KR101902655B1 - Preparation method of male sterility rice using OsAGPL4 gene, composition for inducing male sterility of rice and male sterility rice - Google Patents

Abstract

The present invention relates to a method for producing male sterile rice using OsAGPL4 gene, a composition for inducing male sterility of rice, and male sterile rice. Specifically, a method for producing male sterile rice comprising the step of inhibiting the expression of the OsAGPL4 gene in rice, a step of crossing with a rice (T1) inhibited expression of the OsAGPL4 gene and a parent rice germ (T1) , A method for producing male sterile rice (T2) further comprising OsAGPL4 How to determine the male sterility of rice plant comprising the step of determining whether a composition for male sterility induced in rice containing formulation for inhibiting the expression of the gene, the expression suppressing male sterile rice of OsAGPL4 gene, OsAGPL4 gene expression, OsAGPL4 In male sterile rice plants with suppressed gene expression, OsAGPL4 A method for recovering the fertility of a rice plant comprising the step of overexpressing the gene, a composition for restoring rice fertility comprising the OsAGPL4 gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1, and a method for recovering the OsAGPL4 gene And measuring the expression level of the male sterility inducer of rice.
The method for producing male sterile rice according to the present invention can suppress the expression of the OsAGPL4 gene, which is a gene expressed in rice, to produce male sterile rice. It is possible to induce male sterile rice, and it has become possible to produce male sterile rice by a variety of methods because it has found a new gene that can produce male sterile rice.

Description

A method for producing male sterile rice using OsAGPL4 gene, a composition for inducing male sterility of rice, and a method for preparing male sterility rice using OsAGPL4 gene, composition for inducing male sterility of rice and male sterility rice,

The present invention relates to a method for producing male sterile rice using OsAGPL4 gene, a composition for inducing male sterility of rice, and male sterile rice. Specifically, a method for producing male sterile rice comprising the step of inhibiting the expression of the OsAGPL4 gene in rice, a step of crossing with a rice (T1) inhibited expression of the OsAGPL4 gene and a parent rice germ (T1) whether the male sterile lines of rice (T2) method, a composition for male sterility induced in rice containing formulation for inhibiting the expression of OsAGPL4 gene, the male sterile rice plants expressing the suppression of OsAGPL4 gene, OsAGPL4 gene expression further comprises A method for confirming the male sterility of rice, a method for recovering the fertility of rice including overexpressing the OsAGPL4 gene in a male sterile rice plant in which the expression of OsAGPL4 gene is inhibited, a nucleotide sequence of SEQ ID NO: 1 OsAGPL4 < / RTI > consisting of the polynucleotide & And a method for screening a male sterility inducer of rice, comprising the step of measuring the expression level of the OsAGPL4 gene in a rice treated with a candidate substance.

Rice is a production plant of rice, which is a stock of rice in more than one third of the world, as well as in the world. It is one of economically important crops. To increase the production of this crop, F1 hybrid production through the introduction of male fertility is a technology development that all world researchers are paying attention to. Although the CMS method can be used in rice, it is not practical in terms of production cost or actual usage. In the method of developing a male sterile transformant by genetic engineering, it is possible to use an external toxic gene (bacteria Or plant genes) to induce the death of selective surgical tissues to produce male sterility.

Surgery is the male reproductive organ of the flowering plant, which is composed of many tissues such as tapeworm, endothecium, connective tissue, and vascular tissue and is responsible for the production of pollen. The developmental process of surgery is the first stage in which the shape of the surgery is established and the microspore cells divide and divide to form the microspore of the tetrad, and the first stage in which pollen and surgery are differentiated, and tissue degeneration, dehiscence, And the second stage, in which only some of the various genes involved in this development process are expressed specifically.

For example, Korean Patent Laid-Open Publication No. 2005-0075170 (hereinafter referred to as "Patent Document 1") discloses a rice expression-specific expression cysteine protease gene, a surgical specific expression promoter of the gene, And a method for producing infertile-introduced rice. Patent Document 1 discloses that the cysteine protease gene is expressed in a surgical specific manner, and thus it is disclosed that it is possible to produce male sterile rice using the cysteine protease gene.

Korean Patent Laid-Open Publication No. 2009-0069397 (hereinafter referred to as "Patent Document 2") relates to a UGPase1 gene of a plant having multiple expression, which induces opacity 100-fold expression and male sterility. In Patent Document 2, the UGPase1 gene is involved in the male sterility of rice.

In addition to the genes disclosed in Patent Document 1 and Patent Document 2, many genes are expected to be expressed in rice. However, only a small number of genes have been found to be involved in the genes.

