KR20230046638A - Method for confirming 3-HP production ability of 3-HP production gene using E. coli having 3-hydroxypropionic acid production ability inserted with 3-hydroxypropionic acid production gene - Google Patents

Abstract

The present specification relates to microorganisms and/or Escherichia coli, into which an exogenous 3-hydroxypropionate (3-HP) production gene is inserted into genomic DNA and which has the ability to produce the 3-HP, and to uses thereof, wherein the use is to measure the production capacity of the inserted 3-HP production gene.

Description

Method for confirming 3-HP production ability of 3-HP production gene using E. coli having 3-hydroxypropionic acid production ability into which 3-hydroxypropionic acid production gene has been inserted using E. coli having 3-hydroxypropionic acid production ability inserted with 3-hydroxypropionic acid production gene}

Foreign 3-hydroxypropionate (3-HP) production gene is inserted into genomic DNA, microorganisms and / or Escherichia coli having 3-HP production ability and their uses and the microorganisms and / Or, it relates to a method for confirming 3-HP production ability of a 3-HP production gene inserted into the E. coli genomic DNA comprising the step of culturing E. coli.

3-hydroxypropionic acid (3-HP) is an important synthetic intermediate used in various chemical processes. It is a platform compound that can be converted into various chemicals including propanediol, ethyl 3-HP, malonic acid, propiolactone and acrylonitrile. In addition, since being selected as a Top 12 value-added bio-chemical by the US Department of Energy (DOE) in 2004, it has been actively researched in academia and industry.

3-HP can be produced through chemical processes using ethylene cyanohydrin, beta-idopropionic acid, beta-bromopropionic acid, beta-chloropropionic acid, beta-propiolactone, acrylic acid, etc. as intermediates, and can be produced from glycerol. It can also be produced through a biological process. However, most of these chemicals are toxic and carcinogenic, consume a large amount of energy under conditions of high temperature and pressure, and emit a large amount of pollutants.

The production of 3-HP is largely done by two methods, chemical and biological methods, but in the case of the chemical method, it is pointed out that the initial material is expensive and toxic substances are generated during the production process, so it is pointed out that it is not eco-friendly. Bio-processing is in the limelight.

For 3-HP biosynthesis using microorganisms, studies on a one-step fermentation method in which 3-HP production and cell growth occur simultaneously have been mainly conducted, but substrates for 3-HP production are also used for cell growth, and acetate (acetate) ) and lactic acid (lactate), there was a problem in that the yield and productivity of 3-HP were lowered, and this was improved through a two-step manufacturing method in which 3-HP production and cell growth were separately performed.

However, in the case of Escherichia coli having a plasmid vector containing a gene set for producing 3-HP from glycerol, when the above two-step culture in which cell growth and 3-HP production are separated using a culture medium and a minimal medium in a flask is applied 3-HP could not be produced, and as a result, the second-stage culture could not be applied, so the carbon source for cell growth and the carbon source consumed for 3-HP conversion had to be added to the minimum medium at the same time, and growth and production had to proceed simultaneously, so the cell concentration was low. In addition, it was not suitable for evaluating the performance of recombinant genes.

In addition, when culturing E. coli with a plasmid vector containing the gene set, it was necessary to add antibiotics to maintain a constant level of maintenance and productivity of the vector, which raised concerns about the cost of antibiotics and environmental pollution.

Under the above background, the present inventors inserted a foreign 3-hydroxypropionate (3-HP) production gene into genomic DNA to separately proceed with 3-HP production and cell growth. The present invention was completed by confirming the production of 3-HP through a two-step manufacturing method.

One example is a foreign 3-hydroxypropionate (3-hydroxypropionate, 3-HP) production gene is inserted into genomic DNA of 1 copy or more and has a 3-HP production ability, a microorganism (eg, E. coli ) is provided.

Another example provides a composition for confirming 3-HP productivity of a 3-HP production gene inserted into genomic DNA of the microorganism (eg, E. coli), including the microorganism (eg, E. coli).

Another example is a microorganism (eg, E. ) Provides a method for confirming the 3-HP productivity of the 3-HP production gene inserted into the genomic DNA of the microorganism (eg, E. coli), comprising the step of culturing.

The present specification is a microorganism and / or Escherichia coli having a foreign 3-hydroxypropionate (3-HP) production gene inserted into genomic DNA and having a 3-HP production ability and its use and Provided is a technique related to a method for confirming 3-HP production ability of a 3-HP production gene inserted into the E. coli genomic DNA, which includes culturing the microorganism and / or E. coli.

In this specification, “3-hydroxypropionate (3-HP)” corresponds to carboxylic acid, particularly β-carboxylic acid, is an acidic viscous liquid, and can be produced by microorganisms (eg, Escherichia coli). there is.

In the present specification, “microorganism” may include unicellular bacteria, and may be, for example, Escherichia genus including Escherichia coli.

As used herein, “Escherichia coli” refers to the genus Escherichia, E.coli DH5a, E.coli JM101, E.coli K12, E.coli W3110, E.coli X1776, E.coli B, and/or E.coli XL1 -Can be Blue.

One example is a foreign 3-hydroxypropionate (3-hydroxypropionate, 3-HP) production gene is inserted into genomic DNA of 1 copy or more and has a 3-HP production ability, a microorganism (eg, E. coli ) is provided.

Another example is a microorganism (eg, E. ) Provides a method for confirming the 3-HP productivity of the 3-HP production gene inserted into the genomic DNA of the microorganism (eg, E. coli), comprising the step of culturing.

The 3-HP production gene is 1 selected from the group consisting of glycerol dehydratase, aldehyde dehydrogenase, glycerol dehydratase reactivase and adenosyltransferase It may include genes of more than one species of enzyme, but is not limited thereto.

Among the genes of the microorganism (eg, E. coli), a gene selected from the group consisting of yqhD, glpK, ldhA, ack-pta, and gldA may be deleted, but is not limited thereto.

In the step of culturing the microorganism (eg, E. coli), a gene selected from the group consisting of yqhD, glpK, ldhA, ack-pta, and gldA among genes of the E. coli may be deleted, but is not limited thereto.

The 3-HP production gene can be inserted where one or more genes selected from the group consisting of ldhA, gldA, glpK, yqhD, mgsA, poxB and nfrA genes of the microorganism (eg, Escherichia coli) are located, and are limited thereto no.

The 3-HP production gene may be inserted into genomic DNA by the CRISPR-Cas9 system, but is not limited thereto.

Microorganisms (eg, Escherichia coli) having the 3-HP production ability may increase the 3-HP production ability in proportion to the copy number of the 3-HP production gene, but are not limited thereto.

Another example provides a composition for confirming 3-HP productivity of a 3-HP production gene inserted into genomic DNA of the microorganism (eg, E. coli), including the microorganism (eg, E. coli).

Confirmation of the 3-HP productivity may be to determine whether the 3-HP production produced by the E. coli is proportional to the copy number of the 3-HP production gene inserted into the E. coli genomic DNA, but is not limited thereto.

The method for confirming the 3-HP production ability of the 3-HP production gene inserted into the genomic DNA of the microorganism (eg, E. coli) further comprises measuring the amount of 3-HP produced by the microorganism (eg, E. coli). It can be done, but is not limited thereto.

In the step of measuring the amount of 3-HP produced, it is confirmed whether the production of 3-HP produced by the E. coli is proportional to the number of copies of the 3-HP production gene inserted into the E. coli genomic DNA, 3-HP Productivity can be confirmed, but is not limited thereto.

The method for confirming the 3-HP production ability of the 3-HP production gene inserted into the genomic DNA of the microorganism (eg, E. coli) may not include the step of administering an antibiotic, but is not limited thereto.

The method for confirming the 3-HP production ability of the 3-HP production gene inserted into the microbial (eg, E. coli) genomic DNA may be characterized in that the 3-HP production capacity increases in proportion to the copy number of the 3-HP production gene. Yes, but not limited thereto.

The step of culturing the microorganism (eg, Escherichia coli),

A first step of culturing in a medium containing glucose and/or sucrose as a carbon source; and

The second step of culturing in a medium containing glycerol as a carbon source

It may include, but is not limited thereto.

The medium of the second stage culture step may not contain glucose and/or sucrose as a carbon source, but is not limited thereto.

Hereinafter, the present application will be described in more detail.

A microorganism according to one embodiment may have the ability to synthesize an organic acid, for example, may have the ability to synthesize 3-hydroxypropionic acid (or 3-HP production ability). there is. According to one embodiment, the microorganism itself may be a strain genetically engineered to produce an organic acid by including a gene involved in the production of an organic acid, or to have an organic acid-producing ability or to enhance the organic acid-producing ability. Production of the organic acid includes production in a strain, production in a cell and secretion to the outside of the cell, or a combination thereof.

In this application, “having the ability to produce 3-hydroxypropionic acid (3-HP)” means that a cell and/or microorganism naturally having the ability to produce 3-HP, or a parent strain without the ability to produce 3-HP It may mean a microorganism endowed with productivity. When the microorganism has 3-HP production ability by introducing the mutation according to one embodiment and/or by introducing the mutation according to one embodiment to a microorganism having no 3-HP production ability, the microorganism has 3-HP production ability. It can be used to mean the case of being. For example, microorganisms of the genus Escherichia having 3-HP production ability are natural microorganisms themselves or foreign genes related to 3-HP production mechanisms are inserted, or the activity of endogenous genes is enhanced or inactivated to improve 3-HP production ability It may mean a microorganism of the genus Escherichia that has a

In microorganisms in which the foreign 3-hydroxypropionate (3-HP) production gene provided herein is inserted into genomic DNA, the 3-HP production gene is inserted into genomic DNA may be achieved by a composition and/or system for multiple insertion of a target gene (e.g., a foreign 3-hydroxypropionate, 3-HP production gene) including, but not limited to:

(1) a recombinant vector containing a gene encoding a Cas9 protein and a gene encoding a recombinase (“common recombinant vector”);

(2) Specific to the target site, which is present on the genome of the target cell and is a site where a target gene (eg, a foreign 3-hydroxypropionate, 3-HP production gene) is introduced, including the following Set of Recombinants (“Variable Recombinants”):

i) a temperature sensitive origin (ts origin), and a recombinant vector containing a gene expressing a guide RNA (gRNA) specific to the target site (“G recombinant vector”); and

ii) A recombinant vector ("D Recombinant DNA”).

The composition for multiple insertion may not include an antibiotic resistance gene in the common recombinant vector, the G recombinant vector, and the D recombinant DNA. By not including the antibiotic resistance gene, the size of each vector can be kept small, the metabolic burden of the target cell can be reduced, and the target gene can be repeatedly inserted without limiting the number of genes that can be introduced by the antibiotic resistance gene. There are advantages to being able to

In the present specification, "target cell" means a cell to be transformed, and the type may be selected without limitation within the target range of transformation. In one embodiment, the target cell may be a prokaryotic cell, and in another embodiment, the target cell may be a bacterial cell. In one example, the target cells may include both Gram-negative bacteria and Gram-positive bacteria, and in one embodiment, the target cells may be Escherichia coli, but is not limited thereto.

In the present specification, “target gene” refers to a nucleic acid molecule to be inserted into the genome of a target cell, and may be, for example, an exogenous 3-hydroxypropionate (3-HP) production gene.

Unless otherwise stated herein, a temperature refers to a temperature in degrees Celsius.

Unless otherwise specified herein, the base sequence is written from the 5' end to the 3' end, and the amino acid sequence is written from the N-terminus to the C-terminus.

In the present specification, the composition and/or system for multiple insertion of a target gene includes (1) a common recombinant vector including a gene encoding a Cas9 protein and a gene encoding a recombinase.

The common recombinant vector does not require additional insertion after being inserted into a target cell once, thereby reducing the burden on the cell.

