KR101884535B1 - Preparation method of male sterility rice using OspPGM gene, composition for inducing male sterility of rice and male sterility rice - Google Patents

Abstract

The present invention relates to a method for producing male sterile rice using OspPGM gene, a composition for inducing male sterility of rice, and male sterile rice. Specifically, in rice, OspPGM A method for producing male sterile rice comprising the step of inhibiting the expression of a gene, a step of crossing the expression of the parent OspPGM gene with a rice (T1) inhibited in expression of the OspPGM gene and a parental male germ (T1) comprising the step of determining whether sterility system rice (T2) method, a composition for male sterility induced in rice containing formulation for inhibiting the expression of OspPGM gene, the male sterile rice plants expressing the suppression of OspPGM gene, OspPGM gene expression A method for confirming the male sterility of a rice plant, a method for recovering rice fertility including a step of overexpressing the OspPGM gene in a male sterile rice plant in which the expression of OspPGM gene is inhibited, a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 , rice plant comprising the steps consisting of measuring the expression level of the gene in fertility OspPGM composition for recovery, and processing the candidate rice in rice comprising the gene OspPGM It relates to a method for screening of male sterility-inducing agent.
The method for producing male sterile rice according to the present invention can suppress the expression of the OspPGM gene, which is a gene expressed in rice, to produce male sterile rice. It is possible to induce male sterile rice, and it has become possible to produce male sterile rice by a variety of methods because it has found a new gene that can produce male sterile rice.

Description

The present invention relates to a method for producing male sterile rice using OspPGM gene, a composition for inducing male sterility in rice and a method for inducing male sterility of rice and male sterility rice,

The present invention relates to a method for producing male sterile rice using OspPGM gene, a composition for inducing male sterility of rice, and male sterile rice. Specifically, the present invention relates to a method for producing male sterile rice, which comprises the step of inhibiting the expression of the OspPGM gene in rice, the step of crossing with the rice (T1) inhibiting the expression of the OspPGM gene and the rice (T1) whether the additional male sterile lines of rice (T2) method, OspPGM composition for male sterility induced in rice containing formulation for inhibiting the expression of the gene, the expression suppressing male sterile rice of OspPGM gene, OspPGM gene expression comprising A method for confirming the male sterility of rice including the step of overexpressing the OspPGM gene in a male sterile rice plant in which expression of the OspPGM gene is inhibited, a method for recovering the fertility of rice, a nucleotide sequence of SEQ ID NO: 1 the composition for fertility restoration in rice comprising the OspPGM gene consisting of a polynucleotide represented by, and the candidates in the treatment of rice plant material the expression level of the gene OspPGM side Relates to a screening method of the step, male sterility-inducing agent of rice containing a.

Rice is a production plant of rice, which is a stock of rice in more than one third of the world, as well as in the world. It is one of economically important crops. To increase the production of this crop, F1 hybrid production through the introduction of male fertility is a technology development that all world researchers are paying attention to. Although it is possible to use CMS method in rice, it is not realistic in terms of production cost or practical use. In addition, a method of developing a male sterile transformant by genetic manipulation uses an external tapetum-specific promoter, Or plant genes) to induce the death of selective surgical tissues to produce male sterility.

Surgery is the male reproductive organ of the flowering plant, which is composed of many tissues such as tapeworm, endothecium, connective tissue, and vascular tissue and is responsible for the production of pollen. The developmental process of surgery is the first stage in which the shape of the surgery is established and the microspore cells divide and divide to form the microspore of the tetrad, and the first stage in which pollen and surgery are differentiated, and tissue degeneration, dehiscence, And the second stage, in which only a few of the genes involved in this development are expressed in the surgery.

For example, Korean Patent Laid-Open Publication No. 2005-0075170 (hereinafter referred to as "Patent Document 1") discloses a rice expression-specific expression cysteine protease gene, a surgical specific expression promoter of the gene, And a method for producing infertile-introduced rice. Patent Document 1 discloses that a cysteine protease gene is expressed in a specific manner, and thus it is disclosed that male sterile rice can be produced using the cysteine protease gene.

Korean Patent Laid-Open Publication No. 2009-0069397 (hereinafter referred to as "Patent Document 2") relates to a UGPase1 gene of a plant having multiple expression, which induces opacity 100-fold expression and male sterility. In Patent Document 2, the UGPase1 gene is involved in the male sterility of rice.

In addition to the genes disclosed in Patent Document 1 and Patent Document 2, many genes are expected to be expressed in rice. However, only a small number of genes have been found to be involved in the genes. Despite the fact that it is possible to introduce more diverse genes into rice, and to introduce them into male sterility of rice, the research on this is still insufficient.

Under these circumstances , the inventors of the present invention discovered a gene expressing in rice, and tried to put it into male sterility. As a result, OspPGM gene involved in pollen development was identified and used to produce male sterile induced rice The present invention has been completed.

Patent Document 1: Korean Patent Publication No. 2005-0075170 Patent Document 2: Korean Patent Publication No. 2009-0069397

The main object of the present invention is to provide a method for producing male sterile rice comprising the step of inhibiting the expression of the OspPGM gene in rice.

Another object of the present invention is to provide a method for producing a male sterile rice (T2), which further comprises a step of crossing with a rice (T1) inhibiting the expression of the parent OspPGM gene and a rice (T1) .

It is still another object of the present invention to provide a composition for inducing male sterility of rice comprising an agent for inhibiting the expression of OspPGM gene.

It is still another object of the present invention to provide male sterile rice in which the expression of the OspPGM gene is suppressed.

It is still another object of the present invention to provide a method for identifying the male sterility of rice including the step of determining the expression of OspPGM gene.

It is still another object of the present invention to provide a composition for identifying male sterility of rice including an agent for measuring mRNA or protein level of OspPGM gene.

It is still another object of the present invention to provide a method for regenerating rice fertility comprising overexpressing the OspPGM gene in a male sterile rice plant in which the expression of the OspPGM gene is inhibited.