In addition, Korean Patent No. 0780486 (hereinafter referred to as "Patent Document 3") relates to "rice OsAGPL1 gene, OsAGPL3 gene or OsAGPL4 gene and plant transformed with said gene". In Patent Document 3, the OsAGPL4 There is no disclosure or implication of the possibility of inducing male sterility as a gene.

Therefore, although it is possible to introduce a more diverse gene into rice, and to introduce it into the male sterility of rice, the research on this is currently in short supply.

Under these circumstances, the inventors of the present invention found a gene expressed in rice and tried to intro- duce it into male sterility. As a result, OsAGPL4 gene involved in pollen development was identified and expressed in rice, and male sterility was induced And the present invention has been completed.

Patent Document 1: Korean Patent Publication No. 2005-0075170 Patent Document 2: Korean Patent Publication No. 2009-0069397 Patent Document 3: Korean Patent No. 0780486

The main object of the present invention is to provide a method for producing OsAGPL4 And suppressing the expression of the gene. The present invention also provides a method for producing male sterile rice.

Another object of the present invention is to provide a method for producing a male sterile rice (T2), which further comprises a step of crossing the expression of the parent OsAGPL4 gene with rice (T1) inhibited, and the parent male rice (T1) .

It is another object of the present invention to provide a composition for inducing male sterility of rice comprising an agent for inhibiting the expression of OsAGPL4 gene.

Another object of the present invention is to provide a male sterile rice in which the expression of OsAGPL4 gene is inhibited.

Yet another object of the present invention is to provide a method for identifying the male sterility of rice including the step of determining the expression of OsAGPL4 gene.

Yet another object of the present invention is to provide a method The present invention provides a composition for identifying male sterility of rice, comprising an agent for measuring mRNA or protein level of a gene.

Yet another object of the present invention is to provide a method The present invention provides a method for regenerating rice, including overexpressing the OsAGPL4 gene in a male sterile rice strain in which gene expression is suppressed.

It is still another object of the present invention to provide a composition for restoring rice fertility comprising OsAGPL4 gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO:

It is another object of the present invention to provide a method for screening a male sterility inducer of rice, comprising the step of measuring the expression level of OsAGPL4 gene in rice treated with a candidate substance.

The present inventors confirmed that OsAGPL4 is a gene involved in pollen development while carrying out various studies to produce male sterile-induced rice, and confirmed that male sterile rice can be produced by inhibiting the expression of OsAGPL4 gene Thus completing the present invention.

The fact that the production of male sterile rice is possible by inhibiting the expression of the OsAGPL4 gene in rice is not known at all and has been identified for the first time by the present inventor.

In one aspect of the present invention, the present invention provides a method for producing male sterile rice comprising inhibiting the expression of the OsAGPL4 gene in rice.

The method for producing male sterile rice is to inhibit the expression of OsAGPL4 gene in rice, thereby decreasing the amount of flower pollen to induce male sterility of rice.

The term " rice " in the present invention is Oryza sativa L. and is an annual herbaceous plant. The rice in the present invention is selected from the group consisting of Japonica type, Indica type and Javanica type Lt; / RTI >

In the present invention, the term " OsAGPL4 " may refer to a gene represented by SEQ ID NO: 1, but may also be interpreted to include a sequence showing substantial identity thereto. Said substantial identity aligns the sequences of SEQ ID NO: 1 with any other sequence to the greatest extent of correspondence, and when at least 60% of the sequence identity is analyzed using an algorithm commonly used in the art Homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology. Or the gene may refer to a gene encoding a protein exhibiting a physiological activity substantially equivalent to the protein OsAGPL4 encoded by the gene of SEQ ID NO: 1.

In the present invention, the term " male sterility " means a phenomenon in which moisture, fertilization, and seed development are not performed due to morphological or functional abnormalities of male organs, and when expressed as an environmental transient mutation or as a genetic trait However, the male sterility in the present invention may be induced as a genetic trait. In particular, the male sterility in the present invention may be induced by inhibiting the expression of the OsAGPL4 gene in the nucleus involved in flowerpot production.

In the present invention, the step may be performed by substituting or eliminating one or more bases of the OsAGPL4 gene. For example, 10% of the total DNA, specifically 0.01% or more, of the DNA may be substituted or deleted.