The common recombinant vector may include an operably linked inducible promoter, a gene encoding a Cas9 protein, and a gene encoding a recombinase.

The inducible promoter may be selected and used without limitation within a range of purposes for regulating the expression of a gene encoding Cas9 and/or a gene encoding a recombinase. In one embodiment, the inducible promoter may be a promoter induced by arabinose.

The Cas9 protein plays a role of recognizing and cutting (eg, double strand break; DSB) PAM (Protospacer adjacent Motif) in the genome of a target cell. The PAM sequence may be a NNGG sequence, and the “N” may be an “A”, “T”, “C” or “G” base.

The Cas9 protein may be derived from Streptococcus pyonenes, and may be encoded by the nucleic acid sequence of SEQ ID NO: 1, but is not limited thereto.

When the double-stranded break generated by the Cas9 protein is not recovered by a recombinase or the like, the cell dies and is eliminated in the selection process, so cell selection is possible without the antibiotic resistance gene.

The recombinase may be selected without limitation from a target range for inserting a target gene into the genome of a target cell based on a homology site described later, and may be, for example, a RED recombinase. In one example, the recombinase may be encoded by the nucleic acid sequence of SEQ ID NO: 2, and when the target gene is inserted into the target cell's genome by the recombinase and the DSB is restored, cell death does not occur.

In the present specification, the composition and/or system for multiple insertion of a target gene includes (2) a set of variable recombination vectors. The variable recombinant vector set includes (i) a G recombinant vector (gRNA-containing) containing a gene expressing a guide RNA (gRNA) specific to a temperature-sensitive origin and target site, and (ii) a target gene and phase. D recombinant DNA (Donor), including homologous regions.

In the set of variable recombinant vectors, gRNAs and homologous regions may be designed specifically for the target site according to the location of the target site in the target cell, and the design may be performed using a method known in the art without limitation. .

The variable recombinant vector set includes (i) a G recombinant vector including a temperature sensitive origin and a gene expressing a guide RNA specific to a target site.

By using the temperature-sensitive origin, the G recombinant vector can be removed from the transformant by culturing the transduced transformant at a specific temperature or higher.

In one example, the specific temperature may be appropriately selected according to the type of temperature sensitive origin, and may be, for example, 36 degrees Celsius or more, 37 degrees Celsius or more, 39 degrees Celsius or more, or 41 degrees Celsius or more, but is not limited thereto no.

The temperature-sensitive origin makes it possible to easily remove the G recombinant vector only by changing the G temperature, and introduces a new G recombinant vector and D recombinant vector specific for the new target site to introduce the target gene into the new site, resulting in a simple process. Multiple gene introduction is possible.

A gene expressing the guide RNA (gRNA) can be designed by appropriately selecting by a person skilled in the art according to the target site to introduce the target gene.

The target gene of the guide RNA may be at least one selected from the group consisting of ldhA, yqhD, glpK, gldA, mgsA, poxB, and nfrA, but is not limited thereto.

In one embodiment, the guide RNA may be one or more selected from the group consisting of nucleic acid sequences of SEQ ID NOs: 3 to 17, but is not limited thereto.

In addition, the target gene of the guide RNA may be deleted in the target cell to be transformed, but is not limited thereto.

When a gene targeted by the guide RNA is deleted in the target cell, the body of the gene is deleted, and the head and tail of the gene may remain. The guide RNA can act by targeting the gene of the part.

The variable recombinant vector set includes (ii) D (Donor) recombinant DNA, including a target gene and a homology region.

The D recombinant DNA may be introduced into the target cell in the form of linear DNA, and in one example, the linear DNA is prepared by digesting a vector using a restriction enzyme or amplifying by polymerase chain reaction (PCR). can In addition, the D recombinant DNA may be a recombinant vector or a DNA strand.

The homology region corresponds to upstream and downstream of the target site, and is attached to the 5' end and 3' end of the target gene, respectively. The length of the homology region may be appropriately adjusted as needed, for example, 50 to 1200 bp, 50 to 1000 bp, 50 to 800 bp, 50 to 700 bp, 50 to 600 bp, 50 to 500 bp, 100 to 1200 bp, 100 to 1000 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 200 to 1200 bp, 200 to 1000 bp, 200 to 800 bp, 200 to 700 bp, 200 to 600 bp, 200 to 500 bp, 120 to 3000 bp, 300 bp It may be 1000 bp, 300 to 800 bp, 300 to 600 bp, or 300 to 500 bp, but is not limited thereto.

If the length of the homology region is too short, the efficiency of homologous recombination may be reduced, and if the homology region is too long, the size of the vector introduced into cells may be excessively large, resulting in low cell transduction efficiency.

When the target cell is Escherichia coli, the homologous region preferably has a length of at least 50 bp or more. When the homologous region is less than 50 bp in length, the efficiency of homologous recombination may decrease. The length of the homology region may be designed to be 100 bp or more, or 500 bp or more in order to experimentally distinguish success or failure.

The homology region can be appropriately selected and designed by a person skilled in the art according to the target site to introduce the target gene, and in one embodiment, the homology region may be a nucleic acid sequence of SEQ ID NOs: 18 to 31.

Among the homology regions, the homology region (or homologous arm) attached to the 5' end of the target gene includes a nucleic acid sequence in which a protospacer adjacent motif (PAM) sequence is substituted with another sequence. The PAM sequence is known to play a role in specifying the site at which the Cas9 protein (Cas restriction enzyme) cleaves, and generally has the sequence of NGG. In this case, each “N” base in the PAM sequence means an “A”, “T”, “G” or “C” base. In the present specification, the PAM sequence may mean 'NNGG', which further includes one base at the 5' end of the generally known 'NGG' sequence.

A nucleic acid sequence substituting the PAM sequence may be used without limitation as long as it is not a sequence of 'NNGG' within the purpose range for not being specifically recognized by Cas9. For example, the NNGG nucleic acid sequence is NNAA, NNAT , NNAG, NNAC, NNTA, NNTT, NNTG, NNTC, NNCA, NNCT, NNCG, NNCC, NNGA, NNGT, or NNGC nucleic acid sequences.

When the homology region in which the PAM sequence is not substituted is attached to the 5' end of the gene of interest, there is a risk that the Cas9 protein will recognise and cleave the site again while repeatedly introducing the gene of interest.

The method for producing a transformant in the present specification includes the following steps:

(1) introducing the composition and/or system provided by the present invention into a target cell;

(2) expressing Cas9 and a recombinase in the target cell to insert the gene of interest into the target site of the target cell; and

(3) removing the G recombinant vector by culturing the cells into which the gene of interest has been inserted into the target site at a temperature of 36 degrees Celsius or higher.

The transformant prepared by the above method may have a target gene inserted into a plurality of target sites on the genome (multiple insertion or multiple introduction). The target genes inserted into each of the target sites may be the same and/or different from each other.

The method for producing a transformant provided by the present invention includes (1) introducing the composition and/or system provided by the present invention into a target cell.

Details of the composition and/or system are as described above.

In step (1), the common recombinant vector and variable recombinant vector set may be introduced simultaneously and/or sequentially, and may be introduced by freely selecting a method known in the art within the scope of the purpose of external vector introduction.

In the present specification, the method for producing a transformant includes (2) expressing Cas9 and a recombinase in the target cell and inserting the target gene into the target site of the target cell.

The target site of the target cell is determined by the gRNA expressed in the G recombinant vector introduced into the target cell, and Cas9 cleaves (eg, double-strand break) the PAM sequence (NNGG) at the position designated by the gRNA. do.

The step of expressing Cas9 and/or recombinase in the target cell may be performed by induction using an inducible promoter. In one embodiment, the inducible promoter may be a promoter inducible by arabinose.

When the Cas9 and/or recombinase are constitutively expressed, the metabolic burden of the target cell may increase, and the risk of damage to an unintended genomic region may increase.

In the present specification, the method for preparing a transformant includes (3) culturing cells into which the target gene has been inserted at the target site at a temperature of 36 degrees Celsius or higher to remove the G recombinant vector.

Removal of the G recombination vector may be performed by the above-described temperature sensitive origin (ts origin). The culture temperature may be appropriately selected according to the type of the temperature-sensitive origin, and may be 36 degrees Celsius (the same below), 37 degrees or more, 39 degrees or more, or 41 degrees Celsius or more, but is not limited thereto.

In the present specification, the method for preparing a transformant may further include the following steps after removing the G recombinant vector:

(i) introducing into the transformant a variable recombinant vector set that is present on the genome of the transformant and is specific for a new target site other than the site into which the gene of interest is inserted;

(ii) expressing Cas9 and a recombinase in the transformant into which the variable recombinant vector set is introduced, and inserting the target gene into the new target site; and

(iii) removing the G recombinant vector by culturing the transformant in which the target gene has been inserted into the new target site at a temperature of 36 degrees Celsius or higher.

Steps (i) to (iii) may be repeated as many times as the number of target sites present in the genome of the target cell. gRNAs and/or homologous regions in the variable recombinant vector set may be substituted for each target site.

There is an advantage in that a target gene can be inserted into a plurality of target sites by the repetition step, and a large target gene having a total length of 9 kb or more or 10 kb or more of the introduced target gene can be quickly and easily introduced into the genome of a target cell.

The present invention also provides a transformant prepared by the above method.

The total length of the target gene inserted into the transformant is 1 kb or more, 5 kb or more, 10 kb or more, 1 to 30 kb, 1 to 15 kb, 1 to 10 kb, 5 to 30 kb, 5 to 15 kb, 5 to 10 kb, 10 to 30 kb, Or it may be 10 to 15 kb, but is not limited thereto.

The 3-HP production gene of E. coli, in which the foreign 3-hydroxypropionate (3-HP) production gene provided herein is inserted into genomic DNA, is 1 copy or more 100 copies 2 copies or more and 100 copies or less, 3 copies or more and 100 copies or less, 4 copies or more and 100 copies or less, 5 copies or more and 100 copies or less, 6 copies or more and 100 copies or less, 7 copies More than 100 copies, 1 copy more than 50 copies, 2 copies more than 50 copies, 3 copies more than 50 copies, 4 copies more than 50 copies, 5 copies more and less than 50 copies , 6 copies or more but 50 copies or less, 7 copies or more and 50 copies or less, 1 copy number or more but 30 copies or less, 2 copies or more and 30 copies or less, 3 copies or more and 30 copies or less, 4 copies or more 30 copies or less, 5 copies or more and 30 copies or less, 6 copies or more and 30 copies or less, 7 copies or more and 30 copies or less, 1 copy or more and 20 copies or less, 2 copies or more and 20 copies or less, 3 copies more than 20 copies, 4 copies more than 20 copies, 5 copies more than 20 copies, 6 copies more than 20 copies, 7 copies more than 20 copies, 1 copies more than 10 copies 2 copies and 10 copies or less, 3 copies and 10 copies and 4 copies, 5 copies and 10 copies and 10 copies, 6 copies and 10 copies and 7 copies More than 1 copy and less than 10 copies, More than 1 copy and less than 8 copies, More than 2 copies and less than 8 copies, More than 3 copies and less than 8 copies, More than 4 copies and less than 8 copies, More than 5 copies and less than 8 copies It may be inserted into genomic DNA at 6 copies or more and 8 copies or less, or 7 copies or more and 8 copies or less, but is not limited thereto.

In one example, the microorganism (eg, Escherichia coli) may be a strain having 3-HP production ability or genetically engineered to have 3-HP production ability. The production of 3-HP includes production in a strain, production in a cell and secretion to the outside of the cell, or a combination thereof.

In the present specification, “glycerol dehydratase” is an enzyme that catalyzes a chemical reaction, a decomposition enzyme that cleaves a carbon-oxygen bond, particularly belongs to the family of hydrolases, participates in glycerol lipid metabolism, and is a cofactor Use cobalamin. The enzyme may be encoded by dhaB (GenBank accession no. U30903.1) gene, but is not limited thereto.

