KR20240020320A - Naked eye detection method for RdRp variation of SARS-CoV-2 - Google Patents

Abstract

The present invention relates to a method for visual detection of SARS-CoV-2 RdRp mutations.
The present invention develops a colorimetric detection method using the CRISPR-Cas12a system to easily diagnose SARS-CoV-2 RNA with the naked eye. In particular, the detection method according to the present invention has the feature of being able to specifically and sensitively identify the type of mutation of SARS-CoV-2.

Description

SARS-CoV-2 RdRp variation naked eye detection method {Naked eye detection method for RdRp variation of SARS-CoV-2}

The present invention relates to a method for visual detection of SARS-CoV-2 RdRp mutations.

SARS-CoV-2 is a newly discovered single-stranded RNA novel betacoronavirus and was named SARS-CoV-2 by the International Committee on Taxonomy of Viruses in January 2020. The genome of SARS-CoV-2 is non-segmented, approximately 30 kb in size, and encodes 10 proteins. The 10 proteins consist of one replicating polyprotein (open reading frames 1ab), four structural proteins (spike, envelope, membrane and nucleocapsid), and five non-structural proteins (open reading frames 3a, 6, 7a, 8 and 10). It is done.

The recently prevalent Omicron mutant virus was first reported to WHO in South Africa on November 24, 2021. On November 26, 2021, the World Health Organization (WHO) held an emergency meeting of the Technical Advisory Group on Virus Evolution (TAG-VE) to identify the COVID-19 mutant virus of the B.1.1.529 lineage. After evaluating its characteristics, it was named “Omicron” and classified as a major variant of concern (VOC).

Omicrons have many amino acid mutations, so to check for omicron mutations, whole-genome analysis or target genome analysis targeting the S protein must be performed. For sequencing, a sufficient amount of virus must be present in the sample for analysis to be performed. possible.

Currently, the standard method for diagnosing SARS-CoV-2 is real-time reverse transcription polymerase chain reaction (rRT-PCR). The method of labeling nucleic acids simultaneously with PCR has the advantage of not requiring a separate step for labeling, while the disadvantage is that when using monomers labeled with a fluorescent dye, etc., PCR efficiency is lower than when using unlabeled monomers. There is.

The PCR method is an easy method to detect target nucleic acids when a large amount of detectable nucleic acids are present. This is a method that is currently widely used for diagnosing viral infectious diseases, but it is very difficult to detect when a small amount of target nucleic acid is present (low sensitivity), and only specific targets cannot be detected due to other inhibitors. Incorrectly detecting a specific target (low specificity) frequently occurs. Accordingly, there is an urgent need to develop nucleic acid detection technology with improved sensitivity and specificity.

In particular, in order to respond early to SARS-CoV-2 infection and prevent the progression and spread of the disease, it is necessary to quickly and accurately diagnose SARS-CoV-2 infection, especially the degree of mutation. If we can diagnose it during the incubation period, we can effectively prevent the spread of the disease and prevent major damage. In other words, in order to early respond to the spread of disease caused by SARS-CoV-2 infection, there is a need to quickly and accurately diagnose infection with SARS-CoV-2 mutations.

Meanwhile, the CRISPR/Cas system is a bacterial transformation system that prevents infection from the outside by recognizing and cutting DNA/RNA introduced from the outside. In particular, since it was discovered that the CRISPR/Cas system is capable of cutting with base sequence-specific factors, it has been attracting attention as a new gene editing technology and has been applied in a variety of ways, including detecting and diagnosing target genes. However, the CRISPR/Cas system has not yet been used. There is minimal research on technology for visually detecting target genes using systems.

Accordingly, the present inventors would like to develop and provide a colorimetric detection method using the CRISPR-Cas12a system that can easily identify SARS-CoV-2 RNA with the naked eye, and specifically and sensitively detect SARS-CoV-2 mutations. .

One object of the present invention is (a) a first oligonucleotide having an anchor at the 5' end; and a second oligonucleotide having a biotin signal moiety at the 3' end and comprising a sequence complementary to the first oligonucleotide; (b) CRISPR RNA (crRNA); and Cas12a endonuclease; and (c) a horseradish hydrogen peroxide conjugate of avidin or an avidin analog; and a horseradish hydrogen peroxide substrate.

Another object of the present invention is (a) a first oligonucleotide of SEQ ID NO: 1 having an anchor at the 5' end; and a second oligonucleotide of SEQ ID NO: 2, which has a labeling ligand signal portion at the 3' end and includes a sequence complementary to the first oligonucleotide; (b) selected from the group consisting of SEQ ID NOs: 3 to 6 Any one CRISPR RNA (crRNA); and a second agent comprising Cas12a endonuclease; and (c) an anti-ligand that recognizes the labeling ligand signal portion; a composition for detecting SARS-CoV-2 or COVID-19 comprising a third agent comprising -19 The goal is to provide diagnostic kits.