It is still another object of the present invention to provide a composition for restoring rice fertility comprising an OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO:

Yet another object of the present invention is to provide a method for screening a male sterility inducer of rice, comprising the step of measuring the expression level of OspPGM gene in rice treated with a candidate substance.

The inventors of the present invention confirmed that OspPGM is a gene involved in pollen development while performing various studies to produce male sterile induced rice and confirmed that male sterile rice can be produced by inhibiting the expression of OspPGM gene Thus completing the present invention.

The fact that the expression of OspPGM gene in rice is suppressed and the production of male sterile rice is possible has not been known until now, and it has been clarified for the first time by the present inventor.

In one aspect of the present invention, the present invention provides a method for producing male sterile rice, comprising the step of inhibiting the expression of the OspPGM gene in rice.

The method for producing male sterile rice is to inhibit the expression of OspPGM gene in rice and reduce the amount of pollen production to induce male sterility of rice.

The term " rice " in the present invention is Oryza sativa L. and is an annual herbaceous plant. The rice in the present invention is selected from the group consisting of Japonica type, Indica type and Javanica type Lt; / RTI >

In the present invention, the term " OspPGM " may refer to a gene represented by SEQ ID NO: 1, but may also be interpreted to include sequences showing substantial identity thereto. Said substantial identity aligns the sequences of SEQ ID NO: 1 with any other sequence to the greatest extent of correspondence, and when at least 60% of the sequence identity is analyzed using an algorithm commonly used in the art Homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology. Alternatively, the gene may refer to a gene encoding a protein exhibiting a physiological activity substantially equivalent to the protein OspPGM encoded by the gene of SEQ ID NO: 1.

In the present invention, the term " male sterility " means a phenomenon in which moisture, fertilization, and seed development are not performed due to morphological or functional abnormalities of male organs, and when expressed as an environmental transient mutation or as a genetic trait However, the male sterility in the present invention may be induced as a genetic trait. In particular, male sterility in the present invention may be induced by inhibiting the expression of the nuclear OspPGM gene involved in flowerpot production.

In the present invention, the step may be performed by substituting or eliminating one or more bases of the OspPGM gene. For example, 10% of the total DNA, specifically 0.01% or more, of the DNA may be substituted or deleted.

The step may also be performed by T-DNA insertion. The T-DNA in the present invention may be inserted into the intron or exon of the OspPGM gene. For example, according to the results of genotyping analysis on the T2 progeny of the T-DNA-inserted rice, co-segregation is performed in the next generation, and plants containing a homozygous mutant in which T-DNA is inserted into the OspPGM gene Male sterile rice can be produced with a significant overall delay in pollen development. That is, the male sterile rice plants exhibit abnormal pollen development, and the operation may include a very small number of pollen. In the present invention, the position of insertion of the T-DNA into the OspPGM gene is not particularly limited, and may be inserted into the 5th intron or the 10th intron according to a specific embodiment.

In addition to the foreign gene that can be inserted into a plant genome such as T-DNA, the above step may be performed by using an endogenous transposon such as TOS17 or by injecting X-ray or gamma-ray to induce mutation, RNAi, or antisense methods, but are not limited thereto.

For example, the method may be performed by the parent OspPGM A step of crossing the rice with the suppressed expression of the gene and the rice of the parental male germ can be further included. On the contrary, male fertile rice can not be produced if the replicate further contains a step of crossing the rice with the suppressed expression of the OspPGM gene and the rice of the common male germ.

The OspPGM gene may also be present in chloroplasts. Thus, the method may be to lose the function of the gene present in the chloroplast but not the cytoplasm.

In another aspect, the present invention provides a method for producing male sterile rice (T2) comprising crossing the expression of a parent OspPGM gene with rice (T1) inhibited, and subordinate male gonad (T1) to provide.

It is possible to produce rice (T2) of male sterile lineage by crossing the rice (T1) with the parent OspPGM gene and the parent rice (T1) with the parent OspPGM gene. On the contrary, the expression of the OspPGM gene Inhibition of rice (T1) with parental male germ (T1) can not produce male sterile rice (T2).

The mating method in the above-mentioned crossing is most commonly carried out by using the most popular method for the crossing breeding.

In another aspect, the present invention provides a composition for inducing male sterility of rice, comprising an agent for inhibiting expression of an OspPGM gene.

The agent means a substance capable of directly or indirectly binding to OspPGM gene or mRNA and inhibiting the expression of OspPGM.

For example, the agent may be selected from the group consisting of siRNA, shRNA, miRNA, and antisense oligonucleotide that specifically binds to the mRNA of the OspPGM gene, but is not limited thereto. That is, the siRNA, the shRNA, the miRNA, or the antisense oligonucleotide can specifically bind to the mRNA of the OspPGM gene to inhibit translation for OspPGM protein synthesis.

In another aspect, the present invention provides a male sterile rice in which the expression of the OspPGM gene is suppressed.

The rice may be any one selected from the group consisting of Japonica type, Indica type and Javanica type and is applicable to all rice varieties.

The male sterility of the rice may be reversible. That is, the fertility of the male sterile rice can be restored by the introduction of the normal OspPGM gene.

In another aspect, the present invention provides a method for identifying the male sterility of rice, comprising determining the expression of the OspPGM gene.

If the expression of the OspPGM gene is inhibited, the male sterility of the rice can be confirmed.

The determining step may be performed by measuring the mRNA level of the OspPGM gene or the level of the protein expressed therefrom.

The mRNA level of the gene can be measured using a separate preparation. The agent for measuring the mRNA level of the gene may be, for example, a primer or a probe capable of specifically binding to the gene, but is not particularly limited thereto. The "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a complementary template and serving as a starting point for template strand copying Quot; means a short nucleic acid sequence. Primers can be used to initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

Methods for measuring mRNA levels of the genes include RT-PCR, quantitative real time PCR, competitive RT-PCR, real time quantitative RT-PCR, RNase protection assay RPA, RNase protection assay, Northern blotting, and DNA chip analysis.

The level of the protein can be measured using a separate preparation. The agent for measuring the level of the protein may be, for example, an antibody or an aptamer that specifically binds to the protein, but is not particularly limited thereto.