The dhaB gene is derived from Klebsiella pneumoniae, and the gene encoding the glycerol dehydratase may include genes encoding dhaB1, dhaB2 and/or dhaB3, but is not limited thereto. . The glycerol dehydratase protein _and the gene encoding it are genes and/or It may contain variations in the amino acid sequence.

In the present specification, “aldehyde dehydrogenase” is an enzyme that catalyzes the oxidation of aldehyde. This enzyme can convert an aldehyde (R-C(=O)-H) into a carboxylic acid (R-C(=O)-O-H). The enzyme may be encoded by the aldH gene, and the gene is aldH (GenBank Accession no. U00096.3; EaldH) gene derived from Escherichia coli or E. coli K12 MG1655 18-3 cell line, Klebsi It may be a puuC gene derived from K. pneumonia, and/or a KGSADH gene derived from Azospirillum brasilense, but is not limited thereto. The aldehyde dehydrogenase protein and the gene encoding it may include mutations in the gene and/or amino acid sequence within the range of maintaining activity for producing 3-HP from 3-HPA.

In the present specification, "glycerol dehydratase reactivase" serves to maintain the activity of the catalyst during the catalytic reaction of glycerol dehydratase. The enzyme may be encoded by the gdrAB gene and may be derived from Klebsiella pneumonia.

In this specification, “adenosyltransferase” serves to improve vitamin B ₁₂ recycling and can be encoded by the gene btuR (GenBank: AAA23530.1), which can be derived from Escherichia coli. can

In the present specification, “yqhD” is a gene encoding alcohol dehydrogenase, which converts 3-hydroxypropanal into 1,3-PDO when glycerol is decomposed into 3-hydroxypropanal and water by glycerol dehydrogenase Encoding enzyme do.

In the present specification, “glpK” may be a gene encoding glycerol kinase.

In the present specification, “ldhA” may be a gene encoding lactate dehydrogenase.

In the present specification, “gldA” may be a gene encoding glycerol dehydrogenase.

In the present specification, “ack-pta” may be a gene encoding acetate kinase-phosphate acetyltransferase.

In the present specification, “mgsA” may be a gene encoding methylglyoxal synthase.

In the present specification, “poxB” may be a gene encoding pyruvate dehydrogenase.

In the present specification, “nfrA” may be a gene encoding bacteriophage adsorption protein A.

As used herein, “vector” refers to any medium for cloning and/or transfer of a base into a host cell. A vector may be a replica, into which other DNA fragments may be combined to effect replication of the linked fragments. "Replication unit" can mean any genetic unit (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, that is, is capable of replicating under its own control. there is. In the present invention, the vector is not particularly limited as long as it is capable of replicating in the host, and any vector known in the art may be used. The vector used in the construction of the recombinant vector may be a natural or recombinant plasmid, cosmid, virus, and/or bacteriophage. For example, pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, and/or Charon21A may be used as phage vectors or cosmid vectors, and pDZ vectors, pBR systems, A pUC system, a pBluescript II system, a pGEM system, a pTZ system, a pCL system, and/or a pET system, etc. can be used. Usable vectors are not particularly limited, and known expression vectors can be used. In one example, the vector may be inserted into the vector so that the transferred gene is irreversibly fused into the genome of the host cell to stably maintain gene expression in the cell for a long period of time. Such vectors may contain transcriptional and translational expression control sequences that allow the gene of interest to be expressed in the host of choice. Expression control sequences may include any operator sequence for regulating transcription, and/or sequences regulating termination of transcription and translation. In one example, the initiation codon and stop codon can generally be considered part of a nucleic acid sequence encoding a protein of interest, should be functional in a subject when the genetic construct is administered, and may be in frame with the coding sequence. there is. Also, in the case of an expression vector capable of replication, an origin of replication may be included. In addition, an enhancer, an untranslated region at the 3' end of the gene of interest, a selectable marker (eg, antibiotic resistance marker), and/or a replicable unit may be appropriately included. The vectors can replicate autonomously or integrate into the host genomic DNA.

According to one example, each component in the vector must be operably linked to each other, and the linkage of these component sequences can be performed by ligation (linkage) at a convenient restriction enzyme site, if such a site does not exist , It can be performed using a synthetic oligonucleotide adapter or linker according to a conventional method.

In the present specification, “transduction” refers to a phenomenon in which bacterial DNA is transferred to other bacteria via a bacteriophage, and is one of the methods of horizontal gene transfer (HGT). Bacteriophages capable of transduction in this way are called “transducing particles” or “transducing phages,” and cells receiving DNA from other bacteria are called “transductants.”

In the present specification, "transformation" is to introduce a gene into a host cell so that it can be expressed in the host cell, and the transformed gene is inserted into the chromosome of the host cell or located outside the chromosome if it can be expressed in the host cell. Anything can be included without limitation. In addition, the gene includes DNA and/or RNA encoding the target protein. As long as the gene can be introduced and expressed into a host microorganism, the introduced form is not limited. For example, the gene may be introduced into a host microorganism in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression. The expression cassette may include expression control elements such as a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and/or a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the gene may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell.

In the present specification, the transformation method is included without limitation as long as it is a method of introducing a gene into a cell, and can be performed by selecting a suitable standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, retroviral infection, polyethylene glycol (PEG) method, DEAE-dextran method , cationic liposome method, and/or lithium acetate-DMSO method may be used, but is not limited thereto.

In the method for confirming the 3-HP production ability of the 3-HP production gene inserted into the genomic DNA of the microorganism (eg, E. coli), comprising the step of culturing the microorganism (eg, E. coli), the culturing step is the first step of culturing. Step and / or may include a first step culture step and a second step culture step, but is not limited thereto.

The step of culturing the microorganism (eg, Escherichia coli),

A first step of culturing in a medium containing glucose and/or sucrose as a carbon source; and

The second step of culturing in a medium containing glycerol as a carbon source

It may include, but is not limited thereto.

The medium containing glucose and/or sucrose as the carbon source may be LB medium, and the medium containing glycerol as the carbon source may be M9 medium, but is not limited thereto.

The culture can be performed according to appropriate media and culture conditions known in the art, and must meet the requirements of a specific strain in an appropriate manner, and can be appropriately modified by a person skilled in the art.

The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.

According to one example, the medium may contain various carbon sources, nitrogen sources, and trace element components, and the recombinant cells are controlled by temperature and/or pH in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, and the like. You can cultivate while doing it. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and/or cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and/or coconut oil, fatty acids such as palmitic acid, stearic acid, and/or linoleic acid; alcohols such as glycerol, and/or ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. In addition, the medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. Precursors suitable for the medium may also be used. The medium or individual components may be added in a batchwise or continuous manner by a method suitable for the culture medium during the culture process, but is not limited thereto.

According to one example, the pH of the culture medium may be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. In addition, the formation of bubbles can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Additionally, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (eg, air) may be injected into the culture medium. The temperature of the culture medium may be 20 °C to 45 °C, 25 °C to 40 °C or 30 °C to 37 °C, for example, 37 °C. The culturing period may be continued until a useful material (eg, 3-HP) is obtained in a desired yield, for example, 3 to 60 hours, 3 to 48 hours, 3 to 36 hours, 3 to 28 hours, 6 to 60 hours, 6 to 48 hours, 6 to 36 hours, 6 to 28 hours, 12 to 60 hours, 12 to 48 hours, 12 to 36 hours, 12 to 28 hours, 20 to 60 hours, 20 to 48 hours, 20 to 36 hours or 20 to 28 hours, for example, 24 hours, but is not limited thereto.

The step of separating and/or recovering 3-HP from the cultured microorganisms (or recombinant cells) and/or culture medium may be performed by using a suitable method known in the art according to the culture method to obtain the desired target from the culture medium, culture medium, or microorganism. It may be to collect a substance (eg, 3-HP). For example, centrifugation, filtration, extraction, spraying, drying, steaming, precipitation, crystallization, electrophoresis, fractionation (eg ammonium sulfate precipitation), and/or chromatography (eg ion exchange, affinity, hydrophobicity, liquid, and size exclusion) may be used, but is not limited thereto. The culture medium may mean a medium in which microorganisms (or recombinant cells) are cultured.

In one example, the 3-HP production method may additionally include a step of purifying 3-HP before, simultaneously with, or after the step of separating and/or recovering.

In the present specification, the foreign 3-hydroxypropionate (3-HP) production gene is inserted into the genomic DNA (genomic DNA) microorganisms and / or Escherichia coli have 3-HP production ability, the microorganisms and / Alternatively, it provides a composition for confirming the 3-HP production ability of the 3-HP production gene inserted into the genomic DNA containing E. coli. In addition, it provides a method for confirming the 3-HP productivity of the 3-HP production gene inserted into the microorganism and / or E. coli genomic DNA, comprising the step of culturing the microorganism and / or E. coli.

1 is a series map of a common recombinant vector including a Cas9 gene and a recombinase.
FIG. 2 shows homology arm regions connected before and after the insertion site at the 5' and 3' ends of the gene of interest included in the D recombinant DNA.
Figure 3 shows a cassette recombinant vector containing four types of target genes (inserted genes).
Figure 4 shows the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector, which is a 3-HP production gene plasmid vector.
5 shows a 3-HP production pRSF plasmid vector based on the pRSFDuet-1 vector.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the present invention is not limited by the following examples.

In this specification, unless otherwise specified, all temperatures are based on Celsius, and nucleic acid sequences are written from the 5' end to the 3' end unless otherwise specified.

Example 1. Plasmid design for strain recombination

1-1. Manufacture of common recombinant vectors (including Cas9 and recombinase)

In this example, a common recombinant vector including a Cas9 gene and a recombinase was prepared.

More specifically, the Cas9 gene (SEQ ID NO: 1) in the araC gene and the RED recombinase gene expression vector that regulates the transcription of Cas9 under the araBAD promoter, which is induction with the RSF origin and arabinose And a recombinase (RED recomgbinase; SEQ ID NO: 2) was inserted to prepare a common recombinant vector, and specific information is shown in Table 1 below.

