such that the activity of the enzyme (or protein) is reduced, including when the activity of the enzyme (or protein) is completely eliminated; A method of introducing a mutation into the expression control sequence (eg, promoter) of a gene on a chromosome encoding the enzyme (or protein); A method of replacing the expression control sequence of the gene encoding the enzyme (or protein) with a weak or inactive sequence; A method of deleting all or part of a gene on a chromosome encoding the enzyme (or protein); A method of introducing an antisense oligonucleotide (eg, antisense RNA) that binds complementary to the transcript of a gene on the chromosome and inhibits translation from the mRNA to an enzyme (or protein); A method of artificially adding a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the enzyme (or protein) to form a secondary structure, making attachment of ribosomes impossible; and/or the RTE (Reverse transcription engineering) method of adding a promoter to reverse transcription to the 3' end of the ORF (open reading frame) of the corresponding sequence. This can also be achieved by a combination of these, but is not limited thereto.

In the present specification, a decrease in gene expression may mean that the expression level of the gene is reduced compared to the expression level of the host cell (parent strain) and/or the wild type before mutation, and may include cases where expression is completely inhibited and expression is not achieved. You can. When it is desired to reduce the expression of a gene in a microorganism, the expression can be reduced by substituting the start codon of gene translation, or the expression level of an existing gene can be genetically manipulated to reduce the expression level. The method of modifying the sequence for expression control is carried out by inducing mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution in the nucleic acid sequence of the expression control sequence, or a combination thereof, or by changing the promoter to a weaker promoter. This can be done by methods such as replacement. The expression control sequence includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation. If a gene that reduces expression exists in the microorganism to be mutated, for example, by replacing the native promoter that operates the expression of the gene with a weak promoter or introducing a mutation, It can reduce gene expression. Furthermore, the expression of the existing gene can be reduced by deleting all or part of the gene.

As used herein, “vector” refers to any vehicle for cloning and/or transferring a base to a host cell. A vector may be a replication unit (replicon) that can bind different DNA fragments and result in replication of the combined fragments. “Replication unit” may mean any genetic unit (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, i.e., is capable of replicating under its own control. there is. In the present invention, the vector is not particularly limited as long as it can replicate in the host, and any vector known in the art can be used. The vector used to construct the recombinant vector may be a plasmid, cosmid, virus, and/or bacteriophage in a natural or recombinant state. For example, pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, and/or Charon21A can be used as phage vectors or cosmid vectors, and as plasmid vectors, pDZ vectors, pBR-based vectors, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and/or pET-based products can be used. Vectors that can be used are not particularly limited, and known expression vectors can be used. In one example, the vector may be one where the gene inserted into the vector is irreversibly fused into the genome of the host cell, allowing gene expression to continue stably for a long period of time within the cell. Such vectors may contain transcriptional and translational expression control sequences that allow the gene to be expressed in the selected host. Expression control sequences may include any operator sequence to regulate transcription, and/or sequences that regulate termination of transcription and translation. In one example, the initiation codon and stop codon may generally be considered part of the nucleic acid sequence encoding the protein of interest, must be functional in the subject when administered to the genetic construct, and may be in frame with the coding sequence. there is. Additionally, if it is a replicable expression vector, it may include an origin of replication. In addition, it may appropriately include an enhancer, an untranslated region at the 3' end of the gene of interest, a selection marker (eg, antibiotic resistance marker), and/or a replicable unit. The vector can self-replicate or integrate into host genomic DNA.

According to one example, each component within the vector must be operably linked to each other, and the linking of these component sequences can be accomplished by ligation at convenient restriction enzyme sites, if such sites do not exist. , can be performed using a synthetic oligonucleotide adapter or linker according to a conventional method.

As used herein, “transduction” refers to the phenomenon in which bacterial DNA is transferred to another bacterium mediated by bacteriophage, and is one of the methods of horizontal gene transfer (HGT). A bacteriophage capable of transduction in this way is called a “transduction particle” or “transduction phage,” and a cell that receives DNA from another bacterium is called a “transductant.”