The step may also be performed by T-DNA insertion. The T-DNA in the present invention may be inserted into the intron or exon of the OsAGPL4 gene. For example, according to the result of genotyping analysis on the T2 progeny of the T-DNA-inserted rice, the mutant-homozygous mutant isozyme conjugated to the OsAGPL4 gene with co-segregation in the next generation Male sterile rice can be produced with a significant overall delay in pollen development. That is, the male sterile rice plants exhibit abnormal pollen development, and the operation may include a very small number of pollen. In the present invention, the position of insertion of the T-DNA into the OsAGPL4 gene is not particularly limited, and may be inserted into the ninth exon according to a specific embodiment (FIG. 2). According to an embodiment of the present invention, it is possible to produce OsAGPL4 mutant using the CRISPR / CAS method. In one embodiment of the present invention, one or two nucleotide sequences may be inserted into the fourth exon 2).

In addition to the foreign gene that can be inserted into a plant genome such as T-DNA, the above step may be performed by using an endogenous transposon such as TOS17 or by injecting X-ray or gamma-ray to induce mutation, RNAi, or antisense methods, but are not limited thereto.

For example, the method may further comprise the step of crossing the expression of the parent OsAGPL4 gene with rice in which the expression of the gene is suppressed, and the parent male parent with rice. Conversely, the Deputy OsAGPL4 The addition of the step of crossing the rice with the suppressed gene expression and the rice of the common male germ can not produce male sterile rice.

In another aspect, the present invention provides a method for producing male sterile rice (T2), comprising crossing the expression of the parent OsAGPL4 gene with rice (T1) inhibited, and subordinate male germ (T1) to provide.

It is possible to produce rice (T2) of male sterile lineage by crossing the rice (T1) inhibiting the expression of the parent OsAGPL4 gene and the rice (T1) of the parental male gametone, In the case of crossing of the rice with inhibited gene expression (T1) and the parental male germ (T1), male sterile rice (T2) can not be produced.

The mating method in the above-mentioned crossing is most commonly carried out by using the most popular method for the crossing breeding.

In another aspect, OsAGPL4 A composition for inducing male sterility of rice, comprising an agent for inhibiting the expression of a gene.

The formulation OsAGPL4 Refers to a substance capable of directly or indirectly binding to a gene or mRNA to inhibit the expression of OsAGPL4 .

For example, the agent may be OsAGPL4 But are not limited to, siRNAs, shRNAs, miRNAs, and antisense oligonucleotides that specifically bind to the mRNA of the gene. That is, the siRNA, shRNA, miRNA, or antisense oligonucleotide OsAGPL4 Can specifically bind to the mRNA of the gene and inhibit translation for OsAGPL4 protein synthesis.

In another aspect, the present invention provides male sterile rice in which the expression of OsAGPL4 gene is inhibited.

The rice may be any one selected from the group consisting of Japonica type, Indica type and Javanica type and is applicable to all rice varieties.

The male sterility of the rice may be reversible. That is, the fertility of the male sterile rice can be restored by the introduction of the normal OsAGPL4 gene.

In another aspect, the invention OsAGPL4 And determining the expression of the gene. The method of the present invention is a method for identifying the male sterility of rice.

If the expression of the OsAGPL4 gene is inhibited, the male sterility of the rice can be confirmed.

The determining step may be performed by measuring the mRNA level of the OsAGPL4 gene or the level of the protein expressed therefrom.

The mRNA level of the gene can be measured using a separate preparation. The agent for measuring the mRNA level of the gene may be, for example, a primer or a probe capable of specifically binding to the gene, but is not particularly limited thereto. The "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a complementary template and serving as a starting point for template strand copying Quot; means a short nucleic acid sequence. Primers can be used to initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

Methods for measuring mRNA levels of the genes include RT-PCR, quantitative real time PCR, competitive RT-PCR, real time quantitative RT-PCR, RNase protection assay RPA, RNase protection assay, Northern blotting, and DNA chip analysis.

The level of the protein can be measured using a separate preparation. The agent for measuring the level of the protein may be, for example, an antibody or an aptamer that specifically binds to the protein, but is not particularly limited thereto.

The "antibody" means a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody can be produced by a conventional method from the obtained protein by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene. The form of the antibody is not particularly limited and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention, and all immunoglobulin antibodies may be included. In addition, it may include a special antibody such as a humanized antibody. In addition, the antibody comprises a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and can be Fab, F (ab ') 2, F (ab') 2, Fv and the like.

The term "aptamer " refers to a single-stranded oligonucleotide, which refers to a nucleic acid molecule having binding activity to a given target molecule. The aptamer may have various three-dimensional structures depending on its nucleotide sequence, and may have a high affinity for a specific substance such as an antigen-antibody reaction. An aptamer can inhibit the activity of a given target molecule by binding to a predetermined target molecule. The aptamer of the present invention may be RNA, DNA, modified nucleic acid, or a mixture thereof, and the form thereof may be linear or cyclic, but is not limited thereto.