Another object of the present invention is (a) isolating total RNA from an isolated biological sample; (b) amplifying a target DNA sequence using the isolated total RNA as a template; and (c) in the presence of a first agent comprising a first oligonucleotide having an anchor at the 5' end and a second oligonucleotide having a biotin signal moiety at the 3' end and comprising a sequence complementary to the first oligonucleotide, Mixing the target DNA product of the amplification step with a second agent containing CRISPR RNA (crRNA) and Cas12a endonuclease; and (d) reacting avidin or an avidin analog with a third agent comprising a horseradish hydrogen peroxide conjugate and a horseradish hydrogen peroxide substrate.

Another object of the present invention is (a) isolating total RNA from an isolated biological sample; (b) Using the isolated total RNA as a template, from the group consisting of primer pairs of SEQ ID NOs: 7 and 8, primer pairs of SEQ ID NOs: 9 and 10, primer pairs of SEQ ID NOs: 11 and 12, and primer pairs of SEQ ID NOs: 13 and 14 Amplifying a target DNA sequence with one or more selected primer pairs; and (c) a first oligonucleotide of SEQ ID NO: 1 having a fixed portion at the 5' end and a second oligonucleotide of SEQ ID NO: 2 having a labeling ligand signal portion at the 3' end and containing a sequence complementary to the first oligonucleotide. In the presence of a first agent comprising, the target DNA product of the amplification step comprising any one CRISPR RNA (crRNA) selected from the group consisting of corresponding SEQ ID NOs: 3 to 6 and Cas12a endonuclease (endonuclease) mixing with the second agent; and (d) reacting with a third agent containing an anti-ligand that recognizes the labeled ligand signal portion; a detection method for detecting SARS-CoV-2 or a method for providing information for diagnosing or identifying mutations of SARS-CoV-2, including; is to provide.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

Additionally, the terms used in this specification are used for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as “include” or “have” are intended to indicate the presence of features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features or It should be understood that this does not exclude in advance the possibility of the presence or addition of numbers, steps, operations, components, parts, or combinations thereof.

Additionally, unless otherwise defined, all terms used herein, including technical or scientific terms, have meanings that are generally understood by those skilled in the art in the technical field to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and unless clearly defined in the present application, should not be interpreted in an ideal or excessively formal sense. No.

Hereinafter, the present invention will be described in detail.

The present invention provides (a) a first oligonucleotide having an anchor at the 5' end; and a second oligonucleotide having a biotin signal moiety at the 3' end and comprising a sequence complementary to the first oligonucleotide; (b) CRISPR RNA (crRNA); and Cas12a endonuclease; and (c) a horseradish hydrogen peroxide conjugate of avidin or an avidin analog; and a third agent comprising a horseradish hydrogen peroxide substrate.

As used herein, the terms “nucleic acid sequence,” “nucleotide sequence,” and “polynucleotide sequence” refer to oligonucleotides or polynucleotides, and fragments or portions thereof, and DNA of genomic or synthetic origin, which may be single-stranded or double-stranded. or RNA, and refers to the sense or antisense strand.

Cas12a (Cpf-1), one of the CRISPR proteins, has the property of cutting both ends of the DNA when it binds to the target DNA and randomly decomposing single DNA strands around it.

In the present invention, the Cas12a protein binds to CRISPR RNA (crRNA), and when these polymers bind to the target DNA of a pathogen whose sequence is complementary to the CRISPR RNA, the Cas12a protein is activated and cleaves it. When the target DNA is cut, the DNase activity of the Cas12a protein is induced and can be cut.

In the present invention, the type of detection target is not limited, but the target sequence may preferably be provided by a virus, pathogen, etc.

For example, it could be a virus that requires rapid diagnosis/detection. The virus may be a DNA virus, RNA virus, or retrovirus. In particular, it may preferably be an RNA virus.

Specifically, examples of RNA viruses include Coronaviridae viruses, Picornaviridae, Caliciviridae, Flaviviridae, Togaviridae, Bornaviridae, Filoviridae, Paramyxoviridae, Neuboviridae, Rhapdoviridae, Arenaviridae, and Burnaviridae. Viridae, Orthomyxoviridae viruses or coronaviruses, SARS virus, poliovirus, rhinovirus, hepatitis A virus, Norwalk virus, yellow fever virus, West Nile virus, hepatitis C virus, dengue virus, Zagaka virus, Rubella Viruses, Ross River virus, Sindbis virus, Chikungunya virus, Borna disease virus, Ebola virus, Maiburg virus, measles virus, mumps virus, Nipah virus, Handra virus, Newcastle disease virus, human respiratory syncytial virus, These are rabies virus, Lassa virus, hantavirus, Crimean-Congo hemorrhagic fever virus, influenza or hepatitis D virus.