In this specification, “transformation” refers to introducing a gene into a host cell so that it can be expressed within the host cell. If the transformed gene can be expressed within the host cell, it is inserted into the chromosome of the host cell or located outside the chromosome. Anything can be included without limitation. Additionally, the gene includes DNA and/or RNA encoding the target protein. As long as the gene can be introduced and expressed into a host microorganism, the form in which it is introduced is not limited. For example, the gene can be introduced into the host microorganism in the form of an expression cassette, which is a genetic structure containing all the elements necessary for its own expression. The expression cassette may typically include expression control elements such as a promoter, transcription termination signal, ribosome binding site, and/or translation termination signal that are operably linked to the gene. The expression cassette may be in the form of an expression vector capable of self-replication. Additionally, the gene may be introduced into the host cell in its own form and operably linked to the sequence required for expression in the host cell.

As used herein, “promoter” refers to an untranslated nucleic acid sequence upstream of the coding region that contains a binding site for a polymerase and has transcription initiation activity into the mRNA of a gene downstream of the promoter, that is, a polymerase binds to generate the gene. It refers to the DNA region that initiates transcription, and may be located in the 5' region of the mRNA transcription start site.

In one example, the microorganism provided herein further comprises a constitutive promoter and dhaB, gdrAB, aldH and/or yqhD operably linked thereto, producing 1,3-propanediol (1,3-PDO) and/or 3- It can produce hydroxypropionic acid (3-HP), but is not limited thereto. The constitutive promoter can induce the expression of an operably linked gene without the need for a separate inducer. For example, the constitutive promoter is the J23 series (e.g., the promoter is J23100, J23101, J23102, J23103, J23104, J23105, J23106, J23107, J23109, J23111, J23112, J23113, J23114, J23115, 16, J23117, and/ or J23118), but is not limited thereto, and a person skilled in the art may select and use it without limitation as needed within the scope of the purpose of producing 1,3-PDO and/or 3-HP. One or more genes (two or more or three or more) selected from the group consisting of dhaB, gdrAB, aldH, and yqhD into which a constitutive promoter has been introduced can be cloned into a vector and introduced into cells (or microorganisms). Alternatively, the above four genes can be cloned into one vector and introduced into cells (or microorganisms).

In this specification, “productivity” may mean the amount of production per hour, but is not limited thereto.

The microorganisms provided herein are 0.1 g/L/hr or more, 0.5 g/L/hr or more, 1 g/L/hr or more, 1.3 g/L/hr or more, 1.6 g/L/hr or more, 1.9 g/hr or more. It may have a 1,3-PDO productivity of L/hr or more, 2 g/L/hr or more, or 2.1 g/L/hr or more, for example, 2.1 g/L/hr, and the 1,3-PDO productivity of The upper limit is not particularly limited, and for example, the 1,3-PDO productivity may be less than 100 g/L/hr or less than 10 g/L/hr, but is not limited thereto.

The microorganisms provided herein are 0.1 g/L/hr or more, 0.5 g/L/hr or more, 1 g/L/hr or more, 1.3 g/L/hr or more, 1.6 g/L/hr or more, 1.9 g/hr or more. It may have a 3-HP productivity of L/hr or more or 2 g/L/hr or more, for example, 2 g/L/hr, and the upper limit of the 3-HP productivity is not particularly limited, for example, 100 g/L. It may have a 3-HP productivity of /hr or less or 10 g/L/hr or less, but is not limited thereto.

The present specification provides a recombinant vector containing one or more genes (two or more or three or more) selected from the group consisting of dhaB, gdrAB, aldH, and yqhD.

The microorganism into which the recombinant vector is introduced can produce 1,3-PDO and/or 3-HP, and can simultaneously produce 1,3-PDO and/or 3-HP, but is not limited thereto.

The microorganism into which the recombinant vector is introduced may have 1,3-PDO and/or 3-HP production activity, and may have simultaneous 1,3-PDO and/or 3-HP production activity, but is not limited thereto. .

The present specification provides 1,3-PDO and/or Provides 3-HP production method.

The method for producing 1,3-PDO and/or 3-HP may further include the step of recovering 1,3-PDO and/or 3-HP from the cultured medium or microorganism, but is not limited thereto.