Methods for measuring the level of the protein include, but are not limited to, western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, Immunohistochemical staining, immunoprecipitation assays, complement fixation assays, immunofluorescence assays, immunofluorescence assays, immunofluorescence assays, immunofluorescence assays, immunofluorescence assays,

Immunochromatography, fluorescence activated cell sorter analysis (FACS), and protein chip technology assay, but the present invention is not limited thereto.

In another aspect, OsAGPL4 There is provided a composition for identifying male sterility of rice, comprising an agent for measuring mRNA or protein level of a gene.

The formulation contains the OsAGPL4 A primer or a probe capable of specifically binding to a gene.

The formulation contains the OsAGPL4 An antibody or an aptamer that specifically binds to a protein.

In another aspect, the invention in inhibiting the expression of male sterile rice lines of OsAGPL4 gene, OsAGPL4 And overexpressing the gene of the present invention.

For example, in the above step, a vector containing OsAGPL4 gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 may be transformed into rice to induce regeneration of rice.

Specifically, this step operably links a plant promoter with a gene of SEQ ID NO: 1 and a plant promoter such as the actin promoter, cytochrome c, ubiquitin (ubi) promoter (Pubi) But may be carried out by inserting a DNA fragment containing the gene of SEQ. ID.

In another aspect, the invention OsAGPL4 The present invention provides a composition for restoring the fertility of rice.

The OsAGPL4 gene may be a gene represented by SEQ ID NO: 1, but it may also be interpreted to include a sequence showing substantial identity thereto. Said substantial identity aligns the sequences of SEQ ID NO: 1 with any other sequence to the greatest extent of correspondence, and when at least 60% of the sequence identity is analyzed using an algorithm commonly used in the art Homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology. Or the gene may refer to a gene encoding a protein exhibiting a physiological activity substantially equivalent to the protein OsAGPL4 encoded by the gene of SEQ ID NO: 1.

In another aspect, the present invention provides a method for screening a male sterility inducer of rice, comprising measuring the expression level of OsAGPL4 gene or a protein thereof in rice treated with a candidate substance.

The method of measuring the expression level is as described above.

The method may further include the step of determining the candidate substance as a male sterility inducer of rice when the measured expression level is lower than the expression level of rice not treated with the candidate substance.

According to the present invention, it is possible to produce male sterile rice by inhibiting the expression of the gene OsAGPL4 gene in rice. It is possible to induce male sterile rice, and it has become possible to produce male sterile rice by a variety of methods because it has found a new gene that can produce male sterile rice. Since the male sterility strains that regulate OsAGPL4 gene activity can be used stably without being affected by the environment, it is expected to replace the cytoplasmic genetic male sterility strain and the temperature - and senescence - sensitive nucleus gene male sterility strain.

FIG. 1 is an electrophoresis image showing that OsAGPL4 among four ADP-glucose pyrophosphorylase large subunit genes was specifically expressed in the late phase of pollen development through the expression pattern of ADP-glucose pyrophosphorylase large subunit.
FIG. 2 is a schematic diagram of mutation generation induced by T-DNA insertion site and CRISPR / CAS method of OsAGPL4 dysfunction mutants.
Fig. 3 (a) is a wild type, (b) is OsAGPL4 heterozygote, (c) is osagpl4 -2 homozygote (d) is a photograph showing the result of the iodine staining osagpl4 -3 homozygote. In addition, photographs inserted inside the photograph are the result of pollen nucleus staining, white arrows are generative nucleus and red arrows are vegetative nucleus.
Figure 4 is a measure of the wild-type, ADP-glucose pyrophosphorylase activity of the osagpl4 -2 / osagpl4 -2 and -3 osagpl4 / osagpl4 -3.
5 is a measured by measuring the amount of starch in the collected mature pollen of the wild-type, osagpl4 -2 / osagpl4 -2 and -3 osagpl4 / osagpl4 -3, ADP-glucose pyrophosphorylase activity.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example  1: Materials and Methods

≪ Example 1-1: Plant material >

Greenhouse cultivar japonica rice (variety: Dongjinbara) wild type and mutant were used for the experiment. Rice were cultivated in a greenhouse at a temperature of 30 ° C in the daytime and 20 ° C in the nighttime at a darkness of 14/10 and humidity of approximately 80%. For RT-PCR, anther from wild type rice was recovered at different developmental stages.

