KR20240018731A - Preparation method of male sterility rice using Os09g03890 gene, composition for inducing male sterility of rice and male sterility rice - Google Patents

Abstract

The present invention relates to a method for producing male sterility and to male sterile rice produced therefrom. According to the present invention, when the Os09g03890 gene is mutated and its expression and function are suppressed, pollen germination and pollen tube elongation are reduced, causing male sterility. . Therefore, the method for producing a male sterile line through regulating the activity of the Os09g03890 gene according to the present invention and the male sterile line produced therefrom are intended to effectively improve the existing breeding method, and can be used stably with little influence from the environment, thereby producing rice. It can greatly contribute to the development of the breeding industry.

Description

Method for producing male sterility rice using the Os09g03890 gene, composition for inducing male sterility of rice, and male sterility rice {Preparation method of male sterility rice using Os09g03890 gene, composition for inducing male sterility of rice and male sterility rice}

The present invention relates to a method for producing male sterile rice using the Os09g03890 gene, a composition for inducing male sterility in rice, and male sterile rice.

Rice (Oryza sativa) is a rice-producing plant that is used as a staple food not only in Korea but also in more than one-third of countries around the world. It is one of the economically important crops, and much research is being conducted to increase production. To increase rice production, F1 hybrid production through the introduction of male sterility is a technological development that all researchers around the world are paying attention to. Although cytoplasmic male sterility (CMS) is possible in rice, it is not realistic in terms of production costs or actual use. The method of developing male sterile transformants through genetic manipulation involves using a tapetum-specific promoter and using an external virulence gene (bacterial or plant gene) to induce selective death of surgical tissue to create male sterility. It is being used.

Meanwhile, in flowering plants, the formation of pollen and subsequent pollination and fertilization are crucial steps for sexual reproduction. Pollen development from microspores involves a series of coordinated cellular events in which mature pollen germinates rapidly, produces a pole-growing pollen tube (PT) derived from a vegetative cell, and delivers two sperm cells to the embryo sac. It has a special function. Efficient and rapid pollen germination and tube growth are known to be important for normal fertilization and fertility.

In mutations that affect pollen germination and tube growth in rice, very few genes have currently been discovered to be functional. For example, mutations in rice OsSUT1 (Sucrose Transporter1) cause male sterility. OsSUT1 mutant pollen grains normally accumulate starch during development, but do not germinate and fertilize eggs. As another example, it is known that infertile pollen is formed when the OsSPS1 (Sucrose Phosphate Synthase1) gene of rice is destroyed. It was confirmed that the mutant in which the OsSPS1 gene was destroyed accumulated sufficient starch in the pollen, but the germination efficiency was reduced to half that of the wild type.

To date, very limited research has been done on genes that affect pollen germination and tube growth in rice, and more research on genes that can cause male sterility is required.

The present inventors completed the present invention by confirming that when the expression of a specific gene in rice is suppressed and its function is deleted, pollen germination and pollen tube elongation are reduced, causing male sterility.

Therefore, the purpose of the present invention is to provide a method for producing male sterile rice.

Another object of the present invention is to provide male sterile rice.

Another object of the present invention is to provide a composition for inducing male sterility in rice.

Another object of the present invention is to provide a method for confirming male sterility of rice.

Another object of the present invention is to provide a composition for confirming male sterility of rice.

In order to achieve the above object, the present invention provides a method for producing male sterile rice, comprising the step of suppressing the expression of the Os09g03890 gene in rice.

In addition, in order to achieve the above other object, the present invention provides male sterile rice in which the expression of the Os09g03890 gene is suppressed.

In addition, in order to achieve the above other object, the present invention provides a composition for inducing male sterility in rice, comprising an agent that inhibits the expression of the Os09g03890 gene.

In addition, in order to achieve the above other object, the present invention provides a method for confirming male sterility of rice, including the step of measuring the expression of the Os09g03890 gene.

In addition, in order to achieve the above other object, the present invention provides a composition for confirming male sterility of rice, which includes an agent for measuring the mRNA or protein level of the Os09g03890 gene.

The present invention relates to a method for producing male sterile rice with suppressed expression and function of the Os09g03890 gene and male sterile rice produced therefrom. According to the present invention, pollen germination in rice with suppressed expression and function of the Os09g03890 gene And it was confirmed that pollen tube elongation was reduced, causing male sterility. The method for producing a male sterile line through regulating the activity of the Os09g03890 gene according to the present invention and the male sterile line produced therefrom are intended to effectively improve the existing breeding method, and can be used stably with little influence from the environment, making them suitable for rice breeding. It can greatly contribute to the development of the industry.