Figure 1 shows a family map of common recombinant vectors. Since the common recombinant vector is inserted once during the first gene insertion, it is always maintained in the recombinant cell without an additional gene insertion process, and functions to edit the genome according to the type of gRNA and homology region to be introduced. carry out

designation Sequence (5'->3') sequence number Cas9 gene atggataagaaatactcaataggcttagatatcggcacaaatagcgtcggatgggcggtgatcactgatgaatataaggttccgtctaaaaagttcaaggttctgggaaatacagaccgccacagtatcaaaaaaaatcttataggggctcttttatttgacagtggagagacagcggaagcgactcgtctcaaacggacagctcgtagaaggtatacacgtcggaagaatcgtatttgttatctacaggagattttttcaaatgagatggcgaaagtagatgatagtttctttcatcgacttgaagagtcttttttggtggaagaagacaagaagcatgaacgtcatcctatttttggaaatatagtagatgaagttgcttatcatgagaaatatccaactatctatcatctgcgaaaaaaattggtagattctactgataaagcggatttgcgcttaatctatttggccttagcgcatatgattaagtttcgtggtcattttttgattgagggagatttaaatcctgataatagtgatgtggacaaactatttatccagttggtacaaacctacaatcaattatttgaagaaaaccctattaacgcaagtggagtagatgctaaagcgattctttctgcacgattgagtaaatcaagacgattagaaaatctcattgctcagctccccggtgagaagaaaaatggcttatttgggaatctcattgctttgtcattgggtttgacccctaattttaaatcaaattttgatttggcagaagatgctaaattacagctttcaaaagatacttacgatgatgatttagataatttattggcgcaaattggagatcaatatgctgatttgtttttggcagctaagaatttatcagatgctattttactttcagatatcctaagagtaaatactgaaataactaaggctcccctatcagcttcaatgattaaacgctacgatgaacatcatcaagacttgactcttttaaaagctttagttcgacaacaacttccagaaaagtataaagaaatcttttttgatcaatcaaaaaacggatatgcaggttatattgatgggggagctagccaagaagaattttataaatttatcaaaccaattttagaaaaaatggatggtactgaggaattattggtgaaactaaatcgtgaagatttgctgcgcaagcaacggacctttgacaacggctctattccccatcaaattcacttgggtgagctgcatgctattttgagaagacaagaagacttttatccatttttaaaagacaatcgtgagaagattgaaaaaatcttgacttttcgaattccttattatgttggtccattggcgcgtggcaatagtcgttttgcatggatgactcggaagtctgaagaaacaattaccccatggaattttgaagaagttgtcgataaaggtgcttcagctcaatcatttattgaacgcatgacaaactttgataaaaatcttccaaatgaaaaagtactaccaaaacatagtttgctttatgagtattttacggtttataacgaattgacaaaggtcaaatatgttactgaaggaatgcgaaaaccagcatttctttcaggtgaacagaagaaagccattgttgatttactcttcaaaacaaatcgaaaagtaaccgttaagcaattaaaagaagattatttcaaaaaaatagaatgttttgatagtgttgaaatttcaggagttgaagatagatttaatgcttcattaggtacctaccatgatttgctaaaaattattaaagataaagattttttggataatgaagaaaatgaagatatcttagaggatattgttttaacattgaccttatttgaagatagggagatgattgaggaaagacttaaaacatatgctcacctctttgatgataaggtgatgaaacagcttaaacgtcgccgttatactggttggggacgtttgtctcgaaaattgattaatggtattagggataagcaatctggcaaaacaatattagattttttgaaatcagatggttttgccaatcgcaattttatgcagctgatccatgatgatagtttgacatttaaagaagacattcaaaaagcacaagtgtctggacaaggcgatagtttacatgaacatattgcaaatttagctggtagccctgctattaaaaaaggtattttacagactgtaaaagttgttgatgaattggtcaaagtaatggggcggcataagccagaaaatatcgttattgaaatggcacgtgaaaatcagacaactcaaaagggccagaaaaattcgcgagagcgtatgaaacgaatcgaagaaggtatcaaagaattaggaagtcagattcttaaagagcatcctgttgaaaatactcaattgcaaaatgaaaagctctatctctattatctccaaaatggaagagacatgtatgtggaccaagaattagatattaatcgtttaagtgattatgatgtcgatcacattgttccacaaagtttccttaaagacgattcaatagacaataaggtcttaacgcgttctgataaaaatcgtggtaaatcggataacgttccaagtgaagaagtagtcaaaaagatgaaaaactattggagacaacttctaaacgccaagttaatcactcaacgtaagtttgataatttaacgaaagctgaacgtggaggtttgagtgaacttgataaagctggttttatcaaacgccaattggttgaaactcgccaaatcactaagcatgtggcacaaattttggatagtcgcatgaatactaaatacgatgaaaatgataaacttattcgagaggttaaagtgattaccttaaaatctaaattagtttctgacttccgaaaagatttccaattctataaagtacgtgagattaacaattaccatcatgcccatgatgcgtatctaaatgccgtcgttggaactgctttgattaagaaatatccaaaacttgaatcggagtttgtctatggtgattataaagtttatgatgttcgtaaaatgattgctaagtctgagcaagaaataggcaaagcaaccgcaaaatatttcttttactctaatatcatgaacttcttcaaaacagaaattacacttgcaaatggagagattcgcaaacgccctctaatcgaaactaatggggaaactggagaaattgtctgggataaagggcgagattttgccacagtgcgcaaagtattgtccatgccccaagtcaatattgtcaagaaaacagaagtacagacaggcggattctccaaggagtcaattttaccaaaaagaaattcggacaagcttattgctcgtaaaaaagactgggatccaaaaaaatatggtggttttgatagtccaacggtagcttattcagtcctagtggttgctaaggtggaaaaagggaaatcgaagaagttaaaatccgttaaagagttactagggatcacaattatggaaagaagttcctttgaaaaaaatccgattgactttttagaagctaaaggatataaggaagttaaaaaagacttaatcattaaactacctaaatatagtctttttgagttagaaaacggtcgtaaacggatgctggctagtgccggagaattacaaaaaggaaatgagctggctctgccaagcaaatatgtgaattttttatatttagctagtcattatgaaaagttgaagggtagtccagaagataacgaacaaaaacaattgtttgtggagcagcataagcattatttagatgagattattgagcaaatcagtgaattttctaagcgtgttattttagcagatgccaatttagataaagttcttagtgcatataacaaacatagagacaaaccaatacgtgaacaagcagaaaatattattcatttatttacgttgacgaatcttggagctcccgctgcttttaaatattttgatacaacaattgatcgtaaacgatatacgtctacaaaagaagttttagatgccactcttatccatcaatccatcactggtctttatgaaacacgcattgatttgagtcagctaggaggtgactga One RED recombinase gene atggatattaatactgaaactgagatcaagcaaaagcattcactaaccccctttcctgttttcctaatcagcccggcatttcgcgggcgatattttcacagctatttcaggagttcagccatgaacgcttattacattcaggatcgtcttgaggctcagagctgggcgcgtcactaccagcagctcgcccgtgaagagaaagaggcagaactggcagacgacatggaaaaaggcctgccccagcacctgtttgaatcgctatgcatcgatcatttgcaacgccacggggccagcaaaaaatccattacccgtgcgtttgatgacgatgttgagtttcaggagcgcatggcagaacacatccggtacatggttgaaaccattgctcaccaccaggttgatattgattcagaggtataaaacgaatgagtactgcactcgcaacgctggctgggaagctggctgaacgtgtcggcatggattctgtcgacccacaggaactgatcaccactcttcgccagacggcatttaaaggtgatgccagcgatgcgcagttcatcgcattactgatcgttgccaaccagtacggccttaatccgtggacgaaagaaatttacgcctttcctgataagcagaatggcatcgttccggtggtgggcgttgatggctggtcccgcatcatcaatgaaaaccagcagtttgatggcatggactttgagcaggacaatgaatcctgtacatgccggatttaccgcaaggaccgtaatcatccgatctgcgttaccgaatggatggatgaatgccgccgcgaaccattcaaaactcgcgaaggcagagaaatcacggggccgtggcagtcgcatcccaaacggatgttacgtcataaagccatgattcagtgtgcccgtctggccttcggatttgctggtatctatgacaaggatgaagccgagcgcattgtcgaaaatactgcatacactgcagaacgtcagccggaacgcgacatcactccggttaacgatgaaaccatgcaggagattaacactctgctgatcgccctggataaaacatgggatgacgacttattgccgctctgttcccagatatttcgccgcgacattcgtgcatcgtcagaactgacacaggccgaagcagtaaaagctcttggattcctgaaacagaaagccgcagagcagaaggtggcagcatgacaccggacattatcctgcagcgtaccgggatcgatgtgagagctgtcgaacagggggatgatgcgtggcacaaattacggctcggcgtcatcaccgcttcagaagttcacaacgtgatagcaaaaccccgctccggaaagaagtggcctgacatgaaaatgtcctacttccacaccctgcttgctgaggtttgcaccggtgtggctccggaagttaacgctaaagcactggcctggggaaaacagtacgagaacgacgccagaaccctgtttgaattcacttccggcgtgaatgttactgaatccccgatcatctatcgcgacgaaagtatgcgtaccgcctgctctcccgatggtttatgcagtgacggcaacggccttgaactgaaatgcccgtttacctcccgggatttcatgaagttccggctcggtggtttcgaggccataaagtcagcttacatggcccaggtgcagtacagcatgtgggtgacgcgaaaaaatgcctggtactttgccaactatgacccgcgtatgaagcgtgaaggcctgcattatgtcgtgattgagcgggatgaaaagtacatggcgagttttgacgagatcgtgccggagttcatcgaaaaaatggacgaggcactggctgaaattggttttgtatttggggagcaatggcgatga 2

1-2. G Recombinant Vector (including guide RNA and ts Origin)

The temperature-sensitive pSC101 origin, the ampicillin antibiotic resistance gene, the sgRNA specifying the integration site under the J23100 promoter, and the sgRNA scaffold of the CRISPR-Cas9 system of Streptococcus pyogenes ( S. pyogenes ) (Cas9 An expression vector containing the sequence acting in conjunction with ) was prepared and named G (Guide RNA-containing) recombinant vector.

The sgRNA can be prepared by a method known in the art depending on the insertion site, and the nucleic acid sequence of the gene encoding the sgRNA used in the present invention is shown in Table 2 below.

Target gRNA sequence (5'->3') Accession Number sequence number ldhA GCACGTTGTGGCAGGCAGAC BAA14990.1 (GenBank) 3 TAACGTCTGATTCAGAGAAC 4 AACGTCTGATTCAGAGAACA 5 yqhD ACTTTCCTGCTGGCGGTTGG BAE77068.1 (GenBank) 6 CACCAAATTTATCGCCGCAG 7 glpK ATTGTCTGGGAAAAAGAAAC BAE77384.1 (GenBank) 8 CGTCGTTCTTCCGAAGTATA 9 gldA ATCGCGGAGACTGCGCAGTG AAC76927.2 (GenBank) 10 CCTCGATACTGCCAAAGCAC 11 mgsA CGAGATAACGCTGATAATCG CAA72119.1 (GenBank) 12 CGCAGCAAGGCTTTCACGTC 13 poxB CAGTGCATGGTTGCCCCTTC CAA27725.1 (GenBank) 14 GTACTTGTGGGGATCTGCTCC 15 nfrA CGCATGCAGCCACCAGTAGA AAC36849.1 (GenBank) 16 CCAGTCGCGCCATTAAAGTC 17

1-3. D Recombinant DNA (including homology regions and target genes)

D (Donor) recombinant DNA containing the target gene (donor or insert) to be introduced into the genome was prepared as follows.

As the target gene, dhaB, gdrAB, aldH and btuR parts of the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector of Korean Patent Publication No. 10-2020-0051375 were used, and homology arms 1 kb long before and after the insertion site at the 5' and 3' ends of the target gene, respectively. (homology arm) region was connected. At this time, the PAM sequence (NNGG) included in the homology arm in the 5' direction (the beginning of the foreign target gene operon) was substituted with CAAA to prepare a 3-HP production gene cassette recombinant vector (see FIG. 3). In the PAM sequence, N base means A base, T base, C base or G base.

Specifically, the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector was treated with xbaI and pacI restriction enzymes (Thermo Scientific) to prepare a fragment, and PCR was performed on the genomic DNA of E. coli W3110 strain (purchased from KCTC) with the primers shown in Table 3 below Thus, upstream and downstream fragments of the homology arm were prepared, and the two fragments were mixed in an In-fusion (TAKARA) reaction to prepare a 3-HP production gene cassette recombinant vector.