The "antibody" means a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody can be produced by a conventional method from the obtained protein by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene. The form of the antibody is not particularly limited and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention, and all immunoglobulin antibodies may be included. In addition, it may include a special antibody such as a humanized antibody. In addition, the antibody comprises a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and can be Fab, F (ab ') 2, F (ab') 2, Fv and the like.

The term "aptamer " refers to a single-stranded oligonucleotide, which refers to a nucleic acid molecule having binding activity to a given target molecule. The aptamer may have various three-dimensional structures depending on its nucleotide sequence, and may have a high affinity for a specific substance such as an antigen-antibody reaction. An aptamer can inhibit the activity of a given target molecule by binding to a predetermined target molecule. The aptamer of the present invention may be RNA, DNA, modified nucleic acid, or a mixture thereof, and the form thereof may be linear or cyclic, but is not limited thereto.

Methods for measuring the level of the protein include, but are not limited to, western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, Immunohistochemical staining, immunoprecipitation assays, complement fixation assays, immunofluorescence assays, immunofluorescence assays, immunofluorescence assays, immunofluorescence assays, immunofluorescence assays,

Immunochromatography, fluorescence activated cell sorter analysis (FACS), and protein chip technology assay, but the present invention is not limited thereto.

In another aspect, the present invention provides a composition for identifying male sterility of rice, comprising an agent for measuring mRNA or protein level of OspPGM gene.

The agent may be a primer or a probe capable of specifically binding to the OspPGM gene.

The agent may be an antibody or an aptamer that specifically binds to the OspPGM protein.

In another aspect, the present invention provides a method for recovering rice fertility, comprising overexpressing the OspPGM gene in male sterile rice plants in which the expression of the OspPGM gene is suppressed.

For example, the step may transform a vector containing the OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 into rice to induce regeneration of rice.

Specifically, this step operably links a plant promoter with a gene of SEQ ID NO: 1 and a plant promoter such as the actin promoter, cytochrome c, ubiquitin (ubi) promoter (Pubi) But may be carried out by inserting a DNA fragment containing the gene of SEQ. ID.

In another aspect, the present invention provides a composition for restoring fertility of rice, comprising an OspPGM gene.

The OspPGM gene may refer to a gene represented by SEQ ID NO: 1, but may also be interpreted to include a sequence showing substantial identity thereto. Said substantial identity aligns the sequences of SEQ ID NO: 1 with any other sequence to the greatest extent of correspondence, and when at least 60% of the sequence identity is analyzed using an algorithm commonly used in the art Homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology. Alternatively, the gene may refer to a gene encoding a protein exhibiting a physiological activity substantially equivalent to the protein OspPGM encoded by the gene of SEQ ID NO: 1.

In another aspect, the present invention provides a method for screening a male sterility inducer of rice, comprising measuring the expression level of an OspPGM gene or a protein thereof in rice treated with a candidate substance.

The method of measuring the expression level is as described above.

The method may further include the step of determining the candidate substance as a male sterility inducer of rice when the measured expression level is lower than the expression level of rice not treated with the candidate substance.

According to the present invention, it is possible to produce male sterile rice by inhibiting the expression of OspPGM gene, which is a gene in rice. It is possible to induce male sterile rice, and it has become possible to produce male sterile rice by a variety of methods because it has found a new gene that can produce male sterile rice. The male sterility strain, which regulates the OspPGM gene activity, is expected to replace the cytoplasmic genetic male sterility strain and the temperature - and senescence - sensitive nucleus gene male sterility strain since it can be used stably without being affected by the environment.

1 is an electrophoresis photograph confirming that OspPGM is specifically expressed only in late developmental stages that the starch of pollen development step synthesis through the expression of OspPGM.
Fig. 2 is a photograph showing the intracellular expression site of OspPGM- GFP. Specifically, Fig. 2 (a) shows OspPGM- GFP, Fig. 2 (b) shows spontaneous fluorescence treatment, d) is the sum of these results.
Figure 3 is a schematic diagram showing the OspPGM genome structure and T-DNA insertion site in osppgm- 1 and osppgm- 2 mutants. The boxes and solid lines represent exons and introns, respectively. The position of the T-DNA is indicated by a triangle.
Figure 4 is a photograph showing the post-growth phenotype of osppgm- 1 / osppgm- 1 homozygote.
(A) is a wild type, (b) is OspPGM / osppgm -1 , (c) is OspPGM / osppgm -2 , (d) is osppgm -1 / osppgm -1 , It is a photograph showing the result of dyeing. In addition, (f) is the wild type, (g) is osppgm -1 / osppgm - TEM photographs, (h) is the wild type, (i) the first is a photograph showing the results of nuclear staining of pollen osppgm-1 / osppgm-1. The white arrow is the generative nucleus and the red arrow is the vegetative nucleus.
FIG. 6 is a graph showing the results of measuring the amount of (a) starch and (b) sucrose in the wild type, Copm # 4, osppgm- 1 / osppgm- 1 system.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example  1: Materials and Methods

≪ Example 1-1: Plant material >

Greenhouse cultivar japonica rice (variety: Dongjinbara) wild type and mutant were used for the experiment. The rice was cultivated in a greenhouse at a temperature of 30 ° C in the day and 20 ° C in the night under conditions of a dark cycle of 14/10 and a humidity of about 80%. For an RT-PCR, anther from wild-type rice was recovered at different developmental stages.

≪ Example 1-2: RT-PCR analysis >

Total RNA was extracted using Trizol reagent. And reverse transcription was performed using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, Calif., USA) to synthesize first strand cDNA from full-length RNA. The rice ubiquitin 5 (OsUBQ5, LOC_Os01g22490) gene was amplified as an internal control to quantify the relative amount of cDNA. The primers were designed within a region containing at least one intron of each gene to exclude genomic DNA incorporation. Table 1 shows the primer sequences used for RT-PCR.