Figure 1 shows the results of analyzing the production and phenotype of a TAPE ( Os09g03890 ) gene homozygous mutant ( tape-1 or tape-2 ). Figure 1(A) shows the TAPE gene structure and deletion of the homozygous mutant. and a diagram showing the insertion site, where the black and white areas represent exons and untranslated regions, respectively, and the gray box represents the T-DNA fragment inserted into TAPE . The number ^{next to} It means p value. In addition, red letters indicate deletions or insertions in the base sequence for the mutants ( tape-1 and tape-2 ) along with altered amino acids. Figures 1(B) and 1(C) are images showing the phenotypes of WT and mutants ( tape-1 and tape-2 ), the bar in Figure 1(B) represents 10 cm, and Figure 1 The bar in (C) represents 2 cm. Figure 1(D) is an image showing the morphology of spikelets and florets of WT and mutants ( tape-1 and tape-2 ), and the bar represents 2 mm. Figures 1(E) and 1(F) are the results of confirming the starch content, exine layer, and intine layer of pollen, and Figure 1(E) shows the I ₂ -KI solution. This is the result of staining with , and Figure 1(F) is the result of staining with calcofluor white. In Figure 1(E), the bar represents 200 μm.
Figure 2 shows the in vitro and in vivo pollen germination of wild type and mutants, and Figures 2(A) and 2(B) show the in vitro germination of WT and mutant pollen. It is a result. Bar represents 200 μm. Figures 2(C) to 2(E) show the results of confirming in vivo germination 2 hours after pollination. Bar represents 200 μm. Figures 2(F) and 2(G) are enlarged images of fully elongated pollen tubes of WT and mutants. Bar represents 200 μm. Figure 2(H) is the result of quantifying the pollen tube length confirmed in Figures 2(F) and 2(G). In this case, the length of at least 150 pollen tubes was quantified. *** indicates p-value<0.001 calculated from Student's t-test.
Figure 3 is a result of confirming the functional role of the TAPE gene. Figure 3(A) is a diagram showing the bait region used in the TAPE gene structure and myosinXI binding analysis, and the orange dotted area is corn ( Zea) . represents the bait region corresponding to the homolog of mays L.). Figure 3(B) shows the results confirming the self-activation of the TAPE bait used in Y2H (yeast two-hybrid) analysis. A bait vector containing murine p53 and a bait vector containing the SV40 large T-antigen were used as positive controls, and an empty vector was used as a negative control.
Figure 4 is a diagram showing the mechanism of pollen tube development in rice ( tape ) with a functional deletion of the TAPE gene ( Os09g03890) .

Hereinafter, the present invention will be described in detail.

While conducting various studies to produce rice with induced male sterility, the present inventors confirmed that Os09g03890 is a gene involved in pollen germination and pollen tube elongation, and were able to produce male sterile rice by suppressing the expression of the Os09g03890 gene. was confirmed and the present invention was completed.

Therefore, the present invention provides a method for producing male sterile rice, including the step of suppressing the expression of the Os09g03890 gene in rice.

In the present invention, the term “rice” has the scientific name Oryza sativa L., an annual herbaceous plant, and the rice in the present invention is selected from the group consisting of Japonica type, Indica type, and Javanica type. It can be any one of them.

In the present invention, “ Os09g03890 ” may refer to a gene consisting of the base sequence shown in SEQ ID NO: 1, but may also be interpreted as including a sequence showing substantial identity.

The substantial identity is at least 60% when aligning the sequence of SEQ ID NO. 1 and any other sequence to correspond as much as possible, and analyzing the aligned sequence using an algorithm commonly used in the art. Homology, more specifically, means a sequence that exhibits 70% homology, even more specifically, 80% homology, and most specifically, 90% homology. Alternatively, the gene may refer to a gene encoding a protein that exhibits substantially the same physiological activity as the protein Os09g03890 encoded by the gene of SEQ ID NO: 1. In the present invention, the Os09g03890 gene may be named “ TAPE gene.”

In the present invention, the “male infertility” refers to a phenomenon in which pollination, fertilization, and seed development do not occur due to morphological or functional abnormalities in male organs, and can occur as a temporary environmental mutation or as a genetic trait. However, male sterility in the present invention may be induced as a genetic trait. In particular, male sterility in the present invention may be induced by suppressing the expression of the nuclear Os09g03890 gene, which is involved in pollen germination and pollen tube elongation.