In one example, the culturing step may include a primary culturing step and/or a primary culturing step and a secondary culturing step, but is not limited thereto.

In one example, the culturing step includes inoculating and culturing LB medium;

Inoculating and culturing M9 medium; and/or

It may include, but is not limited to, the step of inoculating and culturing MR medium.

The step of inoculating and culturing in the LB medium can be used as primary culture, and the step of inoculating and culturing in M9 medium and/or MR medium can be used as secondary culture, but is not limited thereto.

The 1,3-PDO productivity of the 1,3-PDO and/or 3-HP production method is 0.1 g/L/hr or more, 0.5 g/L/hr or more, 1 g/L/hr or more, 1.3 g/L /hr or more, 1.6 g/L/hr or more, 1.9 g/L/hr or more, 2 g/L/hr or more, or 2.1 g/L/hr or more, such as 2.1 g/L/hr, The upper limit of 1,3-PDO productivity is not particularly limited, and may be, for example, 100 g/L/hr or less or 10 g/L/hr or less, but is not limited thereto.

The 3-HP productivity of the 1,3-PDO and/or 3-HP production method is 0.1 g/L/hr or more, 0.5 g/L/hr or more, 1 g/L/hr or more, 1.3 g/L/hr or more, 1.6 g/L/hr or more, 1.9 g/L/hr or more, or 2 g/L/hr or more, for example, 2 g/L/hr, and the upper limit of the 3-HP productivity is not particularly limited. , for example, may be 100 g/L/hr or less or 10 g/L/hr or less, but is not limited thereto.

The culture can be carried out according to appropriate media and culture conditions known in the art, must meet the requirements of the specific strain in an appropriate manner, and can be appropriately modified by a person skilled in the art.

The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.

According to one example, the medium may contain various carbon sources, nitrogen sources, and trace element components, and the recombinant cells are adjusted to temperature and/or pH in a typical medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc. You can cultivate it while doing it. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and/or cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and/or coconut oil; Included are fatty acids such as palmitic acid, stearic acid, and/or linoleic acid, alcohols such as glycerol, and/or ethanol, and organic acids such as acetic acid. These substances may be used individually or in mixtures, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or in a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. Additionally, the medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. Additionally, precursors suitable for the medium may be used. The medium or individual components may be added to the culture medium in an appropriate manner in a batch or continuous manner during the culture process, but are not limited thereto.

The step of separating and/or recovering 1,3-PDO and/or 3-HP from the cultured microorganism (or recombinant cell) and/or culture medium is performed using a suitable method known in the art according to the culture method. , a culture medium, or a desired substance (eg, 1,3-PDO and/or 3-HP) may be collected from the microorganism. For example, centrifugation, filtration, extraction, nebulization, drying, steaming, precipitation, crystallization, electrophoresis, differential dissolution (e.g. ammonium sulfate precipitation), and/or chromatography (e.g. ion exchange, affinity, hydrophobic, liquid, and size exclusion) may be used, but are not limited thereto. The culture medium may refer to a medium in which microorganisms (or recombinant cells) are cultured.

In one example, the method for producing 1,3-PDO and/or 3-HP includes purifying 1,3-PDO and/or 3-HP before, simultaneously with, or after the separation and/or recovery step. Can be additionally included.

As used herein, “fermented broth composition” refers to a composition manufactured by adding strains and/or microorganisms to a specific material and undergoing a culture and/or fermentation process.

The present specification provides a fermentation broth composition obtained by fermenting a microorganism having 1,3-PDO and 3-HP production activity and containing 1,3-PDO and/or 3-HP.

The fermentation broth composition contains 1,3-PDO in an amount of 50 g/L or more, 55 g/L or more, 60 g/L or more, 65 g/L or more, 70 g/L or more, 75 g/L or more, and 80 g/L. It may be included at a concentration of 81 g/L or more, for example, 81 g/L, and the upper limit of the 1,3-PDO concentration is not particularly limited, for example, 1000 g/L or less or 100 g/L or less. It may be included at a concentration of, but is not limited to.