Types of homology arm primers homology arm sequence (5'->3') sequence number ldhA_upstream_For actgaaccgctctaggcgattgggatgtgtgcattacc 48 ldhA_upstream_Rev tagctgtaaatctagatctctctgcactgcccgc 49 ldhA_downstream_For tactagcgcagcttaagctcaaagccaaaggactcg 50 ldhA_downstream_Rev cagcagcctaggttaacgatcaattgcccgctattttcc 51 yqhD_upstream_For actgaaccgctctagggcggagttaatcccgctg 52 yqhD_upstream_Rev tagctgtaaatctagcactttctgttcgcgaaccagtttc 53 yqhD_downstream_For tactagcgcagcttagaacagtatgttaccaaaccggttg 54 yqhD_downstream_Rev cagcagcctaggttaagggctttgccgacacct 55 glpK_upstream_For tactagcgcagcttaacctatggcactggctgct 56 glpK_upstream_Rev tagctgtaaatctaggtcatattacagcgaagctttttgt 57 glpK_downstream_For tactagcgcagcttaaagcgtttatgccgcatccg 58 glpK_downstream_Rev cagcagcctaggtttcttcgttgtcgcctttgacg 59 gldA_upstream_For actgaaccgctctagcatgcacgaagaattccgtaac 60 gldA_upstream_Rev tagctgtaaatctagaaacctaaaacaaatttgtcaccc 61 gldA_downstream_For tactagcgcagcttagaagcggcatgtgcagaagg 62 gldA_downstream_Rev cagcagcctaggtttatctgaaaccaccccaatatgtgc 63 mgsA_upstream_For actgaaccgctctaggattgtgattctggagaaaggtcgc 64 mgsA_upstream_Rev tagctgtaaatctagcggaccgtctgaagtaatattgc 65 mgsA_downstream_For tactagcgcagcttatccgcgcaggtaaagtgc 66 mgsA_downstream_Rev cagcagcctaggttacgaatgaatgagagcaaaagcggg 67 poxB_upstream_For actgaaccgctctagcggcattaaagatgcgcgca 68 poxB_upstream_Rev tagctgtaaatctagacaacagcgtgctgggct 69 poxB_downstream_For tactagcgcagcttaagctcgcaatagtgactacattcgc 70 poxB_downstream_Rev cagcagcctaggttacgtgatgacctgcggccc 71 nfrA_upstream_For actgaaccgctctagtgtgcggccaggcgtcgtagtgc 72 nfrA_upstream_Rev tagctgtaaatctaggggcttccggacgatccg 73 nfrA_downstream_For tactagcgcagcttaggcgagcagtttttgcgc 74 nfrA_downstream_Rev cagcagcctaggttaacagaaaaataacgacgaagcaacc 75

By substituting the PAM sequence with the CAAA sequence, it is possible to prevent the insertion site of the foreign gene, which has already been introduced and expressed, from being cleaved by Cas9 again in the subsequent transformation step.

In order to insert the 3-HP production gene cassette recombinant vector, the sequence of the homology arms acting on the gene targeted by the guide RNA so that the guide RNA sequence of Table 2 acts on the E. coli genome to be inserted is shown in Table 4 below. shown in

Types of homology arms homology arm sequence (5'->3') sequence number ldhA_upstream ggcgattgggatgtgtgcattacccaacggcaaacgctgtagcgaacagtcacttgccgccgggagctgtggcagctattaattcattaaatccgccagcttataagttaatgtctgttttgcggtcgccagcgttaactggttcgcggtcagatccacttgtgcaccttctttcagcatttcgctaatggtgttatcgagttcattaagctgcgggttagcgcacatcatacgggtcattgccagccctttggc 18 ldhA_downstream tactagcgcagcttaagctcaaagccaaaggactcgttcacctgttgcaggtacttcttgtcgtactgttttgtgctataaacggcgagtttcataagactttctccagtgatgttgaatcacatttaagctactaaaaatattttacaaaatttcaaatttaattgaaagctatggcgatattgaaaattcatcaacaactatgcttagtgtagatacctggaaccttaactgcaacctgaacctgcaactg 19 yqhD_upstream ggcggagttaatcccgctggctgccatcgacggctggaaatgctcatcttcgccaatgtccatcaacagttcctgtaactgcaaaatatcgacattgagacgcaaccctgccagcggcacctctgacgtggcataggtttcgcactcaaacggcaacggcaccgtcagcagcaggtattcattggcatcataacgaaacacgcgtttcattgatgattagaccgattgatgatagaccgattga 20 yqhD_downstream tactagcgcagcttagaacagtatgttaccaaaccggttgatgccaaaattcaggaccgtttcgcagaaggcattttgctgacgctaatcgaagatggtccgaaagccctgaaagagccagaaaactacgatgtgcgcgccaacgtcatgtgggcggcgactcaggcgctgaacggtttgattggcgctggcgtaccgcaggactgggcaacgcatatgctgggccacgaactgactgcgatgcacggtctggat 21 glpK_upstream ccgggttgttgattttcttcggtgtgggttgcgttgcagcactaaaagtcgctggtgcgtcttttggtcagtgggaaatcagtgtcatttggggactgggggtggcaatggccatctacctgaccgcaggggtttccggcgcgcatcttaatcccgctgttaccattgcattgtggctgtttgcctgtttcgacaagcgcaaagttattccttttatcgtttcacaagttgccggcgctttctgtgctgcggctt 22 glpK_downstream tactagcgcagcttaacctatggcactggctgctttatgctgatgaacactggcgagaaagcggtgaaatcagaaaacggcctgctgaccaccatcgcctgcggcccgactggcgaagtgaactatgcgttggaaggtgcggtgtttatggcaggcgcatccattcagtggctgcgcgatgaaatgaagttgattaacgacgcctacgattccgaatatttcgccaccaaagtgcaaaacaccaatggtgtgtat 23 gldA_upstream catgcacgaagaattccgtaacgcgctggttaacgccgcctctgccgacgctatcgccagcctgctgcaacatgaactggaactgtaaaaggaaacatcatggaactgtatctggacaccgctaacgtcgcagaagtcgaacgtctggcacgcatattccccattgccggggtgacaactaacccgagcattatcgctgccagcaaggagtccatatgggaggtgctgcagcaaggagtccatatgggaagtgctg 24 gldA_downstream tactagcgcagcttagaagcggcatgtgcagaaggtgaaaccattcacaacatgcctggcggcgcgacgccagatcaggtttacgccgctctgctggtagccgaccagtacggtcagcgtttcctgcaagagtgggaataacctactccaaactcccggcttgtccgggagtttgaacgcaaaattgcctgatgcgctacgcttatcaggcctacgcaatctctgcaatatattgaatttgcgtgcttttgtagg 25 mgsA_upstream gattgtgattctggagaaaggtcgctttatcagcccgtggaagcatattctggttgatgaatttcaggatatctcgccgcagcgggcagcgttgttagcggcattacgcaagcaaaacagtcagacgacgttgttcgctgttggtgatgactggcaggcgatttaccgattcagcggtgcgcaaatgtcgctcaccaccgctttccatgaaaactttggtgaaggcgaacgctgtgatttagacacgacttaccg 26 mgsA_downstream tactagcgcagcttatccgcgcaggtaaagtgcgagtcgtcagttccataatgtacatccgtagttaactttcctacagattactgtaagcacttatcgctgcaagataaagaccgaaaaagcctgcgcacaggcacaaaaatctcaggaagatggttgtttttccgcccactgcaggaaagtatttcgcgtttgtgggtcagccagtttaaaccaatacttcagccgttgttctgtgagcacctgagactgcgg 27 poxB_upstream ttaccttagccagtttgttttcgccagttcgatcacttcatcaccgcgtccgctgatgattgcgcgcagcatatacaggctgaaacctttggcctgttcgagtttgatctgcggtggaatggctaactcttctttggcgaccaccacatccaccaacaccggaccgtcgatggagaaggcgcgttgcagggcttcatcaacttcagacgctttttctacacggatacccgtaatgccgcacgcttcggcaatgcg 28 poxB_downstream tactagcgcagcttaagctcgcaatagtgactacattcgcggaatagctcttgtgggtgggtttcctggaaatagccgctgccaatttcgctggagggaatatgagcggcaatcgccagtaccggaacgtgattgcggtggcaatcgaacaggccgttgattaagtgcaggttgccggggccgcacgatccggcgcagaccgccagttctccgctaagttgtgcttcagcgccagcggcaaaggccgccacttct 29 nfrA_upstream tgtgcggccaggcgtcgtagtgcgtctcgccggtccagatattccagcggaccccgactccgccaagctgcgcgccctgagtgcctttatcacgatagccgttgtcctgaacgtgagcgtaaggctcaatagtctgtccgttagctaccttctgatgccagctgacgcgataatctgccgtccacgcctgaatatcctggcggatatattgcgccgcatcgaggtacaggttttgggcaaaccagcctgaaccgt 30 nfrA_downstream tactagcgcagcttaggcgagcagtttttgcgctgcgtcgtactgaccttcttttaacagcaccggtagcgtcgcgccaacaacatactggcggttgtcggcaaactgtaccgtataattcgccaacgcctgaacggggttagcgctgtatttagataacagatagagccaacttttctcttgtgcgtccgtggtaaatagtggcttattttcaatgagataatgctggaggcgtgctttttcgccacgataagc 31

The homology arm junction and the cassette recombinant vector are shown in FIGS. 2 and 3, respectively.

Example 2. Gene deletion and 3-hydroxypropionic acid (3-hydroxypropionic acid, 3-HP) Production of a strain inserted into genomic DNA

The common recombinant vector, G recombinant vector and D recombinant DNA prepared in Example 1 were used in E. coli W3110 strain (purchased from KCTC), a strain in which yqhD, glpK, ldhA, ack-pta and gldA genes were deleted. W3110 (ΔyqhD, ΔglpK, ΔldhA, Δack-pta and ΔgldA) (named DKALG strains) were transduced with 5 copies, 6 copies and 7 copies, respectively. Subsequently, transformants were prepared by expressing Cas9 and RED recombinase of the common recombinant vector.

Transduction of the 5 copy number into the DKALG strain was performed using the ldhA, gldA, glpK, yqhD and mgsA (5) sgRNAs of Example 1-2 as a G recombinant vector, and the 6 copy number The transduction was performed using ldhA, gldA, glpK, yqhD, mgsA and poxB (six) sgRNAs of Example 1-2, and the 7 copies were transduced as in Example 1-2. It was transduced using ldhA, gldA, glpK, yqhD, mgsA, poxB and nfrA (seven) sgRNAs.

Specifically, the E. coli strain was cultured at 37 ° C. to have an O.D. (600 nm) of 0.5 to 1, washed twice with distilled water (DW), and then electroporated by adding 50 to 100 ng of each recombinant vector. Colonies were selected. D In the case of recombinant DNA, the prepared vector was introduced in a linear form by enzymatic treatment or PCR, or introduced as a vector.

Thereafter, the selected colonies in LB medium were cultured at 37 ° C., and RED recombinase was expressed by adding arabinose at a concentration of 0.1 to 1% (w / v), and further at 37 ° C. for 1 hour. cultured.

Colony PCR was performed on the prepared transformants to select transformed strains, and cell streaking was performed at 37° C. until removal of the selected transformant G recombinant vector was confirmed. The G recombinant vector was removed from the transformants by culturing. Specifically, the cells were plated on an ampicillin-added LB-agar plate and an LB-agar plate, respectively, and growth was confirmed in kanamycin-added medium, but strains that did not grow in ampicillin-added medium were selected.

In the case of colony PCR, considering that the efficiency of Taq polymerase amplifies DNA of 5 kb or more, about 1.0 to 1.5 kb is amplified from a region 100 bp upstream of the 5' homology arm region to the 5' vicinity of the inserted dhab1 gene. Primers were designed to confirm the insertion of the target gene, and specific information of the primers is shown in Table 5 below.

prime name Primer sequence (5'->3') sequence number poxB_For agtgtgcgcaccagatgc 32 poxB_Rev gtttgccgtccagttcgacga 33 nfrA_For cgctctccgttacgttgattaatcg 34 nfrA_Rev gtttgccgtccagttcgacga 35 mgsA_For gaaggcagaaaacgctgtcg 36 mgsA_Rev gtttgccgtccagttcgacga 37 ldhA_For caatgatcggcggttcgc 38 ldhA_Rev gtttgccgtccagttcgacga 39 yqhD_For cacgtcgagtaaccgc 40 yqhD_Rev gtttgccgtccagttcgacga 41 gldA_For ctgcgggcgatcagcatatg 42 gldA_Rev gtttgccgtccagttcgacga 43 glpK_For gctgtttgcctgtttcgacaagc 44 glpK_Rev gtttgccgtccagttcgacga 45

Comparative Example 1. Preparation of strain into which 3-HP production gene plasmid vector was inserted

In order to conduct experiments using the 3-HP production gene plasmid vector, the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector of Korean Patent Publication No. 10-2020-0051375 having a copy number of 20 to 30 was prepared, and the structure of the vector is shown in FIG. 4.