In addition, the present invention provides (a) a first oligonucleotide of SEQ ID NO: 1 having an anchor at the 5' end; and a second oligonucleotide of SEQ ID NO: 2, which has a labeling ligand signal portion at the 3' end and includes a sequence complementary to the first oligonucleotide; (b) selected from the group consisting of SEQ ID NOs: 3 to 6 Any one CRISPR RNA (crRNA); and Cas12a endonuclease; and (c) an anti-ligand that recognizes the label ligand signal portion; providing a composition for detecting SARS-CoV-2 comprising a third agent. do.

The SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) virus is an RNA virus with an RNA genome and belongs to the Betacoronavifus family of the Coronaviridae family. The SARS-CoV-2 virus is the pathogen of coronavirus disease 2019 (COVID-19), which can invade respiratory epithelial cells and cause fever, chest pain, difficulty breathing, muscle pain, or severe pneumonia. SARS-CoV-2 viral RNA contains the following genes: Orf1a, Orf1b, S (coding for spike protein), E (coding for envelope protein), M (coding for membrane protein), and N (coding for nucleocapsid protein).

In the present invention, the first oligonucleotide can detect target nucleic acid cleaved by Cas12a protein and may be called a reporter probe.

The second oligonucleotide binds to and identifies target nucleic acids cleaved by the Cas12a protein, and may be called a capture probe.

As used herein, the term “labeled ligand signal” refers to a signal that can be detected directly by the human eye or by means of a detection system. The characteristics of the signal vary depending on the characteristics of the label used. The signals may in particular be colored, luminescent, fluorescent, phosphorescent, radioactive or magnetic signals. Preferably the signal is a colored signal.

The labeling ligand signal portion may be one or more selected from the group consisting of biotin, digoxigenin, aptamer, peptide, fluorescent compound, oligonucleotide, and polysaccharides. You can.

The anti-ligand that recognizes the labeled ligand signal portion may be one or more selected from the group consisting of avidin or avidin analogs, antibodies, receptors, and lectins.

The avidin analog may be streptavidin, neutravidin, or captavidin.

Avidin or an avidin analog may be a horseradish hydrogen peroxide conjugate of avidin or an avidin analog.

Horseradish hydrogen peroxide substrates are 3,3',5,5'-tetramethylbenzidine (TMB), 2,2'-azino-di-[3-ethylbenzthiazoline-6-sulfonic acid] (ABTS), o -It may be any one selected from the group consisting of phenylenediamine dihydrochloride (OPD), 3,3'-diaminobenzidine (DAB), and luminol.

More preferably, in the present invention, the base sequence in which biotin is bound to the 3' end of the second oligonucleotide can be processed with horseradish hydrogen peroxide conjugate of avidin or an avidin analog, and color development can be confirmed through TMB.

The generation of a detectable signal through the above ligand/anti-ligand provides information to specifically detect target RNA with high sensitivity without going through the step of isolating genes and/or RNA from cell lysates. do.

The fixing part is an acetyl group (-COCH ₃ ), carboxyl group (-COOH), phosphate group, amino group (-NH ₂ , RNH ₂ , -ArNH ₂ ; where R is H or C ₁ -C ₆ alkyl group), methyl chloride (-CH ₂ Cl, -ArCH ₂ Cl), amide (-CONH ₂ ), aldehyde (-CHO), hydroxyl group (-OH), epoxy, thiol and succinyl group (-COC ₂ H ₄ COOH), but is not limited thereto, and any functional group known to be capable of binding to a protein at the 5' end of a nucleotide can be used regardless of its type.

At this time, the target DNA sequence for detection may be any one selected from the group consisting of SEQ ID NOs: 15 to 18. SEQ ID NO: 15 is the target DNA of RdRp/nsp12 P323L, SEQ ID NO: 16 is the target DNA of the S gene, SEQ ID NO: 17 is the target DNA of the N gene, and SEQ ID NO: 18 is the target DNA of the Orf1ab gene.

Accordingly, the composition of the present invention consists of a primer pair of SEQ ID NOs: 7 and 8, a primer pair of SEQ ID NOs: 9 and 10, a primer pair of SEQ ID NOs: 11 and 12, and a primer pair of SEQ ID NOs: 13 and 14 for amplifying the target DNA sequence. It may further include one or more primer pairs selected from the group consisting of

The primer pair of SEQ ID NOs: 7 and 8 is used to synthesize cDNA with the sequence of SEQ ID NO: 15 for RdRp/nsp12 P323L RNA on the sample, and the primer pair of SEQ ID NOs: 9 and 10 is used to synthesize the S gene RNA on the sample. It is used to synthesize cDNA with the sequence of SEQ ID NO: 16, and the primer pair of SEQ ID NO: 11 and 12 is used to synthesize the N gene RNA on the sample into cDNA with the sequence of SEQ ID NO: 17. , the primer pair of SEQ ID NOs: 13 and 14 is used to synthesize cDNA with the sequence of SEQ ID NO: 18 from Orf1ab RNA in the sample.

