KR20240054470A - Molecular markers for discriminating seed perilla cultivars and uses thereof - Google Patents

Abstract

The present invention relates to molecular markers for identifying perilla seed varieties and their uses.
The marker of the present invention can identify seed perilla varieties, so it can be used to differentiate seed perilla breeding varieties through quality control such as preventing hybridization between varieties, and can further be used to protect the genetic resources of seed perilla varieties.

Description

Molecular markers for discriminating seed perilla cultivars and uses thereof}

The present invention relates to molecular markers for identifying perilla seed varieties and their use.

Perilla frutescens ( Perilla frutescens var. frutescens ) is an annual herb belonging to the Lamiaceae family and is a gyptic and monoecious crop. Perilla seeds are consumed mainly in East Asia, such as Korea and China, as an oil crop whose oil is obtained by extracting the seeds or leaves. In Korea, the seeds or leaves of perilla seeds are also used as food ingredients.

Perilla seeds contain about 44% lipids, of which α-linolenic acid, which is an omega-3 fatty acid and is known to prevent various diseases such as cardiovascular disease, high blood pressure, inflammation, depression, and certain nervous system dysfunction, accounts for more than 60%. . In addition, perilla seeds are reported to not only contain a large amount of unsaturated fatty acids but also to be rich in phenolic compounds.

Accordingly, there is a need to cultivate various perilla seed varieties and secure their protection and rights.

In particular, the perilla varieties grown domestically are divided into perilla seeds for seed use (perilla seeds) and perilla seeds only for leaves (perilla perilla). The mixing of perilla varieties causes a decline in perilla quality due to differences in quality characteristics, so to prevent this, There has been a demand for the development of technology to distinguish and identify perilla seed varieties.

In this regard, Korean Patent No. 2261756 discloses a biomarker composition for distinguishing domestic and Chinese perilla seeds and a method for distinguishing domestic and Chinese perilla seeds using the same, but molecular markers that can efficiently distinguish seed perilla varieties have not yet been developed. It's not working.

Under this background, the present inventors made extensive research efforts to prevent hybridization of seed perilla varieties and completed the present invention by selecting KASP (Kompetitive Allele Specific PCR) markers that can identify seed perilla varieties.

One object of the present invention is one or more consecutive oligonucleotides selected from the base sequences of SEQ ID NO: 1 to SEQ ID NO: 18; Any one or more oligonucleotides selected from the group consisting of their complementary oligonucleotides; and combinations thereof; to provide a composition for determining perilla seed varieties, including a primer set containing at least one selected from the group consisting of.

Another object of the present invention is (a) performing PCR using the primer set using DNA isolated from a sample as a template; and (b) analyzing the amplified PCR product obtained in step (a).

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

One aspect of the present invention is one or more consecutive oligonucleotides selected from the base sequences of SEQ ID NO: 1 to SEQ ID NO: 18; Any one or more oligonucleotides selected from the group consisting of their complementary oligonucleotides; It provides a composition for determining perilla seed varieties, comprising a primer set containing at least one selected from the group consisting of; and combinations thereof.

In the present invention, the term " Perilla frutescens var. frutescens " is an annual herb belonging to the Lamiaceae family and is a gyptic and monoecious crop. Perilla seeds are consumed mainly in East Asia, such as Korea and China, as an oil crop whose oil is obtained by extracting the seeds or leaves. In Korea, the seeds or leaves of perilla seeds are also used as food ingredients. Perilla varieties grown in Korea are divided into perilla seeds for seeds (perilla seeds) and perilla seeds for leaves (perilla leaves).

In the present invention, the term "seed perilla" refers to a perilla variety whose seeds are mainly consumed.

In the present invention, the term "oligonucleotide" refers to a DNA or RNA strand of a certain length or more, which is a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds. The oligonucleotide may be used interchangeably with polynucleotide.

In the present invention, the term “primer” refers to a nucleic acid sequence having a short free 3' terminal hydroxyl group, which can form a base pair with a complementary template and allows copying of the template. The length and sequence of the primer must allow for initiation of synthesis of the extension product, and the specific length and sequence of the primer must determine the complexity of the required DNA or RNA target. complexity), as well as usage conditions such as temperature and ionic strength. For example, the specific length and sequence of the primer will depend on the content of guanine and cytosine (GC contents), GC arrangement, annealing temperature, and ionic strength. Primers must be determined by considering several conditions for DNA synthesis in the presence of four different nucleoside triphosphates (dNTPs) and reagents for the polymerization reaction (i.e., DNA polymerase or reverse transcriptase) at an appropriate buffer solution and temperature. can be initiated.