In addition, pRSFDuet-1 (Merck Millipore 71341) vector was treated with xbaI and bglII restriction enzymes (Thermo Scientific), and then purified with qiagen PCR purification kit to obtain a purified fragment of the vector. Then, PCR was performed on the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector using the primers in Table 6, and the xbaI and bglII restriction enzymes were treated and purified with qiagen PCR purification kit to obtain a purified fragment of the 3-HP production gene cassette recombinant vector. got it

prime name Primer sequence (5'->3') sequence number 3-HP_For ctagatttacagctagctcagtcc 46 3-HP_Rev tgccatattaataatcgatccctatctgc 47

The purified fragment of the pRSFDuet-1 vector obtained through the purification process was ligated with the purified fragment of the 3-HP production gene cassette recombinant vector with NEB T4 ligase (NEB M0202S) to prepare a 3-HP production gene plasmid vector. The structure of the vector is shown in FIG. 5 .

The pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector prepared above and the 3-HP production gene plasmid vector based on the pRSFDuet-1 vector were introduced into the DKALG strain of Example 2 by electroporation using an electroporation device (Eppendorf Eporator) to transform the pRSFDuet-1 vector A strain (3-HP_pRSF) into which the 3-HP production gene plasmid was inserted and a strain (3-HP_pCDF) into which the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector plasmid was inserted were prepared.

Example 3. Cell 2-step culture and 3-HP production

5 copy number (3-HP_5gD), 6 copy number (3-HP_6gD) and 7 copy number (3-HP_7gD) inserted into genomic DNA of the 3-HP production gene prepared in Example 2, respectively, and the comparative example The strain (3-HP_pCDF) into which the 3-HP production gene plasmid vector prepared in 1 was inserted at 20 to 30 copies (3-HP_pCDF) and the strain (3-HP_pRSF) into which the 3-HP production gene plasmid vector was inserted at 100 copies or more were used as carbon sources, such as glycerol Culture was carried out through a two-step culture method using a minimal medium containing only (M9_Gly).

The strain was inoculated in 50 mL of LB medium (growth medium) at 1% and grown at 37° C. and 200 rpm for 24 hours (first stage culture), and the whole cells were harvested by centrifugation and the supernatant was discarded. Thereafter, the collected whole cells were added to a minimal medium (M9_Gly; production medium) containing purified water, M9 minimal medium salt, glycerol, magnesium sulfate, and calcium chloride, and cultured at 200 rpm at 37 ° C for more than 24 hours (second step culture) to collect samples at regular intervals, and then confirm the production of 3-HP by HPLC.

The LB medium is a medium prepared by dissolving BD Difco Miller Luria-Bertani product in DW (distilled water) at a concentration of 25 g / L and autoclave sterilization at 121 ° C for 15 minutes, and the minimum medium (M9_Gly) is Disodium per 1 L of medium A medium containing phosphate 6g, Monopotassium phosphate 3g, Ammonium chloride 1g, Sodium chloride 0.5g, 1M CaCl ₂ 0.1ml, 1M MgSO ₄ 2ml, 5mM Vitamin B ₁₂ 0.1ml and Glycerol 20g. The HPCL measurement conditions are shown in Table 7 below.

Detector RI / UV detector Column Bio-Rad Aminex HPX-87H Ion Exclusion Column 300 mm×7.8 mm Mobile phase 0.5 mM H2SO4 Flow rate 0.4 mL/min Run time 35min Column temperature 35℃ Detector temperature 35℃ Injection volume 5 μL

Comparative Example 2. Strain culture and 3-HP production in the conventional way

Additionally, for comparison with the conventional method, the strain (3-HP_pCDF) into which the 3-HP production gene plasmid vector prepared in Comparative Example 1 was inserted at 20 to 30 copies and the 3-HP production gene plasmid vector at 100 copies Disodium phosphate 6g, Monopotassium phosphate 3g, Ammonium chloride 1g, Sodium chloride 0.5g, 1M CaCl2 0.1ml, 1M MgSO4 2ml, 5mM Vitamin B12 0.1ml, Glycerol 20g, It was cultured in minimal medium (M9_Glu) containing 5 g of Glucose and 0.1 ml of 5% Streptomycin.

Specifically, the strains (3-HP_pCDF and 3-HP_pRSF) were inoculated into the LB medium of Example 3 and cultured at 37 ° C. and 200 RPM for 24 hours, and then the saturated culture medium was added to the minimal medium (M9_Glu) with 1 ( After inoculation with v / v)% volume, culture was performed in which growth and production were performed simultaneously at 37 ° C and 200 RPM for 24 hours.

Example 4. 3-HP production measurement results according to the culture method

The cell concentration measured through the absorbance measurement measured in Example 3 and Comparative Example 2 and the 3-HP concentration measured in Example 3 and Comparative Example 2 are shown in Table 8 below.

Types of strains used Production medium used Cell Concentration (OD ₆₀₀ ) 3-HP concentration (g/L) 3-HP concentration / cell concentration (OD ₆₀₀ ) 3-HP_5gD M9_Gly 3.84 4.06 1.057 3-HP_6gD M9_Gly 3.78 4.9 1.296 3-HP_7gD M9_Gly 3.63 5.3 1.460 3-HP_pCDF M9_Glu 0.429 0.1967 0.459 3-HP_pRSF M9_Glu 0.477 0.1311 0.275 3-HP_pCDF M9_Gly 2.395 4.8790 2.037 3-HP_pRSF M9_Gly 2.978 0.8319 0.279

As a result, in the case of strains in which the 3-HP production gene was inserted into genomic DNA, a linear increase in 3-HP concentration was confirmed according to the increase in gene copy number, and through this, it was confirmed that the strain was appropriate for recombinant gene performance confirmation. .

However, in the case of the strain into which the plasmid vector was inserted, when comparing the 3-HP concentration produced by the 3-HP_pRSF strain with copy number of 100 or more and 3-HP_pCDF with copy number of 20 to 30, the 3-HP concentration according to copy number increase An increase could not be confirmed, and through this, it was confirmed that the strain was not suitable for confirming the performance of the recombinant gene.

Through this, it was confirmed that in order to confirm the performance of the recombinant gene, the target gene should be inserted into genomic DNA rather than inserted in the form of a plasmid vector.