In the present invention, the above step may be accomplished by deleting or inserting some bases of 1 bp or more of the Os09g03890 gene, for example, by deleting or inserting 10%, specifically, 0.01% or more of the bases of the full-length DNA. In addition, the above step can be accomplished by various gene editing methods known in the art, preferably by T-DNA insertion or gene editing using CRISPR-Cas9.

In the present invention, suppression of expression of the Os09g03890 gene may be achieved by deleting the base at position 508 of the Os09g03890 gene. The base at the 508th position is characterized by having A as the first base of the ATG (start codon) at the 38th position of the gene consisting of the base sequence shown in SEQ ID NO: 1. The base sequence at the 508th position may be adenine (A), and the Os09g03890 gene lacking adenine (A) at the 508th position may be composed of the base sequence shown in SEQ ID NO: 2.

In the present invention, suppression of expression of the Os09g03890 gene may be achieved by inserting adenine (A) at position 1429 of the Os09g03890 gene. The base at the 1429th position is characterized by having A as the first base of the ATG (start codon) at the 38th position of the gene consisting of the base sequence shown in SEQ ID NO: 1. The Os09g03890 gene in which adenine (A) is inserted at position 1429 may consist of the base sequence shown in SEQ ID NO: 3.

Additionally, the above step may be accomplished by T-DNA insertion. According to one embodiment of the present invention, when a mutant with T-DNA inserted into the Os09g03890 gene is used as a parent (female donor) and crossed with fertile rice, normal offspring and heterozygous offspring are separated. It was confirmed that the ratio was 1: 1. Therefore, it was confirmed that TAPE is essential for male-gamete gene transfer. In the present invention, the position where the T-DNA is inserted into the Os09g03890 gene is not particularly limited, and in one embodiment of the present invention In the example, it was inserted into the exon and intron region of Os09g03890 gene No. 1. More specifically, it was inserted at 1890bp to 2447bp with A of the ATG (start codon) at the 38th position of the gene consisting of the base sequence shown in SEQ ID NO: 1 as the first base. It has been inserted.

In addition, in this step, in addition to foreign genes that can be inserted into the plant genome such as T-DNA, mutations are induced by using endogenous transposons such as TOS17 or by injecting X-rays or gamma-rays, etc. This may be performed using RNAi or antisense methods, but is not limited thereto.

In the present invention, the “T-DNA” refers to a DNA fragment that is transferred to the nucleus of a host plant cell as transfer DNA in a Ti (tumor-inducing) plasmid of Agrobacterium species. There is a 25 bp repeat sequence at both ends of the T-DNA, and transfer begins at the left border and ends at the right border. Bacterial T-DNA is about 20,000 bp long and is used to cause insertional mutagenesis by disrupting the target gene by insertion. The inserted T-DNA sequence not only causes mutation but also marks the target gene. do.

In addition, this method may further include the step of using rice in which the expression of the Os09g03890 gene is suppressed as a model and crossing it with male fertile rice. On the contrary, if the step of crossing rice with wild-type seedlings using rice in which the expression of the Os09g03890 gene is suppressed is additionally included, male sterile rice cannot be produced.

The hybridization method may be any of the previously known methods. For example, the cutting method, which is most commonly used in rice hybridization, may be used, but is not limited thereto.

In addition, the present invention provides male sterile rice in which the expression of the Os09g03890 gene is suppressed.

The rice may be any one selected from the group consisting of Japonica type, Indica type, and Javanica type, and is applicable to all rice varieties.

The male sterility of rice may be reversible. In other words, the fertility of the male sterile rice plant can be restored by introducing the normal Os09g03890 gene.

The present invention also provides a composition for inducing male sterility in rice, comprising an agent that inhibits the expression of the Os09g03890 gene.

The agent refers to a substance that can inhibit the expression of Os09g03890 by directly or indirectly binding to the Os09g03890 gene or mRNA.

For example, the agent may be one or more selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, PNA (peptide nucleic acid), and antisense oligonucleotide that specifically binds to the mRNA of the Os09g03890 gene. It is not limited to this. That is, the siRNA, shRNA, miRNA, ribozyme, PNA (peptide nucleic acid), or antisense oligonucleotide can specifically bind to the mRNA of the Os09g03890 gene and inhibit translation for Os09g03890 protein synthesis.