At this time, the Cas12a protein binds to the CRISPR RNA (crRNA) corresponding to any one of SEQ ID NOs: 3 to 6, and these polymers bind to any one of SEQ ID NOs: 15 to 18, which is complementary in sequence to the CRISPR RNA. When it binds to the corresponding target DNA, the Cas12a protein is activated and cuts it. When the target DNA is cut, the DNase activity of the Cas12a protein is induced and can be cut.

SEQ ID NO: 3 is the crRNA of RdRp/nsp12 P323L, SEQ ID NO: 4 is the crRNA of the S gene, SEQ ID NO: 5 is the crRNA of the N gene, and SEQ ID NO: 6 is the crRNA of the Orf1ab gene. The Cas12a protein polymer bound to these crRNAs is RdRp/nsp12 P323L target DNA (SEQ ID NO: 15), S gene target DNA (SEQ ID NO: 16), N gene target DNA (SEQ ID NO: 17), and Orf1ab gene target DNA (SEQ ID NO: 18), respectively. combines with

Therefore, the composition of the present invention can detect alpha mutation, beta mutation, gamma mutation, omicron mutation, delta mutation, or wild type among SARS-CoV-2.

Synthesis of the cDNA may be performed in the presence of reverse transcriptase. Additionally, if necessary, the target sequence can be amplified and the reaction can be performed using isothermal amplification or polymerase chain reaction (PCR).

The term “isothermal amplification” refers to a method of amplifying a nucleic acid template under constant reaction temperature conditions. The isothermal amplification method may be recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HAD), nucleic acid sequence-based amplification (NASBA), or a combination thereof. You can.

As used herein, the term “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be replicated, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow for initiation of synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target desired as well as the conditions under which the primer is used, such as temperature and ionic strength.

In the present invention, oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids, or May contain an intercalating agent.

Meanwhile, the present invention provides (a) a first oligonucleotide having an anchor at the 5' end; and a second oligonucleotide having a biotin signal moiety at the 3' end and comprising a sequence complementary to the first oligonucleotide; (b) CRISPR RNA (crRNA); and Cas12a endonuclease; and (c) a horseradish hydrogen peroxide conjugate of avidin or an avidin analog; and a third agent comprising a horseradish hydrogen peroxide substrate.

The above-described kit may additionally include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare the buffer solution, and the colorimetric detection sequence presented. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and descriptions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

In addition, the present invention provides (a) a first oligonucleotide of SEQ ID NO: 1 having an anchor at the 5' end; and a second oligonucleotide of SEQ ID NO: 2, which has a labeling ligand signal portion at the 3' end and includes a sequence complementary to the first oligonucleotide; (b) selected from the group consisting of SEQ ID NOs: 3 to 6 Any one CRISPR RNA (crRNA); and Cas12a endonuclease; and (c) an anti-ligand that recognizes the labeling ligand signal portion.

The kit may further include samples required for SARS-CoV-2 diagnosis. The kit may include a negative control, a positive control, a reverse transcriptase, a polymerase, a suitable buffer solution, a chromogenic enzyme, or a chromogenic substrate.

In the kit of the present invention, the first agent, second agent, and third agent may be divided into separate containers from the primer set (pair) for synthesizing the RNA of the sample into cDNA and the reagent for performing the reaction. .

The optimal amount of the above reagent can be easily determined by a person skilled in the art after learning the disclosure herein. Typically, the kits of the present invention are manufactured in separate packaging or compartments containing the previously mentioned components.

The kit according to the present invention can detect target nucleic acids in real time and with the naked eye without separate gene isolation and amplification steps, and in particular can detect single mutant target nucleic acids with excellent sensitivity and accuracy, providing rapid and accurate detection and Diagnosis is possible.

Meanwhile, the present invention includes the steps of (a) isolating total RNA from a separated biological sample; (b) amplifying a target DNA sequence using the isolated total RNA as a template; and (c) in the presence of a first agent comprising a first oligonucleotide having an anchor at the 5' end and a second oligonucleotide having a biotin signal moiety at the 3' end and comprising a sequence complementary to the first oligonucleotide, Mixing the target DNA product of the amplification step with a second agent containing CRISPR RNA (crRNA) and Cas12a endonuclease; and (d) reacting avidin or an avidin analog with a third agent comprising a horseradish hydrogen peroxide conjugate and a horseradish hydrogen peroxide substrate.