Name of the primer order SEQ ID NO: OspPGM Forward CTGCTCAGATTATCACTAAAATTG SEQ ID NO: 2 Reverse AGAGCTAGGTCTATTAAAGGCTTC SEQ ID NO: 3 OscPGM Forward ACGATATGACTATGAGAATGTTGA SEQ ID NO: 4 Reverse AGATGTAAAAAGGCTATCAAACAG SEQ ID NO: 5 OsUBQ5 Forward GACTACAACATCCAGAAGGAGTC SEQ ID NO: 6 Reverse TCATCTAATAACCAGTTCGATTTC SEQ ID NO: 7

≪ Example 1-3: Identification of cell position of OspPGM- GFP fusion protein >

The OspPGM full-length cDNA without the stop codon was fused with GFP in the frame. The OspPGM full-length cDNA was amplified by PCR using a reverse primer comprising a forward primer containing the SalI restriction site (5'-CACCGTCGACATGGCCTCGCACGCGCTCCGCCTC -3 ', SEQ ID NO: 8) and an SmaI restriction site (5'-TCCCCCGGGATGTTATGACAGTAGGCTTATCTC-3', SEQ ID NO: 9) Lt; / RTI > The amplified product was digested with each enzyme and cloned between the CaMV35S promoter of pJJ461 and GFP derived from pC1300intC (Ouwerkerk et al., 2001). The GFP fusion construct was transformed into corn lobule cell progenitors. GFP signals were monitored using a confocal microscope (LSM 510 META, Carl Zeiss, Jena, Germany).

<Example 1-4: Preparation of osppgm T-DNA insertion mutant>

The osppgm- 1 and osppgm- 2 mutant alleles were cloned into a rice T-DNA insertion sequence database (Jeon et al., 2000; An et al., 2003; Jeong et al., 2006; http://www.postech.ac. kr / life / pfg / risd / index.html). Genomic DNA was isolated from young leaves of rice using a simple mini-prep (Chen and Ronald, 1999) method. The pollen was transferred under a microscope using a tip of a sophisticated pipette. And pulverized using a small rod in a PCR tube for use as a genomic DNA template thereof. Genotype caused by T-DNA insertion using the PF2 / PF2 and PR2 / G1 set for PF1 / PR1 and L1 / PR1 primer set, osppgm -2 to -1 osppgm genomic DNA was determined by PCR analysis. The sequences of the primers used are shown in Table 2.

Name of the primer order SEQ ID NO: PF1 CTATGTAGAATAGCTGTTTTGCACCCAAC SEQ ID NO: 10 PR1 TATAGCACTACGGGCATATTCTTCATTTG SEQ ID NO: 11 L1 CGATTTTTGAAATGCGAGAGCG SEQ ID NO: 12 PF2 TGCTGCTAGGAACCAAGAGTAAATCAATA SEQ ID NO: 13 PR2 TCAAACACAAGATGAAATGGGAAATAAAC SEQ ID NO: 14 G1 ATCCAGACTGAATGCCCACA SEQ ID NO: 15

&Lt; Example 1-5: Reverse mating >

For reverse mating, OspPGM / osppgm- 1 and OspPGM / osppgm - 2 were assigned to Japonica cv. Ilpum was crossed with wild type rice. The genotypes of the crossed strains were determined by PCR using the same primer sets used for the T-DNA inserts (Table 2).

Example 1-6: Approximately incubation of osppgm mutants < RTI ID = 0.0 >

To create homozygous mutant of OspPGM, about cultures and is Eom et al, except that the anthers detached from the heterozygote of OspPGM / osppgm -1 and OspPGM / osppgm-2. (2016). &Lt; / RTI &gt; Anthers isolated from spikelets after surface sterilization of panicles with 70% (v / v) ethanol were treated with 2.0 mg / L NAA, 0.2 mg / L kinetin and 5% gelite at 25 ° C for one month It was cultured on callus induction medium containing N _6. The induced callus for regeneration N ₆ regeneration medium containing 0.2 mg / L IAA, 2.0 mg / L kinetin, 2 g / L casein hydrolyzate, 2 mg / L ABA, 40 g / L maltose, and 5% gel Light .

&Lt; Example 1-7: Analysis of PGM activity by PAGE >

Analysis of the in-gel PGM activity of the homozygous osppm- 1 mutant was performed by Egli et al. (2010) was slightly modified. Specifically, leaf samples were homogenized in a very cold extraction buffer containing 100 mM Tris-HCl, pH 7.0, 10 mM MgCl ₂ , 100 mM KCl, 42 mM β-mercaptoethanol and 15% (v / v) glycerol. Proteins were dissolved in unmodified polyacrylamide gels containing 8% (w / v) acrylamide (30% acrylamide / 0.8% bis-acrylamide) and 375 mM Tris-HCl (pH 8.8). The gel was washed with a washing solution containing 50 mM Tris-HCl, pH 7.0, and 5 mM MgCl ₂ for 1 minute and then eluted with 50 mM Tris-HCl, pH 7.0, 5 mM MgCl ₂ , 5.3 mM Glc- 1-P, 0.25 mM NADP, 0.25 mM NAD, 0.1 mM phenazine methosulfate, 0.25 mM nitroblue tetrazolium and 40 units Glc-6-P dehydrogenase.

&Lt; Example 1-8: Measurement of fructose and starch >

Rice leaves 100 mg and 3 mg of mature anthers including pollen were isolated from mature flowers of rice and rice at 12 weeks of age, respectively. Fructose and soluble starches were tested for their soluble sugar and insoluble fractions using the NAD (P) H binding enzyme test (Lee et al., 2008). The contents of the measured metabolites were normalized based on the weight of the received leaves.

&Lt; Example 1-9: Pollen staining and optical microscopic analysis >

The pollen was incubated in phosphate-buffered saline containing 4 ng / mL Hoechst 33342 (Sigma, St. Louis, Mo., USA) at 65 ° C for 1 hour to stain the nuclei of the pollen. Pollen starches were stained with 10% (v / v) Lugol solution (Sigma). Nuclear and starch-stained pollen were monitored under UV and white light, respectively, on an Olympus BX61 microscope.