<110> LG CHEM, LTD. <120> Method for confirming 3-HP production ability of 3-HP production gene using E. coli having 3-hydroxypropionic acid production ability inserted with 3-hydroxypropionic acid production gene <130> DPP20212280KR <160> 75 <170> koPatentIn 3.0 < 210> 1 <211> 4107 <212> DNA <213> Artificial Sequence <220> <223> Cas9 gene <400> 1 atggataaga aatactcaat aggcttagat atcggcacaa atagcgtcgg atgggcggtg 60 atcactgatg aatataaggt tccgtctaaa aagttcaagg ttctgggaaa tacagaccgc 120 cacagtatca aaaaaaatct tataggggct cttttatttg acagtggaga gacagcggaa 180 gcgactcgtc tcaaacggac agctcgtaga aggtatacac gtcggaagaa tcgtatttgt 240 tatctacagg agattttttc aaatgagatg gcgaaagtag atgatagttt ctttcatcga 300 cttgaagagt cttttttggt ggaagaagac aagaagcatg aacgtcatcc tatttttgga 360 aatatagtag atgaagttgc ttatcatgag aaatatccaa ctatctatca tctgcgaaaa 420 aaattggtag attctactga taaagcggat ttgcgcttaa tctatttggc cttagcgcat 480 atgattaagt ttcgtggtca ttttttgatt gagggagatt taaatcctga taatagtgat 540 gtggacaaac tatttatcca gttggtacaa acctacaatc aattatttga agaaaaccct 600 attaacgcaa gtggagtaga tgctaaagcg attctttctg cacgattgag taaatcaaga 660 cgattagaaa atctcattgc tcagctcccc ggtgagaaga aaaatggctt atttgggaat 720 ctcattgctt tgtcattggg tttgacccct aattttaaat caaattttga tttggcagaa 780 gatgctaaat tacagctttc aaaagatact tacgatgatg atttagataa tttattggcg 840 caaattggag atcaatatgc tgatttgttt ttggcagcta agaatttatc agatgctatt 900 ttactttcag atatcctaag agtaaatact gaaataacta aggctcccct atcagcttca 960 atgattaaac gctacgatga acatcatcaa gacttgactc ttttaaaagc tttagttcga 1020 caacaacttc cagaaaagta taaagaaatc ttttttgatc aatcaaaaaa cggatatgca 1080 ggttatattg atgggggagc tagccaagaa gaattttata aatttatcaa accaatttta 1140 gaaaaaatgg atggtactga ggaattattg gtgaaactaa atcgtgaaga tttgctgcgc 1200 aagcaacgga cctttgacaa cggctctatt ccccatcaaa ttcacttggg tgagctgcat 1260 gctattttga gaagacaaga agacttttat ccatttttaa aagacaatcg tgagaagatt 1320 gaaaaaatct tgacttttcg aattccttat tatgttggtc cattggcgcg tggcaatagt 1380 cgttttgcat ggatgactcg gaagtctgaa gaaacaatta ccccatggaa ttttgaagaa 1440 gttgtcgata aaggtgcttc agctcaatca tttattgaac gcatgacaaa ctttgataaa 1500 aatcttccaa atgaaaaagt actaccaaaa catagtttgc tttatgagta ttttacggtt 1560 tataacgaat tgacaaaggt caaatatgtt actgaaggaa tgcgaaaacc agcatttctt 1620 tcaggtgaac agaagaaagc cattgttgat ttactcttca aaacaaatcg aaaagtaacc 1680 gttaagcaat taaaagaaga ttatttcaaa aaaatagaat gttttgatag tgttgaaatt 1740 tcaggagttg aagatagatt taatgcttca ttaggtacct accatgattt gctaaaaatt 1800 attaaagata aagatttttt ggataatgaa gaaaatgaag atatcttaga ggatattgtt 1860 ttaacattga ccttatttga agatagggag atgattgagg aaagacttaa aacatatgct 1920 cacctctttg atgataaggt gatgaaacag cttaaacgtc gccgttatac tggttgggga 1980 cgtttgtctc gaaaattgat taatggtatt agggataagc aatctggcaa aacaatatta 2040 gattttttga aatcagatgg ttttgccaat cgcaatttta tgcagctgat ccatgatgat 2100 agtttgacat ttaaagaaga cattcaaaaa gcacaagtgt ctggacaagg cgatagttta 2160 catgaacata ttgcaaattt agctggtagc cctgctatta aaaaaggtat tttacagact 2220 gtaaaagttg ttgatgaatt ggtcaaagta atggggcggc ataagccaga aaatatcgtt 2280 attgaaatgg cacgtgaaaa tcagacaact caaaagggcc agaaaaattc gcgagagcgt 2340 atgaaacgaa tcgaagaagg tatcaaagaa ttaggaagtc agattcttaa agagcatcct 2400 gttgaaaata ctcaattgca aaatgaaaag ctctatctct attatctcca aaatggaaga 2460 gacatgtatg tggaccaaga attagatatt aatcgtttaa gtgattatga tgtcgatcac 2520 attgttccac aaagtttcct taaagacgat tcaatagaca ataaggtctt aacgcgttct 2580 gataaaaatc gtggtaaatc ggataacgtt ccaagtgaag aagtagtcaa aaagatgaaa 2640 aactattgga gacaacttct aaacgccaag ttaatcactc aacgtaagtt tgataattta 2700 acgaaagctg aacgtggagg tttgagtgaa cttgataaag ctggttttat caaacgccaa 2760 ttggttgaaa ctcgccaaat cactaagcat gtggcacaaa ttttggatag tcgcatgaat 2820 actaaatacg atgaaaatga taaacttatt cgagaggtta aagtgattac cttaaaatct 2880 aaattagttt ctgacttccg aaaagatttc caattctata aagtacgtga gattaacaat 2940 taccatcatg cccatgatgc gtatctaaat gccgtcgttg gaactgcttt gattaagaaa 3000 tatccaaaac ttgaatcgga gtttgtctat ggtgattata aagtttatga tgttcgtaaa 3060 atgattgcta agtctgagca agaaataggc aaagcaaccg caaaatattt cttttactct 3120 aatatcatga acttcttcaa aacagaaatt acacttgcaa atggagagat tcgcaaacgc 3180 cctctaatcg aaactaatgg ggaaactgga gaaattgtct gggataaagg gcgagatttt 3240 gccacagtgc gcaaagtatt gtccatgccc caagtcaata ttgtcaagaa aacagaagta 3300 cagacaggcg gattctccaa ggagtcaatt ttaccaaaaa gaaattcgga caagcttatt 3360 gctcgtaaaa aagactggga tccaaaaaaa tatggtggtt ttgatagtcc aacggtagct 3420 tattcagtcc tagtggttgc taaggtggaa aaagggaaat cgaagaagtt aaaatccgtt 3480 aaagagttac tagggatcac aattatggaa agaagttcct ttgaaaaaaa tccgattgac 3540 tttttagaag ctaaaggata taaggaagtt aaaaaagact taatcattaa actacctaaa 3600 tatagtcttt ttgagttaga aaacggtcgt aaacggatgc tggctagtgc cggagaatta 3660 caaaaaggaa atgagctggc tctgccaagc aaatatgtga attttttata tttagctagt 3720 cattatgaaa agttgaaggg tagtccagaa gataacgaac aaaaacaatt gtttgtggag 3780 cagcataagc attatttaga tgagattatt gagcaaatca gtgaattttc taagcgtgtt 3840 attttagcag atgccaattt agataaagtt cttagtgcat ataacaaaca tagagacaaa 3900 ccaatacgtg aacaagcaga aaatattatt catttattta cgttgacgaa tcttggagct 3960 cccgctgctt ttaaatattt tgatacaaca attgatcgta aacgatatac gtctacaaaa 4020 gaagttttag atgccactct tatccatcaa tccatcactg gtctttatga aacacgcatt 4080 gatttgagtc agctaggagg tgactga 4107 <210> 2 <211> 1885 <212> DNA <213> Artificial Sequence <220> <223> RED recomgbinase gene <400> 2 atggatatta atactgaaac tgagatcaag caaaagcatt cactaacccc ctttcctgtt 60 ttcctaatca gcccggcatt tcgcgggcga tattttcaca gctatttcag gagttcagcc 120 atgaacgctt attacattca ggatcgtctt gaggctcaga gctgggcgcg tcactaccag 180 cagctcgccc gtgaagagaa agaggcagaa ctggcagacg acatggaaaa aggcctgccc 240 cagcacctgt ttgaatcgct atgcatcgat catttgcaac gccacggggc cagcaaaaaa 300 tccattaccc gtgcgtttga tgacgatgtt gagtttcagg agcgcatggc agaacacatc 360 cggtacatgg ttgaaaccat tgctcaccac caggttgata ttgattcaga ggtataaaac 420 gaatgagtac tgcactcgca acgctggctg ggaagctggc tgaacgtgtc ggcatggatt 480 ctgtcgaccc acaggaactg atcaccactc ttcgccagac ggcatttaaa ggtgatgcca 540 gcgatgcgca gttcatcgca ttactgatcg ttgccaacca gtacggcctt aatccgtgga 600 cgaaagaaat ttacgccttt cctgataagc agaatggcat cgttccggtg gtgggcgttg 660 atggctggtc ccgcatcatc aatgaaaacc agcagtttga tggcatggac tttgagcagg 720 acaatgaatc ctgtacatgc cggatttacc gcaaggaccg taatcatccg atctgcgtta 780 ccgaatggat ggatgaatgc cgccgcgaac cattcaaaac tcgcgaaggc agagaaatca 840 cggggccgtg gcagtcgcat cccaaacgga tgttacgtca taaagccatg attcagtgtg 900 cccgtctggc cttcggattt gctggtatct atgacaagga tgaagccgag cgcattgtcg 960 aaaatactgc atacactgca gaacgtcagc cggaacgcga catcactccg gttaacgatg 1020 aaaccatgca ggagattaac actctgctga tcgccctgga taaaacatgg gatgacgact 1080 tattgccgct ctgttcccag atatttcgcc gcgacattcg tgcatcgtca gaactgacac 1140 aggccgaagc agtaaaagct cttggattcc tgaaacagaa agccgcagag cagaaggtgg 1200 cagcatgaca ccggacatta tcctgcagcg taccgggatc gatgtgagag ctgtcgaaca 1260 gggggatgat gcgtggcaca aattacggct cggcgtcatc accgcttcag aagttcacaa 1320 cgtgatagca aaaccccgct ccggaaagaa gtggcctgac atgaaaatgt cctacttcca 1380 caccctgctt gctgaggttt gcaccggtgt ggctccggaa gttaacgcta aagcactggc 1440 ctggggaaaa cagtacgaga acgacgccag aaccctgttt gaattcactt ccggcgtgaa 1500 tgttactgaa tccccgatca tctatcgcga cgaaagtatg cgtaccgcct gctctcccga 1560 tggtttatgc agtgacggca acggccttga actgaaatgc ccgtttacct cccgggattt 1620 catgaagttc cggctcggtg gtttcgaggc cataaagtca gcttacatgg cccaggtgca 1680 gtacagcatg tgggtgacgc gaaaaaatgc ctggtacttt gccaactatg acccgcgtat 1740 gaagcgtgaa ggcctgcatt atgtcgtgat tgagcgggat gaaaagtaca tggcgagttt 1800 tgacgagatc gtgccggagt tcatcgaaaa aatggacgag gcactggctg aaattggttt 1860 tgtatttggg gagcaatggc gatga 1885 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ldhA <400> 3 gcacgttgtg gcaggcagac 20 <210> 4 <210> 4 > DNA <213> Artificial Sequence <220> <223> ldhA <400> 4 taacgtctga ttcagagaac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ldhA <400> 5 aacgtctgat tcagagaaca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> yqhD <400> 6 actttcctgc tggcggttgg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> yqhD <400> 7 caccaaattt atcgccgcag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> glpK <400> 8 attgtctggg aaaaagaaac 20 <210> 9 < 211> 20 <212> DNA <213> Artificial Sequence <220> <223> glpK <400> 9 cgtcgttctt ccgaagtata 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gldA <400> 10 atcgcggaga ctgcgcagtg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gldA <400> 11 cctcgatact gccaaagcac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mgsA <400> 12 cgagataacg ctgataatcg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mgsA <400> 13 cgcagcaagg ctttcacgtc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> poxB <400> 14 cagtgcatgg ttgccccttc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220 > <223> poxB <400> 15 gtacttgtgg gatctgctcc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> nfrA <400> 16 cgcatgcagc caccagtaga 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> nfrA <400> 17 ccagtcgcgc cattaaagtc 20 <210> 18 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> ldhA_upstream <400 > 18 ggcgattggg atgtgtgcat tacccaacgg caaacgctgt agcgaacagt cacttgccgc 60 cgggagctgt ggcagctatt aattcattaa atccgccagc ttataagtta atgtctgttt 120 tgcggtcgcc agcgttaact ggttcgcggt cagatccact tgtgcacctt ctttcagcat 180 ttcgctaatg gtgttatcga gttcattaag ctgcgggtta gcgcacatca tacgggtcat 240 tgccagccct ttggc 255 <210> 19 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> ldhA_downstream <400> 19 tactagcgca gcttaagctc aaagccaaag gactcgttca cctgttgcag gtacttcttg 60 tcgtactgtt ttgtgctata aacggcgagt ttcataagac tttctccagt gatgttgaat 120 cacatttaag ctactaaaaa tattttacaa aatttcaaat ttaattgaaa gctatggcga 180 tattgaaaaa ttcatcaaca actatgctta gtgtaggcgc aaccttcaac tgaacggtta 240 aacatgccac aatac 255 <210> 20 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> yqhD_upstream <400> 20 ggcggagtta atcccgctgg ctgccatcga cggctggaaa tgctcatctt cgccaatgtc 60 catcaacagt tcctgtaact gcaaaatatc gacattgaga cgcaaccctg ccagcggcac 120 ctctgacgtg gcataggttt cgcactcaaa cggcaacggc accgtcagca gcaggtattc 180 attggcatca taacgaaaca cgcgttcatt gatataaccg attttatgcc cggaaaagag 240 aattatgatg ccagg 255 <210> 21 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> yqhD_downstream <400> 21 tactagcgca gcttagaaca gtatgttacc aaaccggttg atgccaaaat tcaggaccgt 60 ttcgcagaag gcattttgct gacgctaatc gaagatggtc cgaaagccct gaaagagcca 120 gaaaactacg atgtgcgcgc caacgtcatg tgggcggcga ctcaggcgct gaacggtttg 180 attggcgctg gcgtaccgca ggactgggca acgcatatgc tgggccacga actgactgcg 240 atgcacggtc tggat 255 <210> 22 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> glpK_upstream <400> 22 ccgggttgtt gattttcttc ggtgtgggtt gcgttgcagc actaaaagtc gctggtgcgt 60 cttttggtca gtgggaaatc agtgtcattt ggggactggg ggtggcaatg gccatctacc 120 tgaccgcagg ggtttccggc gcgcatctta atcccgctgt taccattgca ttgtggctgt 180 ttgcctgttt cgacaagcgc aaagttattc cttttatcgt ttcacaagtt gccggcgctt 240 tctgtgctgc ggctt 255 <210> 23 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> glpK_downstream <400> 23 tactagcgca gcttaaccta tggcactggc tgctttatgc tgatgaacac tggcgagaaa 60 gcggtgaaat cagaaaacgg cctgctgacc accatcgcct gcggcccgac tggcgaagtg 120 aactatgcgt tggaaggtgc ggtgtttatg gcaggcgcat ccattcagtg gctgcgcgat 180 gaaatgaagt tgattaacga cgcctacgat tccgaatatt tcgccaccaa agtgcaaaac 240 accaatggtg tgtat 255 <210> 24 <211> 255 <212> DNA <213> Artificial Sequence <220> <223 > gldA_upstream <400> 24 catgcacgaa gaattccgta acgcgctggt taacgccgcc tctgccgacg ctatcgccag 60 cctgctgcaa catgaactgg aactgtaaaa ggaaacatca tggaactgta tctggacacc 120 gctaacgtcg cagaagtcga acgtctggca cgcatattcc ccattgccgg ggtgacaact 180 aacccgagca ttatcgctgc cagcaaggag tccatatggg aagtgctgcc gcgtctgcaa 240 aaagcgattg gtgat 255 <210> 25 <211> 255 <212> DNA < 213> Artificial Sequence <220> <223> gldA_downstream <400> 25 tactagcgca gcttagaagc ggcatgtgca gaaggtgaaa ccattcacaa catgcctggc 60 ggcgcgacgc cagatcaggt ttacgccgct ctgctggtag ccgaccagta cggtcagcgt 120 ttcctgcaag agtgggaata acctactcca aactcccggc ttgtccggga gtttgaacgc 180 aaaattgcct gatgcgctac gcttatcagg cctacgcaat ctctgcaata tattgaattt 240 gcgtgctttt gtagg 255 <210> 26 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> mgsA_upstream <400> 26 gattgtgatt ctggagaaag gtcgctttat cagcccgtgg aagcatattc tggttgatga 60 atttcaggat atctcgccgc agcgggcagc gttgttagcg gcattacgca agcaaaacag 120 tcagacgacg ttgttcgctg ttggtgatga ctggcaggcg atttaccgat tcagcggtgc 180 gcaaatgtcg ctcaccaccg ctttccatga aaactttggt gaaggcgaac gctgtgattt 240 agacacgact taccg 255 <210> 27 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> mgsA_downstream <400> 27 tactagcgca gcttatccgc gcaggtaaag tgcgagtcgt cagttccata atgtacatcc 60 gtagttaact ttcctacaga ttactgtaag cacttatcgc tgcaagataa agaccgaaaa 120 agcctgcgca caggcacaaa aatctcagga agatggttgt ttttccgccc actgcaggaa 180 agtatttcgc gtttgtgggt cagccagttt aaaccaatac ttcagccgtt gttctgtgag 240 cacctgagac tgcgg 255 <210> 28 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> poxB_upstream <400> 28 ttaccttagc cagtttgttt tcgccagttc gatcacttca tcaccgcgtc cgctgatgat 60 tgcgcgcagc atatacaggc tgaaaccttt ggcctgttcg agtttgatct gcggtggaat 120 ggctaactct tctttggcga ccaccacatc caccaacacc ggaccgtcga tggagaaggc 180 gcgttgcagg gcttcatcaa cttcagacgc tttttctaca cggatacccg taatgccgca 240 cgcttcggca atgcg 255 <210> 29 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> poxB_downstream <400> 29 tactagcgca gcttaagctc gcaatagtga ctacattcgc ggaatagctc ttgtgggtgg 60 gtttcctgga aatagccgct gccaatttcg ctggagggaa tatgagcggc aatcgccagt 120 accggaacgt gattgcggtg gcaatcgaac aggccgttga ttaagtgcag gttgccgggg 180 ccgcacgatc cggcgcagac cgccagttct ccgctaagtt gtgcttcagc gccagcggca 240 aaggccgcca cttct 255 <210> 30 <211> 255 <212> DNA <213> Artificial Sequence < 220> <223> nfrA_upstream <400> 30 tgtgcggcca ggcgtcgtag tgcgtctcgc cggtccagat attccagcgg accccgactc 60 cgccaagctg cgcgccctga gtgcctttat cacgatagcc gttgtcctga acgtgagcgt 120 aaggctcaat agtctgtccg ttagctacct tctgatgcca gctgacgcga taatctgccg 180 tccacgcctg aatatcctgg cggatatatt gcgccgcatc gaggtacagg ttttgggcaa 240 accagcctga accgt 255 <210> 31 <211> 255 < 212> DNA <213> Artificial Sequence <220> <223> nfrA_downstream <400> 31 tactagcgca gcttaggcga gcagtttttg cgctgcgtcg tactgacctt cttttaacag 60 caccggtagc gtcgcgccaa caacatactg gcggttgtcg gcaaactgta ccgtataatt 120 cgccaacgcc tgaacggggt tagcgctgta tttagataac agatagagcc aacttttctc 180 ttgtgcgtcc gtggtaaata gtggcttatt ttcaatgaga taatgctgga ggcgtgcttt 240 ttcgccacga taagc 255 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> poxB_For <400> 32 agtgtgcgca ccagatgc 18 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220 > <223> poxB_Rev <400> 33 gtttgccgtc cagttcgacg a 21 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> nfrA_For <400> 34 cgctctccgt tacgttgatt aatcg 25 <210> 35 < 211> 21 <212> DNA <213> Artificial Sequence <220> <223> nfrA_Rev <400> 35 gtttgccgtc cagttcgacg a 21 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mgsA_For <400> 36 gaaggcagaa aacgctgtcg 20 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mgsA_Rev <400> 37 gtttgccgtc cagttcgacg a 21 <210> 38 <211> 18 <212 > DNA <213> Artificial Sequence <220> <223> ldhA_For <400> 38 caatgatcgg cggttcgc 18 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ldhA_Rev <400> 39 gtttgccgtc cagttcgacg a 21 <210> 40 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> yqhD_For <400> 40 cacgtcgagt aaccgc 16 <210> 41 <211> 21 <212> DNA Artificial Sequence <220> <223> yqhD_Rev <400> 41 gtttgccgtc cagttcgacg a 21 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gldA_For <400> 42 ctgcgggcga tcagcatatg 20 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> gldA_Rev <400> 43 gtttgccgtc cagttcgacg a 21 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> < 223> glpK_For <400> 44 gctgtttgcc tgtttcgaca agc 23 <210> 45 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> glpK_Rev <400> 45 gtttgccgtc cagttcgacg a 21 <210> 46 <211> 24 <212> DNA <213 > Artificial Sequence <220> <223> 3-HP_For <400> 46 ctagatttac agctagctca gtcc 24 <210> 47 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 3-HP_Rev <400> 47 tgccatatta ataatcgatc cctatctgc 29 <210> 48 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> ldhA_upstream_For <400> 48 actgaaccgc tctaggcgat tgggatgtgt gcattacc 38 <210> 49 <21 212> DNA <213> Artificial Sequence <220> <223> ldhA_upstream_Rev <400> 49 tagctgtaaa tctagatctc tctgcactgc ccgc 34 <210> 50 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> ldhA_downstream_For <400 > 50 tactagcgca gcttaagctc aaagccaaag gactcg 36 <210> 51 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> ldhA_downstream_Rev <400> 51 cagcagccta ggttaacgat caattgcccg ctattttcc 39 <342> 52 <342> 52 <210> > DNA <213> Artificial Sequence <220> <223> yqhD_upstream_For <400> 52 actgaaccgc tctagggcgg agttaatccc gctg 34 <210> 53 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> yqhD_upstream_Rev <400> 53 tagctgtaaa tctagcactt tctgttcgcg aaccagtttc 40 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> yqhD_downstream_For <400> 54 tactagcgca gcttagaaca gtatgttacc aaaccggttg 11 5 211> aaaccggttg 40 <211> DNA <213> Artificial Sequence <220> <223> yqhD_downstream_Rev <400> 55 cagcagccta ggttaagggc tttgccgaca cct 33 <210> 56 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> glpK_upstream_For <400> 56 tactagcgca gcttaaccta tggcactggc tgct 34 <210> 57 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> glpK_upstream_Rev <400> 57 tagctgtaaa tctaggtcat attacagcga agctttttgt 40 <210> 23 <211> DNA <213> Artificial Sequence <220> <223> glpK_downstream_For <400> 58 tactagcgca gcttaaagcg tttatgccgc atccg 35 <210> 59 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> glpK_downstream_Rev <400> 59 cagcagccta ggttatcttc gttgtcgcct ttgacg 36 <210> 60 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> gldA_upstream_For <400> 60 actgaaccgc tctagcatgc acgaagaatt ccgtaac 37 <210> 61 <211> 39 <212> DNA 213> Artificial Sequence <220> <223> gldA_upstream_Rev <400> 61 tagctgtaaa tctagaaacc taaaacaaat ttgtcaccc 39 <210> 62 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> gldA_downstream_For <400> 6 gtacttagcagc2 ggcatgtgca gaagg 35 <210> 63 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> gldA_downstream_Rev <400> 63 cagcagccta ggttatctga aaccacccca atatgtgc 38 <210> 64 <211> 40 <212> DNA <213 > Artificial Sequence <220> <223> mgsA_upstream_For <400> 64 actgaaccgc tctaggattg tgattctgga gaaaggtcgc 40 <210> 65 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> mgsA_upstream_Rev <400> 65 c tagctctgtaggaa aatattgc 38 <210> 66 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> mgsA_downstream_For <400> 66 tactagcgca gcttatccgc gcaggtaaag tgc 33 <210> 67 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> mgsA_downstream_Rev <400> 67 cagcagccta ggttacgaat gaatgagagc aaaagcggg 39 <210> 68 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> poxB_upstream_For <400> 68 35 <210> 69 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> poxB_upstream_Rev <400> 69 tagctgtaaa tctagacaac agcgtgctgg gct 33 <210> 70 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> poxB_downstream_For <400> 70 tactagcgca gcttaagctc gcaatagtga ctacattcgc 40 <210> 71 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> poxB_downstream_Rev <400> 71 cagcagccta tgggattacgt3cta <210> 72 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> nfrA_upstream_For <400> 72 actgaaccgc tctagtgtgc ggccaggcgt cgtagtgc 38 <210> 73 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> nfrA_upstream_Rev <400> 73 tagctgtaaa tctaggggct tccggacgat ccg 33 <210> 74 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> nfrA_downstream_For <400> 74 tactagcgca gcttaggctgat gcagt < 210> 75 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> nfrA_downstream_Rev<400> 75 cagcagccta ggttaacaga aaaataacga cgaagcaacc 40