In the present invention, the “siRNA” refers to a short double-stranded RNA that can induce an RNA interference (RNAi) phenomenon through cleavage of a specific mRNA. It consists of a sense RNA strand with a sequence homologous to the mRNA of the target gene and an antisense RNA strand with a complementary sequence. siRNA is an efficient gene knockdown method because it can suppress the expression of target genes.

The siRNA is not limited to complete pairing of the double-stranded RNA portion where RNAs are paired, but can be paired by mismatch (corresponding bases are not complementary), bulge (corresponding bases are missing in one chain), etc. Parts that are not completed may be included. The total length is 10 to 100 bases, preferably 15 to 80 bases, and most preferably 20 to 70 bases. The siRNA end structure can be either a blunt end or a cohesive end as long as it can inhibit the expression of the target gene through the RNAi effect. The sticky end structure can be either a structure where the 3rd end protrudes or a structure where the 5th end protrudes. The number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases. In addition, to the extent that siRNA can maintain the effect of suppressing the expression of the target gene, for example, a small molecule RNA (for example, a natural RNA molecule such as tRNA, rRNA, viral RNA, or artificial RNA) is attached to the protrusion at one end. molecules) may be included. The siRNA terminal structure does not need to have a cut structure on both sides, and may be a stem-loop-type structure in which one terminal portion of the double-stranded RNA is connected by a linker RNA. The length of the linker is not particularly limited as long as it does not interfere with pairing of the stem portion.

In the present invention, the “shRNA (short hairpin RNA)” refers to a single strand of 50-70 nucleotides, and forms a stem-loop structure in vivo. Long RNAs of 19 to 29 nucleotides complementary to each other on both sides of the loop region of 5 to 10 nucleotides form a double-stranded stem by base pairing.

In the present invention, the “miRNA (microRNA)” regulates gene expression and has a total length of 20-50 nucleotides, preferably 20-45 nucleotides, more preferably 20-40 nucleotides, even more preferably It refers to a single-stranded RNA molecule consisting of 20-30 nucleotides, most preferably 21-23 nucleotides. MiRNAs are oligonucleotides that are not expressed within cells and have a short stem-loop structure. MiRNAs have full or partial homology to one or two or more mRNAs (messenger RNAs) and suppress target gene expression through complementary binding to the mRNAs.

In the present invention, the “ribozyme” is a type of RNA and refers to an RNA molecule that has the same function as an enzyme that recognizes the base sequence of a specific RNA and cleaves it on its own. The ribozyme consists of a region that specifically binds to the complementary base sequence of the target messenger RNA strand and a region that cleaves the target RNA.

In the present invention, the “Peptide nucleic acid (PNA)” refers to a molecule that has the properties of both nucleic acid and protein, and is capable of complementary binding to DNA or RNA. PNA is similar to DNA in which nucleobases are linked by peptide bonds, and is not found in nature but is artificially synthesized through chemical methods.

The PNA undergoes a hybridization reaction with a natural nucleic acid having a complementary base sequence to form a double strand. When the lengths are the same, a PNA/DNA duplex is more stable than a DNA/DNA duplex, and a PNA/RNA duplex is more stable than a DNA/RNA duplex. The most commonly used peptide backbone is N-(2-aminoethyl)glycine repeatedly linked by amide bonds. In this case, the backbone of peptide nucleic acids is electrically charged, unlike the backbone of natural nucleic acids, which are negatively charged. It is neutral. The spatial size and distance between nucleotide bases of the four nucleotide bases present in PNA are almost the same as in natural nucleic acids. PNA is not only chemically more stable than natural nucleic acids, but is also biologically stable as it is not degraded by nucleases or proteases.

In the present invention, the "antisense oligonucleotide" refers to DNA or RNA or a derivative thereof containing a nucleotide sequence complementary to the sequence of a specific mRNA, and binds to the complementary sequence in the mRNA to translate the mRNA into a protein. It has characteristics that hinder. The antisense oligonucleotide sequence of the present invention refers to a DNA or RNA sequence that is complementary to the mRNA of the target gene and can bind to the mRNA of the target gene, and carries out translation, translocation into the cytoplasm (cation of trans), and maturation (cation of trans) of the mRNA of the target gene. maturation) or essential activities for all other overall biological functions. The length of the antisense oligonucleotide is 6 to 100 bases, preferably 10 to 40 bases.