Additionally, the present invention includes the steps of (a) isolating total RNA from a separated biological sample; (b) Using the isolated total RNA as a template, from the group consisting of primer pairs of SEQ ID NOs: 7 and 8, primer pairs of SEQ ID NOs: 9 and 10, primer pairs of SEQ ID NOs: 11 and 12, and primer pairs of SEQ ID NOs: 13 and 14 Amplifying a target DNA sequence with one or more selected primer pairs; and (c) a first oligonucleotide of SEQ ID NO: 1 having a fixed portion at the 5' end and a second oligonucleotide of SEQ ID NO: 2 having a labeling ligand signal portion at the 3' end and containing a sequence complementary to the first oligonucleotide. In the presence of a first agent comprising, the target DNA product of the amplification step comprising any one CRISPR RNA (crRNA) selected from the group consisting of corresponding SEQ ID NOs: 3 to 6 and Cas12a endonuclease (endonuclease) mixing with the second agent; and (d) reacting with a third agent comprising an anti-ligand that recognizes the labeled ligand signal portion.

In the target sequence or SARS-CoV-2 detection method according to the present invention, the sample may be a sample obtained from an individual infected with or suspected to be infected with SARS-CoV-2. The subject may be a mammal, such as a human, mouse, rat, cow, horse, pig, dog, sheep, ferret, hamster, monkey, ape, goat or cat.

In addition, the sample may be, for example, a collected human specimen (blood, saliva, urine, mucosal secretion from the back of the nose, i.e., nasal swab), but is not limited to this, and is not limited to this, and may be a target virus, target bacteria, or Any biological sample isolated from a patient suspected of SARS-CoV-2 infection can be used without limitation. Additionally, any method known in the art may be used to isolate total RNA from the sample, for example, a phenol extraction method may be used. Alternatively, total RNA can be isolated by reacting the biological sample with a lysis buffer consisting of 30 to 500 mM Tris at pH 6.0 to 7.0 and containing 0.1 to 1.5% (v/v) of Triton X-100. Not limited.

In the present invention, the term "detection" includes quantitative and/or qualitative analysis, detection of presence or absence, and detection of the amount (level) present.

The detection method according to the present invention can detect target nucleic acids in real time and with the naked eye without separate gene isolation and amplification steps, and in particular, single mutant target nucleic acids can be detected based on excellent sensitivity and accuracy, which is rapid and accurate. and diagnosis is possible.

Meanwhile, the present invention includes the steps of (a) isolating total RNA from a separated biological sample; (b) Using the isolated total RNA as a template, from the group consisting of primer pairs of SEQ ID NOs: 7 and 8, primer pairs of SEQ ID NOs: 9 and 10, primer pairs of SEQ ID NOs: 11 and 12, and primer pairs of SEQ ID NOs: 13 and 14 Amplifying a target DNA sequence with one or more selected primer pairs; and (c) a first oligonucleotide of SEQ ID NO: 1 having a fixed portion at the 5' end and a second oligonucleotide of SEQ ID NO: 2 having a labeling ligand signal portion at the 3' end and containing a sequence complementary to the first oligonucleotide. In the presence of a first agent comprising, the target DNA product of the amplification step comprising any one CRISPR RNA (crRNA) selected from the group consisting of corresponding SEQ ID NOs: 3 to 6 and Cas12a endonuclease (endonuclease) mixing with the second agent; and (d) reacting with a third agent containing an anti-ligand that recognizes the labeled ligand signal portion.

The information provision method of the present invention may further include (e) determining that the patient is infected with SARS-CoV-2 when a color change is confirmed.

As used herein, the term “diagnosis” refers to confirming the presence or absence of the COVID-19 disease or condition and the SARS-CoV-2 virus.

In the present invention, the term "mutation identification" refers to alpha mutation, beta mutation, gamma mutation, omicron mutation, and delta mutation based on detection of mutations selected from SARS-CoV-2 S gene, N gene, Orf1ab gene, and RdRp/nsp12-P323L. It refers to identifying mutations due to mutation or mutation of the above-mentioned genes.

The present invention develops a colorimetric detection method using the CRISPR-Cas12a system to easily diagnose SARS-CoV-2 RNA with the naked eye. In particular, the detection method according to the present invention has the feature of being able to specifically and sensitively identify the type of mutation of SARS-CoV-2.

1 is a schematic diagram of a colorimetric detection method according to the present invention.
Figure 2 shows the results of optimizing the conditions of Cas12a:crRNA for detection of RdRp/nsp12-P323L mutation in the colorimetric detection method according to the present invention (black bar is control (absence of target DNA), blue bar is RdRp/nsp12-P323L) This is the detection result of a mutant SARS-CoV-2 sample).
Figure 3 shows the results of measuring the detection limit of target DNA and viral RNA of the colorimetric detection method according to the present invention.
Figure 4 shows the results of evaluating the detection specificity of the colorimetric detection method according to the present invention for the RdRp/nsp12-P323L mutation.
Figure 5 shows the results of evaluating the detection specificity of the colorimetric detection method according to the present invention for each clinical specimen containing RdRp/nsp12-P323L, S gene, ORf1ab, and N gene mutations.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

Example One. CRISPR - Cas12a using the system RdRp / nsp12 - P323L Mutation detection

(One) CRISPR - Cas12a Colorimetric detection method using the system

As shown in Figure 1, the following process was performed for visual detection of the RdRp/nsp12-P323L mutation using the CRISPR-Cas12a system.