Oligonucleotides used as primers in the present invention may include nucleotide analogues, specific examples of which include phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or intercalating substances. agent), etc.

Additionally, the primers may be modified, such as methylation, capping, substitution of nucleotides or modifications between nucleotides, such as uncharged linkages (e.g. methyl phosphonate, phosphotriester, phosphoroamidate). , carbamate, etc.) or a charged linker (e.g., phosphorothioate, phosphorodithioate, etc.).

The primer set of the present invention may specifically include oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 18.

The primer set is

i) forward primer of SEQ ID NO: 3n-2;

ii) forward primer of SEQ ID NO: 3n-1; and

iii) reverse primer of SEQ ID NO: 3n; comprising a primer set consisting of,

The n is a natural number from 1 to 6, n in i) and ii) has the same value, and may be composed of 6 types of primer sets, each having 3 sequences.

As an example, the primer set includes a primer set consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; A primer set consisting of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9; A primer set consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; A primer set consisting of SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15; And/or a primer set consisting of SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18.

Meanwhile, any primer that can amplify the same region as the above-described primer set and has the same function can be included in the scope of the present invention.

In addition, it may include, but is limited to, one or more, two or more, three or more, four or more, five or more, or six types of primer sets consisting of SEQ ID NOs: 1 to 18. That is not the case.

In one embodiment, the primer set includes oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 18; Or, it may include an oligonucleotide complementary to the oligonucleotide.

The primer set of the present invention can be used for amplification of target sequences, and in particular, can be used for amplification of single nucleotide polymorphism (SNP) sequences for identification of seed perilla varieties. Specifically, the primer set may be a primer set capable of detecting or amplifying a SNP marker of seed perilla genomic DNA.

In the present invention, the term “single nucleotide polymorphism (SNP) marker” refers to a nucleotide variation that indicates variation between individuals or breeds among the nucleotide sequences of a chromosome. Specifically, it may mean a difference in one base pair among a specific base sequence. The SNP marker produces primers based on information on one or more base pair regions that are different from the base sequence of the standard genome through a method of comparative analysis of the genome information of the standard genome and the variety used in the experiment.

The “marker” refers to a base sequence used as a reference point when identifying genetically unspecified related loci.

The term “standard genome” refers to the genome of a crop variety that serves as a standard for determining the variety of the present invention.

The term “genetic locus” refers to the location of a molecular marker on a genetic map.

Specifically, among the primer sets of the present invention, a primer set consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; A primer set consisting of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9; A primer set consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; A primer set consisting of SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15; and/or a primer set consisting of SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18; may be a primer set capable of detecting or amplifying a SNP marker.

The primer set of the present invention can identify one or more varieties selected from the group consisting of Dayu, Deulsaem, Sodam, Deulhyang, Deulchan, Daesil, Anyu, Baekjin, Dami, and Neuulsaemi.

In addition, the primer set of the present invention can simultaneously discriminate one or more varieties selected from the group consisting of Dayu, Deulsaem, Sodam, Deulhyang, Deulchan, Daesil, Anyu, Baekjin, Dami, and Neuulsaemi.

In one embodiment of the present invention, as a result of polymorphism analysis after performing PCR on 10 varieties of perilla seeds using the 6 primer sets selected in the present invention, it was confirmed that the 10 varieties of perilla seeds described above could be identified. (Figures 1 to 6).

Another aspect of the present invention provides a kit for identifying perilla seed varieties, including the primer set of the present invention.

The terms used here are the same as described above.

The kit of the present invention is not limited thereto, but may be a PCR kit or a DNA analysis (eg, DNA chip) kit.

The kit of the present invention can be used to identify or distinguish perilla seed varieties by amplifying and confirming the SNP sequence of perilla seed genomic DNA using the composition of the present invention. As a specific example, the kit provided by the present invention may be a kit containing essential elements necessary to perform PCR.

For example, a PCR kit may, in addition to the set of primers described in the previous embodiment, contain test tubes, other suitable containers, reaction buffers (of varying pH and magnesium concentration), deoxynucleotides (dNTPs), various enzymes (Taq-polymerase, etc. ), DNase, RNAse inhibitor, DEPC-water, sterilized water, etc. As another example, the kit of the present invention may be a DNA chip kit for identifying perilla seed varieties that includes the essential elements necessary to perform DNA chip processing.