The antisense oligonucleotide may be modified at one or more base, sugar, or backbone positions to improve efficacy. The oligonucleotide backbone can be modified with phosphorothioate, phosphotriester, methyl phosphonate, short-chain alkyl, cycloalkyl, short-chain heteroatomic, heterocyclic intersaccharide linkages, etc. Additionally, antisense nucleic acids may contain one or more substituted sugar moieties. Antisense oligonucleotides may contain modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-methyl pyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, 2,6-diaminopurine, etc. There is.

In addition, the present invention provides a method for confirming male sterility of rice, including the step of measuring the expression of the Os09g03890 gene.

In the step of measuring the expression of the Os09g03890 gene, the expression of the Os09g03890 gene in the target rice may be measured, and if the expression is suppressed, it may be determined that the target rice is male sterile.

The method for confirming male sterility may be performed by measuring the mRNA level of the Os09g03890 gene or the level of the protein expressed therefrom.

The mRNA level of the gene can be measured using a separate preparation. An agent for measuring the mRNA level of the gene may be, for example, a primer or probe capable of specifically binding to the gene, but is not limited thereto. award

In the present invention, the "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary template and serves as a starting point for copying the template strand. It refers to a short nucleic acid sequence that functions as a point. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature.

Methods for measuring the mRNA level of the gene include RT-PCR, quantitative real-time PCR, competitive RT-PCR, real-time quantitative RT-PCR, and RNase protection assay (RPA). It may be, but is not limited to, RNase protection assay), Northern blotting, or DNA chip analysis.

The level of the protein can be measured using a separate preparation. The agent for measuring the level of the protein may be, for example, an antibody or aptamer that specifically binds to the protein, but is not limited thereto.

In the present invention, the “antibody” refers to a proteinaceous molecule that can specifically bind to the antigenic site of a protein or peptide molecule. These antibodies can be produced by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene, and from the obtained protein by a conventional method. The form of the antibody is not particularly limited, and as long as it is a polyclonal antibody, a monoclonal antibody, or has antigen-binding properties, a portion thereof may be included in the antibody of the present invention, and all immunoglobulin antibodies may be included. In addition, it may contain special antibodies such as humanized antibodies. Additionally, the antibodies include intact forms with two full-length light chains and two full-length heavy chains as well as functional fragments of the antibody molecule. A functional fragment of an antibody molecule refers to a fragment that possesses at least an antigen-binding function and may include Fab, F(ab'), F(ab') 2, and Fv.

In the present invention, the “aptamer” refers to a single-stranded oligonucleotide and refers to a nucleic acid molecule that has binding activity to a given target molecule. The aptamer may have a variety of three-dimensional structures depending on its base sequence, and may have high affinity for a specific substance, such as an antigen-antibody reaction. An aptamer can inhibit the activity of a certain target molecule by binding to it. The aptamer of the present invention may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be linear or circular in shape, but is not limited to these.

Methods for measuring the level of the protein include western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket. Rocket immunoelectrophoresis, immunohistochemical staining, Immunoprecipitation Assay, Complement Fixation Assay, immunofluorescence, immunochromatography, FACS ( Methods such as fluorescence activated cell sorter analysis and protein chip technology assay may be used, but are not limited thereto.

The present invention also provides a composition for confirming male sterility in rice, comprising an agent for measuring the mRNA or protein level of the Os09g03890 gene.

The agent may be a primer or probe capable of specifically binding to the Os09g03890 gene, but is not limited thereto.

The agent may be an antibody or aptamer that specifically binds to the Os09g03890 protein, but is not limited thereto.

The contents of the present invention described above are applied equally to each other unless they contradict each other, and implementation by a person skilled in the art with appropriate changes is also included in the scope of the present invention.

Hereinafter, the present invention will be described in detail through examples, but the scope of the present invention is not limited to the following examples.

Example 1. TAPE gene using CRISPR/Cas ( os09g03890) Creation of Mutants

1-1. Plants and growing conditions

Wild-type (WT), ( Oryza sativa L. spp. japonica cv. Dongin and Hwayoung) and transgenic lines were grown in a growth chamber at 28°C/25°C (day/night) for 16 hours/day. After being cultivated for 2 weeks under conditions of 8 hours (light/dark) and 80% humidity, they were transferred to a rice field. For segregation analysis and reciprocal crossing, heterozygotes (HZ) were grown. Mutants were used: Seeds were grown on Murashige and Skoog media in a CO ₂ incubator for 2 weeks and transferred to a growth chamber.