&Lt; Example 1-10: Transmission electron microscopy analysis >

During development, pollen at the mature stage was fixed in phosphate buffer containing 3% glutaraldehyde. Subsequently, 2% osmium tetroxide was used for subsequent fixation. The dehydrated sample was placed in a low viscosity, formazed mixture of Spurr. Thin sections (40-60 nm thickness) were stained with 2.5% uranyl acetate and 2.5% citric acid lead salt aqueous solution. And observed with an electron microscope (Tecnai G2 Spirit (FEI Co., Hillsboro, OR, USA)).

Example  2: derived from rice OspPGM  Pollen development of gene By stage  Expression analysis

RT-PCR was performed as in Example 1-2, and the synthesized DNA was observed at each stage of pollen development.

As a result, it was confirmed that OspPGM (Oryza sativa plastidic phosphoglucutase) gene in the chromosomes as shown in Fig. 1 showed a particularly improved expression level only at the post-development stage in which the pollen was mature in the bicellular, mature stage, that is, the starch was synthesized. In contrast, the expression pattern of the OscPGM (Oryza sativa cytosolic phosphoglucomutase) gene in the cytoplasm was not significantly changed. This suggests that the OspPGM gene present in the chromosomes is involved in pollen development.

Example  3: OspPGM of  Location within the cell

The GFP fusion constructs were monitored by confocal microscopy according to Examples 1-3. FIG. 2 is a photograph showing the intracellular expression site of OspPGM , confirming that the OspPGM is present in the chloroplast.

Example  4: OspPGM  Mutant production

OspPGM mutants were prepared using the method in Example 1-3. Thus after making the same preparation, was produced by the T-DNA insert was lost the function of the wild-type gene OspPGM two OspPGM mutants in OspPGM gene of rice, it was respectively named osppgm-1, osppgm -2 (3) . Specifically, a Ti plasmid binary vector pGA2144 (Jeon et al., The Plant Journal (2000) 22 (6), 561-570) and co-cultured rice cells (callus derived from Dong Jinbin seed) DNA was inserted into the plant. osppgm- 1 contains the T-DNA insert in the 5th intron, and osppgm-2 contains the T-DNA insert in the 10th intron.

Example  5: OspPGM  Including Mutants Male sterility  Production of rice seedlings (T2)

The OspPGM mutant (T1) produced in Example 4 was self-hydrated to produce T2 progeny. As a result, the ratio of wild type (WT): heterozygote: hemozygote was 1: 1: 0 without normal isolation ratio of 1: 2: 1. Because this is a later genotyping of the typical infertile lineage, we predicted that OspPGM would have the function of inducing infertility. Table 3 shows the ratio (%) / predicted ratio (%) observed in T2 and the number of plants observed / the number of plants estimated.

T1 T2 Observed (%) / predicted (%)
Number of plants observed / number of plants estimated OspPGM / osppgm -One OspPGM / OspPGM OspPGM / osppgm -One osppgm-1 / osppgm-1 48.7 / 25
37/76 51.3 / 50
39/76 0/25
0/76 OspPGM / osppgm -2 OspPGM / OspPGM OspPGM / osppgm -2 osppgm -2/ osppgm -2 48.4 / 25
46/95 51.6 / 50
49/95 0/25
0/95

Example  6: OspPGM / osppgm Male sterility  Phenotype verification

OspPGM / osppgm strains were tested for the genotype of the later seeds after the reverse mating according to Example 1-5 for the male sterility phenotype verification. As a result, the replicates were OspPGM / osppgm and the samples were OspPGM / OspPGM , There was no mutant genotype at a later stage. On the other hand, the ratio of wild type (WT): heterozygote: hemozygote is 1: 1: 0, which is the isolation ratio of male sterile lineage only when the replicate is OspPGM / OspPGM and the sample is OspPGM / osppgm (Table 4). Thus, it was confirmed that OspPGM gene induces male sterility.

Reciprocating target Reverse mating result counterpart Example Observed (%) / predicted (%))
Number of plants observed / number of plants estimated OspPGM / osppgm -One OspPGM / OspPGM OspPGM / OspPGM OspPGM / osppgm -One 100/50
93/93 0 (n = 10) / 50
0/93 OspPGM / OspPGM OspPGM / osppgm -One OspPGM / OspPGM OspPGM / osppgm -One 51.5 / 50
52/101 48.5 / 50
49/101 OspPGM / osppgm -2 OspPGM / OspPGM OspPGM / OspPGM OspPGM / osppgm -2 100/50
97/97 0/50
0/97 OspPGM / OspPGM OspPGM / osppgm -2 OspPGM / OspPGM OspPGM / osppgm -2 48.1 / 50
52/108 51.9 / 50
56/108

On the other hand, osppgm strains osppgm -1 / osppgm through about cultured according to Example 1-6 because it does not produce homozygous with self-modify-produced one. FIG. 4 is a graph showing the change in growth after osppgm - 1 / osppgm - 1 , which is a homozygous construct, was produced through drug culture and compared with the wild type strain . 4, no change in growth was observed in the rice cultivated from the mutant OspPGM gene / mutant OspPGM gene ( osppgm- 1 / osppgm- 1 ) homozygote in comparison with the wild type strain .

On the other hand, produced a OspPGM / osppgm a system of Copm # 4 overexpression of OspPGM -1 system for recovering the lost genes. The amount of starch in the pollen of the wild type, OspPGM / osppgm- 1 , OspPGM / osppgm- 2 , osppgm-1 / osppgm-1 and Copm # 4 lines was measured by iodine reaction. Performed when dyed by the method of Example 1-9, and wild-type strains has been Copm # 4 all pollen staining ((A) and (E) in FIG. 5), OspPGM / osppgm -1 and the OspPGM / osppgm -2 strains Only 50% of the pollen was stained (Fig. 5 (B) and (C)). On the other hand, it was confirmed that osppgm- 1 / osppgm- 1 was not stained at all (Fig. 5 (D)). This confirms that mutants of OspPGM exhibit male sterile phenotype due to lack of starch. Also, it was confirmed through TEM as in Example 1-10 that the wild type starch was synthesized while the osppgm- 1 / osppgm- 1 system did not synthesize starch (FIGS. 5 (H) and (I) ).