The term "DNA chip" in the present invention refers to a DNA microarray that can identify each base of hundreds of thousands of DNA at once.

The DNA chip kit generally attaches nucleic acid species in a gridded array to a flat solid support plate, typically a glass surface no larger than a microscope slide. Nucleic acids are arranged uniformly on the chip surface, and DNA It can be a tool that enables massively parallel analysis by causing multiple hybridization reactions between the nucleic acid on the chip and the complementary nucleic acid contained in the solution treated on the chip surface.

Another aspect of the present invention includes the steps of (a) performing PCR using the primer set of the present invention using DNA isolated from a sample as a template; and (b) analyzing the amplified PCR product obtained in step (a).

The terms used here are the same as described above.

In step (a), PCR may be performed using the DNA isolated from the sample as a template, using the composition for determining perilla seed varieties of the present invention or the kit for determining perilla seed varieties of the present invention. The composition for determining perilla seed varieties of the present invention or the kit for determining perilla seed varieties of the present invention is the same as described above in the previous aspect.

Step (a) may further include obtaining genomic DNA using a sample isolated from a perilla seed plant individual or seed, and the sample is not particularly limited thereto, but may include, for example, seeds, isolated tissue, etc. Or it may be an isolated cell.

Step (a) may be performed by polymerase chain reaction (PCR) using the primer set of the present invention. The primer set of the present invention is the same as described above in the previous aspect.

Additionally, the PCR performance step of step (a) can be performed using any method known to those skilled in the art. Specifically, the DNA used as a template may be DNA isolated from each individual perilla seed plant or seed, or may be DNA isolated from a mixed material containing two or more perilla seed plants or seeds.

Step (b) may be analyzing the amplified PCR product obtained in step (a).

The amplified PCR product can be analyzed using any method known to those skilled in the art. Specifically, the sequence of the DNA marker amplified in step (a) can be determined to determine whether the desired DNA marker has been detected. Specific methods may include, but are not limited to, DNA chips, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.

Additionally, in order to more effectively recognize the PCR product amplified using the primer set of the present invention, the 5' or 3' end of the primer may be labeled with a fluorescent substance, etc. At this time, the fluorescent material used is not particularly limited, but is FAM (6-carboxyfluorescein), HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), NED ^TM etc. can be used. However, due to the clear size difference between the amplified PCR products in the specific primer set of the present invention, they can be clearly distinguished by band size on the gel without any special fluorescent label.

The marker of the present invention can identify perilla seed varieties, and can differentiate between perilla seed cultivars through quality control such as preventing hybridization between varieties. It is possible to identify 10 varieties simultaneously, and furthermore, the genes of perilla seed varieties can be identified. It can be used for circle protection.

Figure 1 shows the results of a PCR test using the KASP marker peril_KASP_30 for 10 perilla seed varieties.
Figure 2 shows the results of a PCR test using the KASP marker peril_KASP_27 for 10 varieties of seed perilla.
Figure 3 shows the results of a PCR test using the KASP marker peril_KASP_06 for 10 varieties of seed perilla.
Figure 4 shows the results of a PCR test using the KASP marker peril_KASP_08 for 10 varieties of seed perilla.
Figure 5 shows the results of a PCR test using the KASP marker peril_KASP_14 for 10 perilla seed varieties.
Figure 6 shows the results of a PCR test using the KASP marker peril_KASP_10 for 10 perilla seed varieties.
Figure 7 shows the results of screening each combination of 6 types of KASP markers for identification of 10 seed perilla varieties.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. Analysis of base sequence variations for each variety using RNA-Seq

1-1. Genomic DNA (gDNA) extraction

To extract gDNA from young leaf tissue of perilla seeds, young leaves were sampled when each true leaf was about 1 cm long. 100 mg of young leaves were cut and placed in a 2ml tube, along with one 5mm beal made of stainless steel, immersed in liquid nitrogen, and then crushed in QIAGEN Tissue Lyser II for 5 minutes. Afterwards, gDNA was extracted using the MACHEREY-NAGEL NucleoSpin Plant II protocols mini kit according to the manufacturer's protocol. At this time, Buffer PL2 (step 2b) was used as the cell lysis buffer.