1-2. TAPE gene( os09g03890) T-DNA insertion mutants

The T-DNA mutant of TAPE (2B-00091; cv. Hwayoung) was obtained from the Kyunghee University seed bank. The T-DNA was inserted into exon 1 and intron regions of the TAPE gene. More specifically, it was inserted between 1890bp and 2447bp using A as the first base of the ATG (start codon) at the 38th position of the gene consisting of the base sequence shown in SEQ ID NO: 1.

1-3. Using CRISPR/Cas TAPE gene( os09g03890) Creation of Mutants

Since mutants with T-DNA insertions cannot produce homozygous offspring, homozygous mutants were created using the CRISPR-Cas9 system in the T ₀ generation. Guide RNA (gRNA) to generate two KO mutants ( tape-1 and tape-2 ) of TAPE ( Os09g03890 ) was designed using CAFRI-Rice and CRISPRdirect web software. The oligomer corresponding to the gRNA was annealed and ligated into the Bsal-treated pRGEB32 binary vector (Addgene plasmid number: 63142). The primers used for cloning at this time are shown in Table 1 below.

TAPE_sCAS1_F GGCAGGAGCTATCAGAGAGTATCA CRISPR/Cas9 ( tape-1 ) TAPE_sCAS1_R AAACTGATACTTCTCTGATAGCTCC CRISPR/Cas9 ( tape-1 ) TAPE_sCAS2_F GGCACCTCAACTGAAGAACTGCGA CRISPR/Cas9 ( tape-2 ) TAPE_sCAS2_R AAACTCGCAGTTTCTTCAGTTGAGG CRISPR/Cas9 ( tape-2 )

For stable transformation, it was transformed into Agrobacterium tumefaciens (A. tumefaciens ) LBA4404 using the known Agrobacterium-mediated co-cultivation method.

50 μL of Agrobacterium tumefaciens LB4404 and 1 μg of vector for plant expression were mixed and left on ice for 15 minutes. Next, it was placed in liquid nitrogen for 75 seconds, left in an oven at 37°C for 5 minutes, 1 ml of LB liquid medium was added thereto, and then cultured in a shaking incubator at 28°C for 3 hours. Next, the cells were plated on tetracycline-resistant LB solid medium, and colonies generated 36 hours later were selected by culturing the cells in 1 mL of LB liquid medium.

The transformed Agrobacterium produced above was used in a rice transformation experiment. Dongjin rice seeds were grown on N6D solid medium in a growth room at 28°C for about 7 days to produce rice callus. The resulting callus and Agrobacterium cells transformed with the pGA2707 plant expression vector cultured for 72 hours were mixed and cultured in a medium containing N6D-acetosyringone in a dark growth room at 22°C.

Callus contaminated with Agrobacterium was washed cleanly with tertiary distilled water about 5 times and then treated on N6D solid medium for the first time (hygromycin 30 mg/L) and the second time (hygromycin 40 mg/L). Hygromycin selection was performed through subculture. The hygromycin selection was carried out in a growth room at 28°C for 4 weeks (2 weeks for each round). The divided callus was transferred to a redifferentiation medium, MSR (hygromycin 40 mg/L) solid medium, and redifferentiation was induced in a growth room under light conditions at 28°C for 4 weeks. Then, the plants were transferred to MS solid medium and grown in a growth room under light conditions at 28°C for 7 days and then grown in a greenhouse. were transferred to and re-differentiated plants were grown.

After extracting the DNA from the leaves of the redifferentiated transgenic plants, the base sequences were amplified through PCR using the TAPE_Seq_F and TAPE_Seq_R primers shown in Table 2 below, and plants with base sequence mutations were selected through sequencing analysis.

TAPE_Seq1_F GTAATGATGATGCAGTCCTG Sequencing ( tape-1 ) TAPE_Seq1_R TTCTGCACATGGTTGTTCCC Sequencing ( tape-1 ) TAPE_Seq2_F GAAAGGTATGCCAACGGCAG Sequencing ( tape-2 ) TAPE_Seq2_R TTCTTTTCACCGCCATGCCT Sequencing ( tape-2 )

Example 2. TAPE Methods for Characterizing Mutants

2-1. Plant phenotyping and pollen germination analysis

Before harvesting WT and tape-1 and tape-2, they were photographed using a COOLPIX P900s camera (Nikon, Tokyo, Japan), and spikelets of these plants were collected at the anthesis stage and examined under an SZX61 microscope ( Olympus, Tokyo, Japan) was used to image the images.