The fermentation broth composition contains 3-HP of 50 g/L or more, 55 g/L or more, 60 g/L or more, 65 g/L or more, 70 g/L or more, 75 g/L or more, or 77 g/L or more, For example, it may be included at a concentration of 77 g/L, and the upper limit of the 3-HP concentration is not particularly limited. For example, it may be included at a concentration of 1000 g/L or less and 100 g/L or less, but is limited thereto. It doesn't work.

The fermentation broth composition may include 1,3-PDO and 3-HP at the same time, but is not limited thereto.

The fermentation broth composition may be produced using the microorganisms provided herein, but is not limited thereto.

The fermentation broth composition may be produced by the 1,3-PDO and/or 3-HP production method provided herein, but is not limited thereto.

The present invention relates to microorganisms into which dhaB, gdrAB, aldH and/or yqhD genes have been introduced and/or their use, and have the effect of producing 1,3-PDO and/or 3-HP.

Figure 1 is a graph showing the results of confirming the production of 1,3-PDO and 3-HP after culturing microorganisms into which dhaB, gdrAB, aldH and/or yqhD genes were introduced.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Plasmid design for strain recombination

To overexpress the yqhD gene, a vector containing yqhD was constructed. Specifically, the yqhD gene (SEQ ID NO: 1) was extracted from the genome of E. coli W3110 strain (yqhD, glpK, ldhA, ack-pta, gldA, and ptsG deletion; galP and glk overexpression; named DKALGP::PK strain; KCCM 40219). , prepared by amplification through PCR using a primer pair consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 3 (pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 1 minute, annealing at 55°C for 30 seconds, 72°C 30 second elongation was repeated 30 times, and after a final elongation of 2 minutes at 72°C, it was stored at 4°C, final product size: 1.1kb), and the yqhD gene and primer information are shown in Tables 1 and 2 below.

gene name Sequence (5' -> 3') sequence number yqhD_gene atgaacaactttaatctgcacacccccaacccgcattctgtttggtaaaggcgcaatcgctggtttacgcgaacaaattcctcacgatgctcgcgtattgattacctacggcggcggcagcgtgaaaaaaaccggcgttctcgatcaagttctggatgccctgaaaggcatggacgtgctggaatttggcggtattgagccaaac ccggcttatgaaacgctgatgaacgccgtgaaactggttcgcgaacagaaagtgactttcctgctggcggttggcggcggttctgtactggacggcacca aatttatcgccgcagcggctaactatccggaaaatatcgatccgtggcacattctgcaaacgggcggtaaagagattaaaagcgccatcccgatgggctgt gtgctgacgctgccagcaaccggttcagaatccaacgcaggcgcggtgatctcccgtaaaaccacaggcgacaagcaggcgttccattctgcccatgttcagccggtatttgccgtgctcgatccggtttatacctacaccctgccgccgcgtcaggtggctaacggcgtagtggacgcctttgtacacaccgtgga acagtatgttaccaaaccggttgatgccaaaattcaggaccgtttcgcagaaggcattttgctgacgctaatcgaagatggtccgaaagccctgaaagag ccagaaaactacgatgtgcgcgccaacgtcatgtgggcggcgactcaggcgctgaacggtttgattggcgctggcgtaccgcaggactgggcaacgcata tgctgggccacgaactgactgcgatgcacggtctggatcacgcgcaaacactggctatcgtcctgcctgcactgtggaatgaaaaacgcgataccaagcgcgctaagctgctgcaatatgctgaacgcgtctggaacatcactgaaggttccgatgatgagcgtattgacgccgcgattgccgcaacccgcaattt ctttgagcaattaggcgtgccgacccacctctccgactacggtctggacggcagctccatcccggctttgctgaaaaaactggaagagcacggcatgacccaactgggcgaaaatcatgacattacgttggatgtcagccgccgtatatacgaagccgcccgctaa One

Primer type Sequence (5' -> 3') sequence number yqhD_Primer_For tactagcgcagcttaatgaacaactttaatctgcacaccc 2 yqhD_Primer_Rev cagcagcctaggttaattaattagcgggcggcttcgtatatacgg 3

The yqhD gene prepared above was cloned into pCDF-dhaB1,2,3-gdrA,B-aldH plasmid for 3HP production.