6 is a graph showing starch and fructose contents in leaves of wild type, Copm # 4 and osppgm- 1 / osppgm- 1 . 6 shows that osppgm- 1 / osppgm - 1 contains a similar amount of starch and fructose as the wild type, whereas Copm # 4 has a slightly higher amount of fructose As shown in Fig. It was confirmed that osppgm - 1 / osppgm - 1, which is male sterile, does not contain starch in pots or leaves.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Preparation method of male sterility rice using OspPGM gene,          composition for inducing male sterility of rice and male          sterility rice <130> KPA161096-KR <160> 15 <170> KoPatentin 3.0 <210> 1 <211> 7521 <212> DNA <213> Oryza sativa <400> 1 gcttcataag atctcgcgcc ccttgcccgc ttccttccgc ggtgcaagcg caacaccacc 60 tcacctcact ccccttctcg cctcttctcc ccttctccac ctcctcttct ctccgcgtgg 120 cggtggcatt gccggccgcc gcatcgtctc gggatggcct cgcacgcgct ccgcctccac 180 ccgctgctct tctccgccgc cgccgcgcgc ccggctccgc tcgcggcgcg gcccggtggt 240 ggtgcccgcc gggtccaccg ccgccactct ctcgccgtcg tccggtgctc ctcctccgcc 300 gcccaggcgc tcaaggtacg atctcccccc tgcccgcgcg ctcgccctcc cggcgctgtt 360 gggtgtacg tgtgtgttgt ggactcgtcg tggggtgggt gggatttttc agttttgccg 420 tcggtgtgca gctccgggtt ctagactggg ggtggtgttg ctctgcgcga ttgtggcctt 480 aatcatgatt cctcgagatg attttgaata ctggtggtgg tttctgcagt cttccggcga 540 tgggaaggcg atttccgttt tttttttggg tttaatcaag cggcggcatc agcgctattt 600 tggcgacgga tactgtgggt tttgggtggt ggtggatccg gattttgggt tgcgtttcat 660 gtttctctcg aggccagtca tagcgcacag ctgctgcctt tgtgcacctc ttggatttat 720 ctatgtgatc acgcatccat tttggtggcc tctagatatg gcagtggatg ctgtgattca 780 tgtcatcatg tgcttccagt gcgctgagag ccctttttgt ctgatttggg tgccgtagga 840 ttcttccatt gtgtgcatta taggattatc aactcttaag tctctttttg cttattgtgt 900 gattgagata cacaaataac agatgatgat tgtgacgttt tatgcagatc aagtcgattc 960 cgaccaagcc cgttgagggg cagaagaccg ggaccagtgg gttgaggaag aaggcaagta 1020 ccagctgttt tatgttccac gatcttgcac ccatttccga tacgcttttt ttttttgggt 1080 gtgtacaatt cccttcatac atcttttttt ggtgttcttt tcaggtgaaa gtgttccagc 1140 aggagaatta cctcgctaat tggattcagg tgtgccacat tttacttgat gttgcacgtc 1200 aatagccttt tctgttttaa tgtgatgaca cctctaagat ggagctacat tcatttatcc 1260 tttctgtggt ttgaaggctc tgttcaattc attgcccccg gaggattatg ttggtggaac 1320 ccttgtgctt ggtggtgatg gccgatactt taacaaggat gctgctcagg tgctgctagg 1380 aaccaagagt aaatcaatac gtgtttgctc cacatttacg catgcatatt tatgactatt 1440 tctgtgggaa tgtagattat cactaaaatt gcagctggga atggtgttgg gaagatccta 1500 gttggcaggt aaggagatac tagatgaagc ttcttggatt tagaagatac aacactaact 1560 attagaagta tggatattca tagaactaaa attccaatgg ataccatcag ggctcctgaa 1620 actacctggt taaactacag ctaatacaca cttctatcct ccacttgcga tgttatccta 1680 tataccaaaa tgcttataat tgcacctaat tatattcaag ggttcaattt gaggattttc 1740 taataaaatg ttcccaaacc aagtactttt aaggctggaa aagggccagt ttctgggcaa 1800 aaaactataa ctagtcaggt tctcatttcc ccacctctga acggatttct gaaccctgac 1860 tttgaaagct tgaagccttc ataccttcac tgggttcggt ctggaaaata tccacatgat 1920 ccttagcata ctcaattaaa ggaagaataa cagattttac caaataaatt aaagcatctg 1980 acaataataa tcacataatt tgattttgac ttagttctga gcatagaaag gacactatgt 2040 tacttccctc aaacatttag catgctcaat tttccagttt atttcccatt tcatcttgtg 2100 tttgatatat actttgtatc ctgtaattgt taaaatattt gtaggaacgg tctgctgtca 2160 acgcctgctg tatctgcagt aattcgtaaa agacaagtat gttttacacc ttttttcatt 2220 cattgtgtgc ttcactatct tttttaattt tctaattcat tgcagttttc aattctgtta 2280 ggccaatggt ggcttcatca tgagtgcaag ccataatcca ggtgggccag ataatgattg 2340 gggtatcaag gtatgccata acttaaattg tatattctct tgtattgcag taattgatta 2400 gattaataat acaattctat ttagtttcgt cctgacaaat atgaaatgaa ctatttgaca 2460 gaatggcaac aaagaaatac ttttctatct ccagaaataa cttaccaatc atagactctt 2520 tgatgaagga tctgagaaaa gaaacacttt gctatttcca taatgttttt atttgtctat 2580 gtttggtctc tcaccctgga caaatgaaaa gaaagggttg ttctgttttt gaagtgcaaa 2640 tctgaaatg ttcttgggtg cccaatattt tctgtgttgg gtccctcatg attcatgaat 2700 gaaataattg aaaatatagc ttcttgtatt tttgattcat gaatgaaata attgaaaatt 2760 tcttgtgtgg caagtattcg gcaaaaaccg aattgtcaac atgcgatagt ataaacatgc 2820 aattttcctc aagtttatta catgatcaag tagcttaata agatgttcaa ttgcagttca 2880 actatagcag tgggcagcca gcaccagaga caattaccga ccaaatatat ggaaacacac 2940 tttcggtatg cacctttact atttattagc atattattta tacattagcc cattatattt 3000 atactatgta gaatagctgt tttgcaccca accctgtttt cagtaacatc ctattggcat 3060 ctaacacgtt ttgtctcatg ttactgcatt tctctttcca atgtcactgc tacagcattt 3120 ttcttcatgg cattatcgta gatgtcgaat aatattgccc ttacatttta cttatttctg 3180 atgatattat ttcttcacca taatgcaaat ctcctgcaga tttctgaaat aaaaacggca 3240 gatattcctg atgttgattt gtcctctcta ggagttgtaa gctatggtga tttcaccgtt 3300 gaagtgatag accctgtctt ggactacctt gagctaatgg aggtatacaa tgaaataatt 3360 atacagagat aatttatttt atatctaaat tatttctttc ctgtttgtgt cttcagaatg 3420 tgtttgactt ccaacttatc aagggcttgt tgtctcggcc agatttcagg ttctgtatat 3480 ttatttgctt ttcacatgtt gtttagtcat taataaataa tactagagtt ttggaaatat 3540 taatgcctga taatctacat gtgtattttt atgaagccta ataatctaca catttatgtc 3600 aacatgtact tcactggttc atttgtttga gcataagttt caaaaaactg ctctttattt 3660 tccttcagtc attcttgagt ttcaaagggg agcacttatg cgatatttgc taaccactac 3720 tacctctgtc ctaaaatata agcactagtc caggtgcata gctaaaatcc ctaatatttt 3780 tgggcggttg tagtagtacc tattacattt tgttgtggtg atgaacttat gattagtagc 3840 agatgcaata actatgtaac tttgtagtgt gataagtaat aaccatatta tttgtttctt 3900 tatttttggg aatatgaatt tatatctgca aataataatg gtaattttcc ttgattttct 3960 aggtttgtat ttgatgccat gcatgctgtg actggtgcat atgcggatcc tatttttgtt 4020 gagaaacttg gagctgatcc ggtggtgtat caattacttg agatgaatca tttttttttc 4080 ttgaggaatt ccattatttg atgctgaata