First, BSA was coated on a 96-well plate, incubated overnight at 4°C, and washed. Afterwards, it was blocked with blocking solution at 37°C for 1 hour.

After washing, EDC and 10 mM NHS at a final concentration were added and reacted at room temperature for 30 minutes. Then, 200 nM capture probe was added and incubation was performed at 37°C for 30 minutes.

After washing, 100 nM of the reporter probe and Streptavidin-HRP (1:1000) mixture was added and incubated at 65°C for 30 minutes, and then incubated again at room temperature for 1 hour and 30 minutes. After washing, blocking was performed with NEB 2.1 buffer at 37°C for 1 hour.

Afterwards, the Cas12a sample containing cas12a, crRNA, and target DNA was added and incubated at 37°C for 2 hours. Finally, 90 ㎕ of the reaction mixture was transferred to a new 96-well plate, TMB substrate was added to confirm the color reaction, and then a reaction stop reagent (stop solution, 1 MH ₂ SO ₄ ) was added and the absorbance was measured at 450 nm.

The viral RNA used in the experiment was applied after securing cDNA through RT-PCR.

The specific sequences of the primer set, probe, cRNA, and target cDNA used in the reaction are shown in Table 1 below.

Name Sequence (5'→3') order
number Capture probe
(amine modified) [NH ₂ -C ₆ ]aaaaaaaaaacCTCTCCCCTATCAC One Reporter probe
(biotinylated) [Biotin] aataaaataaaataaaataaGTGATAGGGGAG 2 RdRP/nsp12-P323L Cas12a crRNA UAAUUUCUACUAAGUGUAGAUcacuugcaaguuuuggaccacua 3 S gene Cas12a crRNA UAAUUUCUACUAAGUGUAGAUacuccuggugaauucuucuucuag 4 N gene Cas12a crRNA UAAUUUCUACUAAGUGUAGAUcccccagcgcuucagcguuc 5 Orf1ab Cas12a crRNA UAAUUUCUACUAAGUGUAGAUaaaauuacagaagagguugg 6 Target RdRp/nsp12 P323L primer F GCTTTAACTGCAGAGGTCACAT 7 Target RdRP/nsp12 P323L primer R CTACTGAAAAGCACCGTAGTGC 8 Target S gene primer F AGGTTTCAAACTTTACTTGCTTTACATAGA 9 Target S gene primer R GCACAGTCTACAGCATCTGTAA 10 Target N gene primer F TTACAAACATTGGCCGCAAA 11 Target N gene primer R GAAATTTGGAATCTTTGTCATCC 12 Target Orf1ab gene primer F ATACTTAAACCAGCAAATAA 13 Target Orf1ab gene primer R GTTTTCAAACCTAATACTCT 14 Target RdRp/nsp12 P323L gctttaactgcagagtcacatgttgacactgacttaacaaagccttacattaagtgggatttgttaaaatatgacttcacggaagagaggttaaaactctttgaccgttattttaaatattgggatcagacataccacccaaattgtgttaactgtttggatgacagatgcattctgcattgtgcaaactttaatgttttattctctacagtgttcccacttaca agttttggaccactagtgagaaaaatatttgttgatggtgttccatttgtagtttcaactggataccacttcagagagctaggtgttgtacataatcaggatgtaaacttacatagctctagacttagttttaaggaattacttgtgtatgctgctgaccctgctatgcacgctgcttctggtaatctattactagataaacgcactacgtgctttt cagtag 15 Target S gene TAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGC 16 Target N gene TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTC 17 Target Orf1ab gene AAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAAC 18

(2) Condition optimization of Cas12a and crRNA

An experiment was performed based on Target RdRP/nsp12 in Table 1 above, and condition optimization was performed.

We sought to optimize Cas12a:crRNA conditions for detection of the RdRp/nsp12-P323L mutation.

The experiment was performed in the same manner as above, except that the Cas12a:crRNA ratio was set at molar ratios of 1:1, 1:2, 1:3, 1:5, and 1:7.

As a result of the experiment, as shown in Figure 2, it was confirmed that color change due to TMB color development occurred only in the presence of RdRp/nsp12-P323L mutant SARS-CoV-2 at all Cas12a:crRNA ratios. Among them, it was confirmed that the most optimal colorimetric reaction occurred when the Cas12a:crRNA molar ratio was 1:5.