1-2. SNP search through perilla DNA resequencing

DNA resequencing was performed on 16 cultivated tetraploid perilla cultivars (Table 1) based on the wild perilla diploid standard genome, Perilla citriodora (660Mb). Based on this, we searched for SNPs that showed differences between breeds.

No. kind No. kind One Dayu 9 good harvest 2 deulsaem 10 Round No. 2 3 Sodam 11 upper leaves 4 wild incense 12 late autumn 5 excited 13 Dongle No. 1 6 main room 14 purple 7 Namcheon 15 Leaf Perilla No. 1 8 mission 16 YCPL285 (Milyang No. 14)

Specifically, DNA resequencing was performed as follows.

1) Sequence preprocessing

The preprocessing process for short reads was to remove PCR duplicate reads, and then the DynamicTrim and LengthSort programs in the SolexaQA (v.1.13) package were used for quality trimming. DynamicTrim performs the process of cutting out bad quality bases at both ends of short reads according to the Phred score and refining them into good quality reads (cleaned reads), and LengthSort removes too many bases from DynamicTrim. The process of removing read was performed. DynamicTrim's Fred score ≥ 20 was used, and the LengthSort process used a short read length ≥ 25bp.

2) Alignment to reference genome

The cleaned reads that passed the preprocessing process were mapped to the reference genome sequence using the BWA (0.6.1-r104) program.

3) De novo assembly

Draft genome sequence assembly was performed using cleaned reads that passed the preprocessing process and using the default option with K-mer = 59 according to the protocol of the SOAPdenovo2 (version 2.04) program.

4) Raw SNP detection and consensus sequence extraction

Using the BAM format file generated by mapping the cleaned reads to the reference genome, raw SNPs were detected using the SAMtools (0.1.16) program, and consensus sequences were extracted.

5) SNP matrix generation

To perform comparative analysis of SNPs between analysis targets, an integrated SNP matrix between samples was created. A list of unions is constructed using the raw SNP positions obtained by comparing each sample with the standard genome as candidates, and at this time, empty regions (non-SNP loci) are filled in from the matched sequence of the sample to form a matrix through a filling process. was written. Afterwards, mis-called SNP loci were filtered through SNP comparison between samples, and a final SNP matrix was created. Based on the corresponding locus, SNPs were classified into ‘homozygous/heterozygous/Etc.’ types according to the type classification criteria.

6) SNP search for variety differentiation

Based on the SNP matrix between the created samples, the nucleotide sequence of the same SNP locus between varieties was determined.

By comparison, a total of 9,686,199 polymorphic SNPs showing differences were discovered. To select a set of refined varietal markers, genotype missing filtering, removal of SNP loci located within the repetitive region, removal of variant loci within the sequence surrounding the target SNP, and filtering of PIC (polymorphism information content) values were performed. Ultimately, 8,250 SNPs were selected.

Example 2. Discovery of a set of molecular markers for identification of perilla seed varieties

150 KASP markers were produced based on the 8,250 SNPs finally selected in Example 1-2.

Next, using KASP markers, PCR tests were performed on 10 varieties of seed perilla (Dayu, Deulsaem, Sodam, Deulhyang, Deulchan, Daesil, Anyu, Baekjin, Dami, and Neuulsaemi), and then markers showing polymorphism were selected to select seed perilla varieties. A set of markers for discrimination was constructed.

PCR assay for KASP markers uses the following composition: DNA: 0.5㎕ (10ng/㎕), 2x KASP Master mix: 5㎕, KASP Assay mix with primers: 0.14㎕, water: 4.5㎕ (total reaction volume: 10.14㎕) , was performed with QuantStudio 5 Real-Time PCR (Thermo Fisher) according to the conditions in Table 2.

Step Description temperature hour Number of cycles per step One activate 94℃ 15 minutes 1 cycle 2 denaturalization 94℃ 20 seconds 10 cycles Annealing/elongation 61~55℃ 60 seconds
(Temperature decreases by 0.6℃ per cycle) 3 denaturalization 94℃ 20 seconds 26 cycles Annealing/elongation 55℃ 60 seconds

The genotype of each seed perilla variety was determined based on FAM and HEX fluorescence values, and the results are shown in Figures 1 to 6.

As a result, it was confirmed that 10 seed perilla varieties could be identified using a combination of 6 KASP markers (Figure 7).