tacacctggt ttgcaggact atatattaaa 4140 tggtgttcca cttgaagatt ttggcaatgg tcaccctgat cctaatttaa cgtatgtaaa 4200 tcagtcctca aatgaagaat atgcccgtag tgctatactt acttcatgtt aaaaaaaaaa 4260 aaaaactact gtacttactg ttgtttttct acagttatgc caaagagctt gtgtttacca 4320 tgtttggaag cggagcacct gactttggtg cagcaagtga tggtatgcct atattactcc 4380 ctctagtcac agataagtga tgttcaggaa tgtgtgcatt caacacgttt aaacttaacc 4440 atcaatatca ctttgaatat ttagaattca actgttagta atgatttcac aagagcgagt 4500 aggcatcttt tgaagagcca tttttgcttc tctttgaact taatgagaga gataaagata 4560 ctgttaaata ttagatcata gggttgtaac ttttgtacat ttttttgata tatgaacaaa 4620 tttaaactgt ggggacctcc actgctgttc tttgatcaga aaagaaaaat gatatgacta 4680 gttttgtctt caaaatagtt tcagaatatt ataacaatgc tacactcttt gtggaattta 4740 tactagtaat tactaaaaaa atcaactgtt tttggtgacc gtgtcattgt ccaaaattat 4800 ttcttagcac agggaaatac tagtactgca tctgcattaa tagatcttct attgtcttgg 4860 ccgtgtgcac gtaatgcgga tgccagaggt gtaacacttc tccgttgtct aaaaaaatat 4920 cttcaattgt gtctggcaaa atttaaacaa ttctggtata gcagttggat gagaaatacc 4980 tttaagtatt gttgagacta attaacaatt attgatcatt agatttatct ctcctcgaag 5040 tgatgccata acagccatat gtcacttgct ctgaaaattg acgtgtcact gtaactatct 5100 actttggtct cattttctta gtatattatg tgcatatagt tacagcttga atctcctttt 5160 catattattt gtgttgtccg taccttaata ttatcattta atacagttag atttgagaag 5220 ttttacttgc tgcatttgca aacttcattg aatgttctat tttatcactg gttctttctt 5280 tctgtgccct tccttttttt ctttttcttt attttttttt tgtgcgagga accttttagt 5340 ttagttgctg aagggaatat tgtgtgaaca aataacatta gaggtaaaaa tgcttgcagg 5400 tgatggtgat cgaaacatga ttcttggaag aaggttcttt gttacaccat cagactctgt 5460 tgcaataatt gcagcgaatg cacaggcagc aattccttat ttccaatctg gtccaaaagt 5520 aatgagatgt tacacattat aatgtttttc taaataggat attagactca tcaaagacaa 5580 gaatgatctc ttatgtttga tactttcttc agggtcttgc tagatcaatg ccaacgagtg 5640 gtgctcttga tcgtgtagct gataaattga atgttccgtt ctttgaggta cttttgtcag 5700 tgaattgcat gtgcatgatt tgtttgcaaa atagtcaata ggccatggct tctagaagaa 5760 cagctaagac aatatggtca ctttgcaggt accaakhga tggaaatttt ttggaaacct 5820 aatggatgca ggtaaattgt ctatatgtgg agaggaaagt tttgggacag gatctgatca 5880 catcagggag aaggatggca tatggtaaaa tattgtttat acatggatgc tttttctatt 5940 agatatcctt actgtcctag tatccagttg ttgcctagaa atgccaaaac agagataagt 6000 gcatcagaat tgctttctat gcatgcttga tagtttgcac tcttttcttg agaactgtct 6060 gcatggaact agtcacactc ccgctaacta ctgactttca gggctgttct agcttggctg 6120 tccatacttg cacaccggaa caaggataag aaggccgggg agagattagt gtcagtggaa 6180 gatgtagcta gggaacactg ggcaacctat ggaaggaatt tcttctccag atatgattat 6240 gaggtatttt atctttcata atgaatttct gaaatgataa tttatgagag tttatcttgc 6300 gtaccgaata aaatttctgg tacattattt caacccagaa attccaatga atcactaatc 6360 ttgtactgta caggagtgtg aatctgagag tgcaaataag atgatggagc atcttagaga 6420 tgtgatcgca aaaagcaagc ctggagagaa atatggttgg ttattataga attgtgcttg 6480 tatgttccgt agtgatgata tgtatgatgg ttaccagaaa ggctaatgaa ttattgacct 6540 tatgatgtag gaaactatac ccttcagttt gccgatgatt tcagttacac tgatccggtt 6600 ggcgctctct ctctctctct ctcccttgaa cacccatgtg tgcgtgtttt ggtggatatg 6660 tcagtcatgg tgcgcaattg aaatttacat ttttcctaaa tgttacaggt ggatggtagc 6720 actgtatcta aacaagggct tcgatttgta ttcaccgatg gatctaggat tatcttccgc 6780 ctttcggtac acagctatca ctgatatttt tttctccctt atcttgttgt tggagttgct 6840 gcttctaggc gctcacttgt ttgctcaaac ttccttctct tcttaatgct gagaagcatg 6900 aatctttcac atattcacta aaagccactg attttgccca cttgttttac aatttagtat 6960 atttttctct tatagggaac cggatctgct ggagcaacaa tccgtatata cattgagcaa 7020 ttcgagtctg atgcctcaaa gcatgatctg gatgcacaaa tagctttgaa gcctttaata 7080 ggtaactatc atctgccctc agatgagctt tctatgcatc catttcctga aattatgtgt 7140 atatataaac tactcataaa ctattttaaa tttctgcaga cctagctcta tctgtttcaa 7200 agttgaagga cttcactgga agagataagc ctactgtcat aacataaaca taccggtgac 7260 attagcaatg ttaccacctg tgtattcttt tatttctttg tttttatagc cccttccaac 7320 cgatgaacca ataatgtaat cttaggccaa gttttgtact gagttgatgg caaactgtat 7380 cttggaggta cctttcattg aacatagtat gcaggaatga ataagctttt agagcaatgg 7440 tacatatttc agaacaaact gtatcttgat gttctcgaat ttatcgaatt catcttgagg 7500 atgtcatgtt tctttgaaat a 7521 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RT-PCR primer sequence 1 <400> 2 ctgctcagat tatcactaaa attg 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RT-PCR primer sequence 2 <400> 3 agagctaggt ctattaaagg cttc 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RT-PCR primer sequence 3 <400> 4 acgatatgac tatgagaatg ttga 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RT-PCR primer sequence 4 <400> 5 agatgtaaaa aggctatcaa acag 24 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> RT-PCR primer sequence 5 <400> 6 gactacaaca tccagaagga gtc 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RT-PCR primer sequence 6 <400> 7 tcatctaata accagttcga tttc 24 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> SalI Foward primer <400> 8 caccgtcgac atggcctcgc acgcgctccg cctc 34 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SmaI Reverse primer <400> 9 tcccccggga tgttatgaca gtaggcttat ctc 33 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PF1 <400> 10 ctatgtagaa tagctgtttt gcacccaac 29 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PR1 <400> 11 tatagcacta cgggcatatt cttcatttg 29 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> L1 <400> 12 cgatttttga aatgcgagag cg 22 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PF2 <400> 13 tgctgctagg aaccaagagt aaatcaata 29 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PR2 <400> 14 tcaaacacaa gatgaaatgg gaaataaac 29 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G1 <400> 15 atccagactg aatgcccaca 20