Specifically, the pCDF-dhaB1,2,3-gdrA,B-aldH plasmid replaces the promoter part of the pCDFDuet-1 vector (Novagen 71340) with the J23101 and J23100 promoters and produces Krebsiella pneumoniae (K.pneumoniae genomic DNA) It is a vector that cloned the dhaB (dhaB1, dhaB2, dhaB3) and gdrAB genes (gdrA, gdrB) of (KCTC12385) and the aldH gene from E. coli K12 MG1655. The dhaB (about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) are obtained from the chromosome of Krebsiella pneumoniae using the primers in Table 3 below and the NEB (New England Biolabs) Q5 DNA polymer. It was amplified using lase under the conditions provided by NEB. Additionally, information on the promoter is shown in Table 4 below.

Primer type Sequence (5' -> 3') sequence number dhaB-gdrA_Primer_For GAATTCATGAAAAGATCAAAACGATTTGCAGTCCT 4 dhaB-gdrA_Primer_Rev AAGCTTGATCTCCCACTGACCAAAGCTGG 5 gdrB_Primer_For AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG 6 gdrB_Primer_Rev CTTAAGTCAGTTTCTCTCACTTAACGGC 7

Promoter type Sequence (5' -> 3') sequence number J23101_Promo tttacagctagctcagtcctaggtattatgctagc 8 J23100_Promo ttgacggctagctcagtcctaggtacagtgctagc 9

Since the dhaB123 and gdrA genes are located side by side on the chromosome of Krebsiella pneumoniae, they were amplified together. Since gdrB is located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately, and NEB Q5 DNA polymerase was used. , the conditions provided by NEB were used. Afterwards, the dhaB123 and gdrA genes were cloned under the J23101 promoter using restriction enzymes EcoRI and HindIII, and the gdrB gene was cloned under the J23101 promoter using restriction enzymes HindIII and AflII, creating pCDF-dhaB1,2,3-gdrA,B plasmid (hereinafter referred to as pCDF- dhaB-gdrAB vector) was prepared.

aldH was amplified from the E. coli K12 MG1655 chromosome using the J23100 promoter, using the primers in Table 5 below and NEB Q5 DNA polymerase, and conditions provided by NEB.

Primer type Sequence (5' -> 3') sequence number aldH_Primer_For ggtaccatgaattttcatcatctggc 10 aldH_Primer_Rev catatgtcaggcctccaggcttat 11

aldH was cloned through T4 DNA ligase reaction under the J23100 promoter of the pCDF-dhaB-gdrAB vector using restriction enzymes KpniI and NdeI, producing pCDF-dhaB1,2,3-gdrA,B-aldH plasmid (hereinafter referred to as pCDF-dhaB). -gdrAB-aldH vector) was prepared.

The yqhD gene prepared above was cloned into the pCDF-dhaB1,2,3-gdrA,B-aldH plasmid prepared as above by In-Fusion reaction using PacI restriction enzyme, and finally, the recombinant vector pCDF-dhaB1,2 ,3-gdrA,B-aldH-yqhD was prepared (hereinafter referred to as pCDF-dhaB-gdrAB-aldH-yqhD vector). Additionally, the pCDF-dhaB-gdrAB-yqhD vector was prepared by cloning yqhD instead of aldH into the pCDF-dhaB-gdrAB vector in the same manner as above.