To observe pollen morphology, pollen grains were collected with tweezers and then stained to determine starch content in the inner and outer cell wall layers. Briefly, starch was stained using 1% I ₂ -KI solution and the intine layer and exine were stained using 0.1% calcofluor white and 0.001% auromine O solution. Each extine layer was stained.

Stained pollen was examined using a BX61 microscope (Olympus, Tokyo, Japan) with bright field, ultra-violet (UV), and fluorescein isothiocyanate channels. Confirmed.

Through pollen germination analysis, pollen grains released from dehiscent anthers were collected using liquid or solid pollen germination media by a method known in the art. Pollen tube (PT) length and pollen germination ratio were measured for more than 150 pollen grains using ImageJ software. To observe PT elongation in the pistil, the pistil was stained using an aniline blue solution. Briefly, pistils were collected 2 hours after pollination and cultured overnight in Carnoy's solution. Afterwards, the cells were washed 5 times with distilled water (5 minutes each time) and then incubated in 1M NaOH for 6 hours. Pistils were washed twice (10 minutes each time) and then stained with 0.05% aniline blue (in 0.1 MK ₂ HPO ₄ (pH 8.5)) for 1 hour in the dark. Stained pistils were observed under a UV channel.

2-2. Yeast two-hybrid (Y2H) analysis

The 4-561 bp, 1252-1488 bp, and 1726-2619 bp fragments of the TAPE gene CDS were amplified and cloned into the EcoRI/BamHI digested pGBKT7 vector to generate GAL4 DNA binding domain fusion baits (Baits A, B, and C, respectively). created. For self-activation test, the construct was transformed into yeast AH109. The bait-yeast transformants did not grow in minimal SD (synthetic defined) medium, confirming that they lacked the transcriptional activator function.

Bait A and B were used in Y2H screening analysis. The Y2H screening analysis was performed by Panbionet Corp, (Pohang, Republic of Korea) using a rice anther cDNA library.

To confirm whether TAPE can bind to myosinXI, Y2H analysis was performed using bait C. The GTD of myosinXI (LOC4330906) was fused with the GAL4 activation domain. SD medium lacks leucine, tryptophan, and histidine (SD-LWH) and is a selective medium containing 5mM of 3-Amino-1,2,4-triazole (3-AT). (selection media) was used.

Example 3. TAPE Identification and determination of impact on rice male-gamete transmission

To identify genes involved in male-gametogene transfer in rice, we performed a large-scale TDNA mutation screening of 627 known late pollen preferred genes (Plant Mol. Biol. 2018, 96, 17- 34. Reference). As a result, the T -DNA insertion strain of Example 1-2 ( 2B-00091). This line has T-DNA in the 1st exon and intron region of TAPE located between the three TPR and PB1 domains (Figure 1A).

In addition, reciprocal crossing analysis was performed using TAPE / tape plants to determine the gender causing the gamete transfer defect, and the results are shown in Table 3 below.

As shown in Table 3 above, when the T-DNA inserted mutant TAPE / tape plants were crossed with WT using a duplicate (male donor), TAPE / tape (heterozygous) progenies were produced without TAPE /tape (progenies). It was confirmed that only TAPE progeny (WT) were generated. In contrast, when TAPE / tape plants were used as mother plants (female donors), the separation ratio of TAPE / TAPE and TAPE / tape progeny was almost 1:1.

Through this, it was confirmed that TAPE is an essential gene for male-gamete gene transfer.

Example 4. TAPE Confirmation of sterile phenotype and PT length of mutants

Since we were unable to obtain a homozygous mutant of TAPE in the T-DNA indexed line, we used the CRISPR/cas9 system to investigate the phenotype by generating two independent homozygous mutants ( tape-1 or tape (specified as -2 ) was generated (see Figure 1A).

The infertility phenotype was observed in the independent homozygous mutants and is shown in Figure 1B and Figure 1C. Since it is known that some types of infertility phenotypes are caused by defects in the development of anthers and defects in the pollen maturation process, the shapes and internal characteristics of anthers and pollen at the maturation stage were confirmed and shown in Figures 1D to 1F.

As shown in Figure 1D, the anthers of WT and the mutant tape-1 and tape-2 developed normally and showed yellow color, confirming that there was no defect in the anthers.