Claims (10)

A foreign 3-hydroxypropionate (3-HP) producing gene is inserted into genomic DNA of 1 copy or more and culturing E. coli having 3-HP production ability , Method for confirming the 3-HP production ability of the 3-HP production gene inserted into the E. coli genomic DNA. According to claim 1, wherein the 3HP production gene is a group consisting of glycerol dehydratase, aldehyde dehydrogenase, glycerol dehydratase reactivase and adenosyltransferase (adenosyltransferase) 3-HP production ability confirmation method of the 3-HP production gene inserted into the E. coli genomic DNA, including the gene of one or more enzymes selected from. The method of claim 1, wherein in the culturing step, culturing E. coli in which a gene selected from the group consisting of yqhD, glpK, ldhA, ack-pta, and gldA among the genes of E. coli is deleted, the 3 inserted into the E. coli genomic DNA -How to confirm the 3-HP production ability of the HP production gene. The E. coli genome according to claim 1, wherein the 3-HP production gene is inserted where one or more genes selected from the group consisting of ldhA, gldA, glpK, yqhD, mgsA, poxB, and nfrA genes of the E. coli are located. Method for confirming 3-HP production ability of 3-HP production gene inserted into DNA. The method of claim 1, wherein the 3-HP production gene is inserted into the genomic DNA by the CRISPR-Cas9 system. The method according to any one of claims 1 to 5, further comprising the step of measuring the amount of 3-HP produced by the E. coli, the 3-HP production gene inserted into the E. coli genomic DNA How to check HP productivity. The method of claim 6, wherein in the step of measuring the amount of 3-HP produced, whether the 3-HP production produced by the E. coli is proportional to the copy number of the 3-HP production gene inserted into the E. coli genomic DNA To confirm, to confirm the 3-HP production capacity, a method for confirming the 3-HP production capacity of the 3-HP production gene inserted into the E. coli genomic DNA. The method according to any one of claims 1 to 5, which does not include the step of administering an antibiotic, to confirm the 3-HP production ability of the 3-HP producing gene inserted into the genomic DNA of the E. coli. The method of any one of claims 1 to 5, wherein the culturing step,
A first step of culturing in a medium containing glucose or sucrose as a carbon source; and
The second step of culturing in a medium containing glycerol as a carbon source
A method for confirming the 3-HP production ability of the 3-HP production gene inserted into the E. coli genomic DNA comprising a. 10. The method of claim 9, wherein the culture medium of the second step does not contain glucose or sucrose as a carbon source.

Images