Example 2. Preparation and cultivation of transformed strains

To prepare a transformed strain with the vector prepared in Example 1, Escherichia coli W3110 (yqhD, glpK, ldhA, ack-pta, gldA, and ptsG deletion; galP and glk overexpression; named DKALGP::PK strain) strain prepared. The strain was plated on an LB plate (containing 10g tryptone, 5g yeast extract, 10g NaCl, and 15g agar per 1L) and cultured at 37°C overnight. The cultured single colony was inoculated into 5 mL LB liquid medium (the medium composition was the same as the LB plate, but did not contain agar) and cultured overnight at 37°C with agitation. The next morning, the culture was diluted 1:100 in 5 mL of LB liquid medium and cultured for 3-6 hours until the OD reached ~0.5. After cooling on ice for 10-15 minutes, cells were collected by centrifugation at 4000 rpm for 10 minutes at 4°C. The cells were resuspended in 1 mL of ice-cold sterile DI water (Deionized water), washed, and centrifuged at 4000 rpm for 10 minutes at 4°C to collect the cells. The collected cells were resuspended in 1 mL of DI water, washed, and centrifuged at 4000 rpm for 10 minutes at 4°C to collect the cells. The collected cells were resuspended in 0.08 mL of DI water, and cell aliquots were placed in individual pre-chilled microfuge tubes.

Then, pCDFDuet-1 (pCDF) of Example 1 and the pCDF-dhaB-gdrAB vector, pCDF-dhaB-gdrAB-yqhD vector, and pCDF-dhaB-gdrAB-aldH-yqhD, which are the plasmid DNA produced in Example 1. After adding each vector (1 μL) by pipetting, 0.08 to 0.09 ml of the mixture was transferred to a pre-chilled 0.1 cm electroporation cuvette. Electroporation was performed at 1.8 kV, and immediately after the pulse, 1 mL of room temperature LB liquid medium was added to the cells and incubated at 37°C for 1 hour. The culture was plated on an LB plate containing streptomycin and excess liquid was dried and absorbed into the plate. The plate was inverted and cultured at 37°C to prepare a single colony.

Example 3. Confirmation of 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP) production of transformed strains through flask culture

In a 250 mL Erlenmeyer flask, 100 mL of modified M9 medium (MgSO ₄ ㆍ7H ₂ O 0.6 g/L, NaCl 1.5 g/L, Na ₂ HPO ₄ ㆍ7H ₂ O 12.8g/L, K ₂ HPO ₄ 17.4g/L, NH ₄ Cl 2g/L, yeast extract 0.5g/L, KH ₂ PO ₄ 3g/L and CaCl ₂ 0.11g/L containing) was prepared. At this time, the pH was maintained at 6.0 using Ca(OH) ₂ .

1 mL of the single colony prepared in Example 2 was inoculated into the M9 medium flask prepared above, cultured in a shaking incubator at 33°C and 250 rpm, and the strain culture solution was cultured at OD600 using HPLC using a UV Spectrometer under the analysis conditions shown in Table 6 below. The absorbance was measured to confirm the amount of 1,3-PDO and 3-HP production of the transformed strain of Example 2, and the results are shown in Table 7 below.

HPLC Model Agilent Technologies 1200 Series Column Bio-Rad Aminex HPX-87H Ion Exclusion Column300 mmⅹ7.8 mm Detector Refractive Index (RI) / Ultraviolet (UV) Detector Mobile Phase 0.5mM H ₂ SO ₄ Flow rate 0.4mL/min Run time 35min Column temperature 35℃ Detector temperature 35℃ Injection volume 10㎕

Type of vector in transformed strain 1,3-PDO (g/L) 3-HP (g/L) pCDF 0 0 pCDF-dhaB-gdrAB 0 0 pCDF-dhaB-gdrAB-yqhD 1.42 0 pCDF-dhaB-gdrAB-aldH-yqhD 2.40 1.31

As a result, when only Empty vector (pCDF) or dhaB/gdrAB is expressed, neither 1,3-PDO nor 3HP is produced. However, when dhaB/gdrAB was expressed together with yqhD, 1,3-PDO was produced at 1.42 g/L, and when aldH and yqhD were expressed simultaneously, 1,3-PDO and 3HP were produced simultaneously. During simultaneous fermentation, 1,3-PDO production increased by about 70% compared to single production, and 3HP was additionally produced, increasing the total target production.

Example 4. Confirmation of 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP) production of transformed strains through high-concentration cell culture

The single colony of Example 2 was inoculated into an LB liquid medium of the same composition as the LB liquid medium of Example 2 and pre-cultured (seed culture) for 18 hours at 37°C.