In addition, to confirm starch accumulation and wall formation in pollen, starch was stained and the intine and exine layers were stained, as shown in Figures 1E and 1F.

As a result, it was confirmed that the sterility phenotype of TAPE mutants tape-1 and tape-2 was not due to defects in anthers and pollen at maturity.

Additionally, pollen germination assay was performed to confirm the PT phenotype between WT and tape-1 . As a result, it was confirmed that tape-1 had a short PT (Figures 2A and 2B). In an in vivo germination analysis using pistils of WT, tape-1 , and tape- 2 2 hours after fertilization, a short PT of tape-1 and tape-2 was observed (Figures 2C to 2E).

The PTs of tape-1 and tape-2 attached and germinated to the stigma, but unlike WT, they did not reach the transmitting track of the style. As a result of enlarging the PT of WT and tape-1 , it was confirmed that there was a short but intact pollen tube in the PT of tape-1 (see Figures 2F and 2G). The PT length between WT and tape-1 was quantitatively compared. As a result, it was confirmed that there was a statistically significant difference in PT length between WT and tape-1 (see Figure 2H).

Example 4. TAPE Confirm the functional role of genes

Meanwhile, in corn (Zea mays L.), it has been reported that Opaque1, a myosinXI motor protein, binds to ZmHIP, one of the TAPE homologs. Based on this, the binding between GTD and TAPE of myosin XI, the closest homolog to Opaque1 of rice, was confirmed. Y2H analysis was performed using a bait consisting of the C-terminus of TAPE (see Figure 3A). As a result, the bait did not show its own activation effect (Figure 3B), but interaction with the GTD of myosinXI was confirmed in the selective medium (Figure 3C).

A schematic diagram of the pollen tube development mechanism of rice ( tape ) with a functional deletion of the TAPE gene ( Os09g03890) based on what was confirmed above is shown in Figure 4.

According to the present invention, TAPE is a myosin

Overall, the present invention produced a male sterile homozygous mutant of rice with a deletion of the function of the TAPE gene ( Os09g03890) . When the expression and/or function of the TAPE gene is suppressed, pollen tube germination and elongation are reduced, resulting in male sterility. It was confirmed that infertility was caused.

Claims (16)

A method of producing male sterile rice, comprising the step of suppressing the expression of the Os09g03890 gene in rice.
According to clause 1,
The above step is a method of producing male sterile rice, which is achieved by deleting or inserting some bases of the Os09g03890 gene.
According to clause 1,
A method of producing male sterile rice, characterized in that the step is performed by T-DNA insertion or gene editing by CRISPR-Cas9.
According to paragraph 1,
A method for producing male-sterile rice, further comprising the step of using rice in which expression of the Os09g03890 gene is suppressed as a model and crossing it with male-fertile rice.
According to clause 1,
A method for producing male sterile rice, characterized in that suppression of expression of the Os09g03890 gene is achieved by deleting the base at position 508 of the Os09g03890 gene.
According to clause 5,
A method for producing male sterile rice, characterized in that the base at position 508 is adenine (A).
According to clause 5,
A method for producing male sterile rice, characterized in that the Os09g03890 gene with a base deletion at position 508 consists of a base sequence represented by SEQ ID NO: 2.
According to clause 1,
A method for producing male sterile rice, characterized in that suppression of expression of the Os09g03890 gene is achieved by inserting adenine (A) at position 1429 of the Os09g03890 gene.
According to clause 8,
A method for producing male sterile rice, characterized in that the Os09g03890 gene in which adenine (A) is inserted at position 1429 consists of a base sequence represented by SEQ ID NO: 3.
Male sterile rice with suppressed expression of the Os09g03890 gene.
A composition for inducing male sterility in rice, comprising an agent that inhibits the expression of the Os09g03890 gene.
According to clause 11,
The agent is characterized in that it is at least one selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, PNA (peptide nucleic acid), and antisense oligonucleotide that specifically binds to the mRNA of the Os09g03890 gene. Composition for inducing male infertility.
Os09g03890 A method of confirming male sterility of rice, including the step of measuring gene expression.
Os09g03890 A composition for confirming male sterility in rice, comprising an agent for measuring the mRNA or protein level of the gene.
According to clause 14,
A composition for confirming male sterility of rice, wherein the agent is a primer or probe capable of specifically binding to the Os09g03890 gene.
According to clause 14,
A composition for confirming male sterility of rice, wherein the agent is an antibody or aptamer that specifically binds to the Os09g03890 protein.