(3) Detection limit evaluation

We sought to measure the detection limit of DNA and viral RNA of RdRp/nsp12-P323L mutant SARS-CoV-2.

For this purpose, the experiment was performed in the same manner as above under the condition that the Cas12a:crRNA molar ratio, which produced the most optimal colorimetric reaction, was 1:5.

As shown in Figure 3, the detection limit of the colorimetric detection method developed targeting the RdRp/nsp12-P323L mutant SARS-CoV-2 is 1.2pM for DNA and 20 copies/ml for viral RNA, showing very high sensitivity. was able to confirm.

(4) Evaluation of detection specificity

We sought to evaluate the detection specificity of the colorimetric detection method according to the present invention for the RdRp/nsp12-P323L mutant SARS-CoV-2.

For this purpose, viral RNA was extracted from various viruses that cause respiratory infections (Flu A, Flu B, HPIV, RSV, HCoV, SARS-CoV-2, Delta variant, and Omicron variant), and then cDNA was obtained using RT-PCR. It was used in the experiment.

The colorimetric detection method according to the present invention was performed in the same manner as the above method under the condition that the Cas12a:crRNA molar ratio, which produced the most optimal colorimetric reaction, was 1:5.

As shown in Figure 4, the colorimetric detection method developed targeting RdRp/nsp12-P323L mutant SARS-CoV-2 showed color change only in SARS-CoV-2 delta and omicron mutant samples containing the RdRp/nsp12-P323L mutation. was observed, confirming that it had very high specificity.

Example 2. Evaluation of clinical sample detection ability using the CRISPR-Cas12a system

Based on the above results, we sought to confirm whether the colorimetric detection method according to the present invention has the same sensitivity and specificity in clinical specimens.

For this purpose, viral RNA was extracted from a sample of a patient infected with omicron variant COVID-19 containing the RdRp/nsp12-P323L mutation, and then cDNA was obtained using RT-PCR and used in the experiment.

In addition, cDNAs for the S, ORf1ab, and N genes of the SARS-CoV-2 shield type were designed and used in experiments.

The colorimetric detection method according to the present invention was performed in the same manner as the above method under the condition that the Cas12a:crRNA molar ratio, which produced the most optimal colorimetric reaction, was 1:5.

As shown in Figure 5, when crRNA capable of detecting each target positive sample was used, a color change was observed only in the group treated with each target positive sample, so the colorimetric detection method according to the present invention is used in SARS-CoV-2 clinical trials. It is judged that the ability to detect the sample is sufficient.

Claims (17)