Claims (19)

1. A method for producing male sterile rice comprising the step of suppressing the expression of an OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 in rice.
The method according to claim 1,
Wherein said step is performed by substitution or deletion of a part of the base of the OspPGM gene.
The method according to claim 1,
Wherein said step is performed by T-DNA insertion.
The method according to claim 1,
Wherein the method further comprises crossing the rice with the parent OspPGM gene expression inhibited rice and the parent male rice germ.
The method according to claim 1,
Wherein the OspPGM gene is present in chloroplasts.
(T1) in which the expression of the OspPGM gene consisting of the polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 as a parent is suppressed, and rice (T1) of the parent male parent germ (T1) T2).
1. A composition for inducing male sterility in rice comprising an agent for inhibiting expression of an OspPGM gene comprising a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1.
8. The method of claim 7,
Wherein the agent is selected from the group consisting of siRNA, shRNA, miRNA, and antisense oligonucleotides that specifically bind to the mRNA of the OspPGM gene.
A male sterile rice in which the expression of the OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 is suppressed.
10. The method of claim 9,
The male sterility of the rice is reversible, male sterile rice.
And determining whether the OspPGM gene is expressed by a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1.
1. A composition for identifying the male sterility of rice, comprising an agent for measuring mRNA or protein level of an OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1.
13. The method of claim 12,
Wherein the agent is a primer or a probe capable of specifically binding to the OspPGM gene.
13. The method of claim 12,
Wherein the agent is an antibody or an aptamer that specifically binds to the OspPGM protein.
1. A method for regenerating rice, comprising the step of overexpressing the OspPGM gene in a male sterile rice plant in which the expression of the OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 is inhibited.
16. The method of claim 15,
Wherein said step is carried out by transforming a vector containing OspPGM gene into rice.
1. A composition for restoring rice fertility comprising an OspPGM gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1.
And measuring the expression level of the OspPGM gene comprising the polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 in the rice treated with the candidate substance.
19. The method of claim 18,
Wherein the method further comprises the step of determining that the measured expression level is a male sterility inducer of rice when the measured amount of expression is inhibited as compared with the expression level of rice not treated with the candidate substance.

Images