The six types of KASP markers finally selected are shown in Table 3 below.

marker name FAM Allele HEX Allele Primer Seq Allele Primer Seq Allele Y (forward) Primer Seq common(reverse) peril_KASP_30 G A GTGTTATCCAAAATTCCTACCACCG (SEQ ID NO: 1) ATGTGTTATCCAAAATTCCTACCACCA (SEQ ID NO: 2) ACATATTTGGTTTGGAGGTGGATTCTACTT (SEQ ID NO: 3) peril_KASP_27 G A ATTGTCATGAAATTGGCGGTAACATTG (SEQ ID NO: 4) AAAATTGTCATGAAATTGGCGGTAACATTA (SEQ ID NO: 5) CATGTATGAATATGGTGTAATATCATTCAA (SEQ ID NO: 6) peril_KASP_06 T C ATCTTTTCTATAAAATCTCCAATATGTGTGTA (SEQ ID NO: 7) CTTTTTCTATAAAATCTCCAATATGTGTGTG (SEQ ID NO: 8) CCTTTAGTTATGAGTAGAATTCAGATGATA (SEQ ID NO: 9) peril_KASP_08 G A GATGGCATGCAAAACCCTCC (SEQ ID NO: 10) CTGATGGCATGCAAAACCCTCT (SEQ ID NO: 11) CTACTCCTATCAATCTTCCATAGAAGGTT (SEQ ID NO: 12) peril_KASP_14 C A TTAACAGACCTGAACACTTCAATCC (SEQ ID NO: 13) CTTTAAGAGACCTGAACACTTCAATCA (SEQ ID NO: 14) TGTTATAAATGACGTCCACACACCTAATTT (SEQ ID NO: 15) peril_KASP_10 A G GAATGTAAAACTTCATGTTCTTCATTCTGATAA (SEQ ID NO: 16) ATGTAAAACTTCATGTTCTTCATTCTGATAG (SEQ ID NO: 17) GAAGAATGGACTGTGTTGTAAGGCTAATA (SEQ ID NO: 18)

As confirmed in this example, the marker of the present invention can identify 10 varieties of perilla seeds, and can differentiate between perilla seed varieties through quality control, such as preventing hybridization between varieties. Furthermore, the marker of the present invention can distinguish between perilla seed varieties. It can be used to protect genetic resources.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

Claims (9)

One or more consecutive oligonucleotides selected from the base sequences of SEQ ID NO: 1 to SEQ ID NO: 18; Any one or more oligonucleotides selected from the group consisting of their complementary oligonucleotides; A composition for determining perilla seed varieties, comprising a primer set containing at least one selected from the group consisting of; and combinations thereof.
The method of claim 1, wherein the primer set includes SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; A primer set consisting of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9; A primer set consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; A primer set consisting of SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15; Or a primer set consisting of SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18. A composition for determining seed perilla varieties.
The method of claim 1, wherein the primer set includes oligonucleotides of SEQ ID NO: 1 to SEQ ID NO: 18; Or an oligonucleotide complementary to the oligonucleotide; a composition for determining seed perilla varieties. The method of claim 1, wherein the primer set is
i) forward primer of SEQ ID NO: 3n-2;
ii) forward primer of SEQ ID NO: 3n-1; and
iii) reverse primer of SEQ ID NO: 3n; comprising a primer set consisting of,
Wherein n is a natural number from 1 to 6, and n in i) and ii) is composed of a set of six primers having the same value.
The method of claim 1, wherein the primer set is for discriminating one or more varieties selected from the group consisting of Dayu, Deulsaem, Sodam, Deulhyang, Deulchan, Daesil, Anyu, Baekjin, Dami, and Neuulsaemi. Composition for.
The method of claim 1, wherein the primer set simultaneously discriminates one or more varieties selected from the group consisting of Dayu, Deulsaem, Sodam, Deulhyang, Deulchan, Daesil, Anyu, Baekjin, Dami, and Neuulsaemi. Composition for discrimination.
The composition for determining perilla seed varieties according to claim 1, wherein the primer set is capable of detecting or amplifying a SNP sequence of perilla seed genomic DNA.
(a) performing PCR using the primer set of any one of claims 1 to 7 using DNA isolated from the sample as a template; and
(b) A method for determining seed perilla varieties, comprising the step of analyzing the amplified PCR product obtained in step (a).
The method of claim 8, wherein the analysis of the amplification product in step (b) is performed using one or more methods selected from the group consisting of DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, and phosphorescence measurement. How to identify perilla seed varieties.