(a) a first oligonucleotide having an anchor at the 5'end; and a second oligonucleotide having a biotin signal at the 3' end and comprising a sequence complementary to the first oligonucleotide; a first agent comprising a
(b) CRISPR RNA (crRNA); And a second agent containing Cas12a endonuclease, and
(c) horseradish hydrogen peroxide conjugate of avidin or an avidin analog; A composition for detecting a target sequence comprising a third agent comprising a horseradish hydrogen peroxide substrate. (a) the first oligonucleotide of SEQ ID NO: 1 having an anchor at the 5'end; and a second oligonucleotide of SEQ ID NO: 2, which has a labeling ligand signal portion at the 3' end and includes a sequence complementary to the first oligonucleotide;
(b) any one CRISPR RNA (crRNA) selected from the group consisting of SEQ ID NOs: 3 to 6; And a second agent containing Cas12a endonuclease, and
(c) A composition for detecting SARS-CoV-2 comprising a third agent comprising an anti-ligand that recognizes the labeled ligand signal portion. The method of claim 2, wherein the labeling ligand signal portion is a group consisting of biotin, digoxigenin, aptamer, peptide, fluorescent compound, oligonucleotide, and polysaccharides. A composition for detecting SARS-CoV-2, which is one or more types selected from. The composition for detecting SARS-CoV-2 according to claim 2, wherein the anti-ligand that recognizes the labeling ligand signal portion is at least one selected from the group consisting of avidin or avidin analogs, antibodies, receptors, and lectins. The composition for detecting SARS-CoV-2 according to claim 4, wherein the avidin analog is streptavidin, neutravidin, or captavidin. The composition for detecting SARS-CoV-2 according to claim 4, wherein the avidin or avidin analog is a horseradish hydrogen peroxide conjugate of avidin or an avidin analog. The method of claim 6, wherein the horseradish hydrogen peroxide substrate is 3,3',5,5'-tetramethylbenzidine (TMB), 2,2'-azino-di-[3-ethylbenzthiazoline-6-sulfonic acid. ] A composition for detecting SARS-CoV-2, which is any one selected from the group consisting of (ABTS), o-phenylenediamine dihydrochloride (OPD), 3,3'-diaminobenzidine (DAB), and luminol. The method of claim 2, wherein the anchoring portion is substituted with one or more selected from the group consisting of acetyl group, carboxyl group, phosphate group, amino group, methyl chloride, amide, aldehyde, hydroxyl group, epoxy, thiol and succinyl group. -Composition for detecting CoV-2. The composition for detecting SARS-CoV-2 according to claim 2, wherein the target DNA sequence for detection is any one selected from the group consisting of SEQ ID NOs: 15 to 18. The method of claim 9, comprising a primer pair of SEQ ID NOs: 7 and 8, a primer pair of SEQ ID NOs: 9 and 10, a primer pair of SEQ ID NOs: 11 and 12, and a primer pair of SEQ ID NOs: 13 and 14 for amplifying the target DNA sequence. A composition for detecting SARS-CoV-2, further comprising one or more primer pairs selected from the group. The composition for detecting SARS-CoV-2 according to claim 2, wherein SARS-CoV-2 is alpha-mutated, beta-mutated, gamma-mutated, omicron-mutated, delta-mutated or wild type. (a) a first oligonucleotide having an anchor at the 5'end; and a second oligonucleotide having a biotin signal at the 3' end and comprising a sequence complementary to the first oligonucleotide; a first agent comprising a
(b) CRISPR RNA (crRNA); And a second agent containing Cas12a endonuclease, and
(c) horseradish hydrogen peroxide conjugate of avidin or an avidin analog; A kit for detecting a target sequence comprising a third agent comprising a horseradish hydrogen peroxide substrate. (a) the first oligonucleotide of SEQ ID NO: 1 having an anchor at the 5'end; and a second oligonucleotide of SEQ ID NO: 2, which has a labeling ligand signal portion at the 3' end and includes a sequence complementary to the first oligonucleotide;
(b) any one CRISPR RNA (crRNA) selected from the group consisting of SEQ ID NOs: 3 to 6; And a second agent containing Cas12a endonuclease, and
(c) an anti-ligand that recognizes the labeled ligand signal moiety; a COVID-19 diagnostic kit containing a third agent. (a) isolating total RNA from the separated biological sample;
(b) amplifying a target DNA sequence using the isolated total RNA as a template; and
(c) in the presence of a first agent comprising a first oligonucleotide having an anchor at the 5' end and a second oligonucleotide having a biotin signal moiety at the 3' end and comprising a sequence complementary to the first oligonucleotide, Mixing the target DNA product of the amplification step with a second agent containing CRISPR RNA (crRNA) and Cas12a endonuclease; and
(d) reacting avidin or an avidin analog with a third agent comprising a horseradish hydrogen peroxide conjugate and a horseradish hydrogen peroxide substrate. (a) isolating total RNA from the separated biological sample;
(b) Using the isolated total RNA as a template, from the group consisting of primer pairs of SEQ ID NOs: 7 and 8, primer pairs of SEQ ID NOs: 9 and 10, primer pairs of SEQ ID NOs: 11 and 12, and primer pairs of SEQ ID NOs: 13 and 14 Amplifying a target DNA sequence with one or more selected primer pairs; and
(c) A first oligonucleotide of SEQ ID NO: 1 having a fixed portion at the 5' end and a second oligonucleotide of SEQ ID NO: 2 having a labeling ligand signal portion at the 3' end and containing a sequence complementary to the first oligonucleotide. In the presence of a first agent, the target DNA product of the amplification step is an agent comprising any one CRISPR RNA (crRNA) selected from the group consisting of corresponding SEQ ID NOs: 3 to 6 and Cas12a endonuclease (endonuclease). Mixing with two agents; and
(d) reacting with a third agent containing an anti-ligand that recognizes the labeled ligand signal portion; a SARS-CoV-2 detection method comprising a. (a) isolating total RNA from the separated biological sample;
(b) Using the isolated total RNA as a template, from the group consisting of primer pairs of SEQ ID NOs: 7 and 8, primer pairs of SEQ ID NOs: 9 and 10, primer pairs of SEQ ID NOs: 11 and 12, and primer pairs of SEQ ID NOs: 13 and 14 Amplifying a target DNA sequence with one or more selected primer pairs; and
(c) A first oligonucleotide of SEQ ID NO: 1 having a fixed portion at the 5' end and a second oligonucleotide of SEQ ID NO: 2 having a labeling ligand signal portion at the 3' end and containing a sequence complementary to the first oligonucleotide. In the presence of a first agent, the target DNA product of the amplification step is an agent comprising any one CRISPR RNA (crRNA) selected from the group consisting of corresponding SEQ ID NOs: 3 to 6 and Cas12a endonuclease (endonuclease). Mixing with two agents; and
(d) reacting with a third agent containing an anti-ligand that recognizes the labeled ligand signal portion; a method of providing information for SARS-CoV-2 diagnosis or mutation differentiation, including the step. The method of claim 16, further comprising: (e) determining that the person is infected with SARS-CoV-2 when a color change is confirmed.