Afterwards, for high-concentration cell culture, in a 5L fermentor, modified MR medium (MgSO ₄ ㆍ7H ₂ O 0.8 g/L, (NH ₄ ) _{2HPO 4} 4 g/L, KH ₂ PO ₄ 6.67 g/L and Citrate 0.8 g/L) Inoculate 2L of the pre-culture (Seed culture) into a 150mL flask, 35°C, 500 rpm, pH 6.95 It was cultured under the conditions (adjusted using NH ₄ (OH)). After the glucose contained in the medium is consumed, add the Feeding Solution (including glucose 700g/L, MgSO ₄ 15g/L, Trace metal 10mL/1L, 10x MR salt 100mL/1L, and 25mg/L streptomycin) at a rate of 40 mL/hr. and cultured for 24 hours.

After high-concentration cell culture, for 3-HP production, the culture medium was added to 2L of new MR medium (containing (NH ₄ ) ₂ HPO ₄ 4 g/L, KH ₂ PO ₄ 6.67 g/L, and Citrate 0.8 g/L). was inoculated at an initial OD of 25 and 1 μM _of Vitamin B ₁₂ was added to produce 3-HP. Glucose 200 g/L and glycerol 500 g/L Feeding Solution were added at a rate of 35 mL/hr, and Mg(OH) ₂ was added to maintain pH 6.95.

Afterwards, the amount of 1,3-PDO and 3-HP production of the strain transformed with pCDF-dhaB-gdrAB-aldH-yqhD was confirmed using HPLC in substantially the same manner as in Example 3, and the results were It is shown in Figure 1 and Table 8. The yield was calculated using Equation 1 below.

[Equation 1]

Yield (%) = (amount of 1.3-PDO and 3-HP produced) / (amount of glucose and glycerol used) * 100

type Measures 1,3-PDO (g/L) 81 3-HP (g/L) 77 1,3-PDO productivity (g/L/hr) 2.1 3-HP productivity (g/L/hr) 2.0 Yield (%, g/g) 63

(In Table 8 above, productivity refers to the amount of production per hour)

As a result, high 1,3-PDO and 3-HP production amount and productivity were confirmed, and the yield was also confirmed to be high.

Sequence list electronic file attached

Claims (14)

A microorganism into which one or more genes selected from the group consisting of dhaB, gdrAB, aldH, and yqhD have been introduced. The microorganism according to claim 1, wherein the dhaB, gdrAB, aldH, and yqhD genes are all introduced. The microorganism according to claim 1, which simultaneously produces 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP). The microorganism according to claim 1, wherein the microorganism further comprises a feature in which the activity of one or more genes selected from the group consisting of yqhD, glpK, ldhA, ack-pta, gldA, and ptsG is weakened or inactivated. The microorganism according to claim 1, wherein the microorganism is a microorganism of the genus Escherichia, a microorganism of the genus Klebsiella, or a microorganism of the genus Lactobacillus. The microorganism according to any one of claims 1 to 5, which produces 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP) from glycerol. According to any one of claims 1 to 5,
1,3-PDO productivity greater than 1 g/L/hr, or
A microorganism having a 3-HP productivity of 1 g/L/hr or more. A composition for producing 1,3-PDO and 3-HP, comprising the microorganism of any one of claims 1 to 5. A recombinant vector comprising one or more genes selected from the group consisting of dhaB, gdrAB, aldH, and yqhD. A method for producing 1,3-PDO and 3-HP, comprising culturing the microorganism of any one of claims 1 to 5. According to clause 10,
The 1,3-PDO productivity of the 1,3-PDO and 3-HP production method is more than 1 g/L/hr, or
A 1,3-PDO and 3-HP production method, characterized in that the 3-HP productivity of the 1,3-PDO and 3-HP production method is 1 g/L/hr or more. A fermentation broth composition obtained by fermenting microorganisms with production activities of 1,3-PDO and 3-HP, and comprising 1,3-PDO at a concentration of 50 g/L or more and 3-HP at a concentration of 50 g/L or more. . The fermentation broth composition according to claim 12, which is produced by the microorganism of any one of claims 1 to 5. The fermentation broth composition according to claim 12, which is produced by the 1,3-PDO and 3-HP production method of claim 10.