≪ Example 1-2: RT-PCR analysis >

Total RNA was extracted using Trizol reagent. One-strand cDNA was synthesized from full-length RNA by reverse transcription using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, Calif., USA). The rice ubiquitin 5 (OsUBQ5, LOC_Os01g22490) gene was amplified as an internal control to quantify the relative amount of cDNA. The primers were designed within a region containing at least one intron of each gene to exclude genomic DNA incorporation. Table 1 shows the primer sequences used for RT-PCR.

order SEQ ID NO: OsAGPL1 Forward TTCCTTTTCTTGATCTCTCTTCTA SEQ ID NO: 2 Reverse CTCCTGACAAGATTAAAATGTGTT SEQ ID NO: 3 OsAGPL2 Forward AGAGGTTGATGGAAAGATTGAATA SEQ ID NO: 4 Reverse CTGATCTCCACACAAGATTACAAC SEQ ID NO: 5 OsAGPL3 Forward GCTAATAAACCAATGTACACATCA SEQ ID NO: 6 Reverse GATGACTAATCCATCTGCAATTAT SEQ ID NO: 7 OsAGPL4 Forward GATATGGGAACTTTTGGTTTG SEQ ID NO: 8 Reverse TGCAGTTTTCTACTTTCGTTG SEQ ID NO: 9 OsUBQ5 Forward GACTACAACATCCAGAAGGAGTC SEQ ID NO: 10 Reverse TCATCTAATAACCAGTTCGATTTC SEQ ID NO: 11

<Example 1-3: Preparation of osagpl4 T-DNA insertion mutant>

The osagpl4 -1 mutant alleles of rice T-DNA insertion sequence database (Jeon et al, 2000;. An et al, 2003;. Jeong et al, 2006;. http://www.postech.ac.kr/life/ pfg / risd / index.html). Genomic DNA was isolated from young leaves of rice using a simple mini-prep (Chen and Ronald, 1999) method. The pollen was transferred under a microscope using a tip of a sophisticated pipette. And pulverized using a small rod in a PCR tube for use as a genomic DNA template thereof. Genotype caused by T-DNA insertion using only LF1 / LR1 LR1 and / G1 primer set for osagpl4 -1 was determined by genomic DNA PCR analysis. The sequences of the primers used are shown in Table 2.

Name of the primer order SEQ ID NO: LF1 TGCATATGTTAAATCATCCACGGTTTTAT SEQ ID NO: 12 LR1 ACCAATAACAGAGCGATCAACACTACATT SEQ ID NO: 13 G1 ATCCAGACTGAATGCCCACA SEQ ID NO: 14

&Lt; Example 1-4: Reverse mating >

For breeding station, OsAGPL4 / osagl4 - japonica cv 1. Ilpum was crossed with wild type rice. The genotypes of the crossed strains were determined by PCR using the same primer sets used for the T-DNA inserts (Table 2).

<Example 1-5: Preparation of OsAGPL4 mutation using CRISPR / Cas>

In order to find an effective protospacer adjacent motif (PAM) and to avoid off-target, the present inventors used a CRISPR direct program (Naito et al., 2015; http://crispr.dbcls.jp/) The target sequences available were screened. The designed guide RNA (5'-GCAGTTCCTGTGGCTATTTG-3 ', SEQ ID NO: 15) was cloned into the pOs-sgRNA as the start vector using the Gateway ™ system (Miao et al., 2013) . &Lt; / RTI &gt; The resulting vector, Agrobacterium mediated by Jeon et al., 2000, Dongjin was transformed. The sequence of the target PAM position of the transgenic plants was confirmed. These CRISPR / Cas 1 using the fourth exon of OsAGPL4 or 2 the nucleotide sequence of the insertion mutants were named, respectively, each osagpl4-2 or osagpl4-3.

&Lt; Example 1-6: Measurement of starch >

Rice leaves 100 mg and 3 mg of mature anthers including pollen were isolated from mature flowers of rice and rice at 12 weeks of age, respectively. The non-consuming starch was measured by the NAD (P) H-binding enzyme test (Lee et al., 2008) in the ethanol-insoluble fraction. The contents of the measured metabolites were normalized based on the weight of the received leaves.

&Lt; Example 1-7: Measurement of AGP activity >

Anthers containing the pollen (3 mg) were suspended in a solution containing 50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5% glycerol, 5 mM EDTA, 5 mM DTT, 1 x proteinase inhibitor and 1 mM PMSF And resuspended in lOOul of lysis buffer. These samples were collected at the bottom of the tube by centrifugation at 1,000 g for 5 minutes at 4 ° C. The collected samples were then ground using a mortar in a 1.5 mL tube on ice. And ultrasonicated twice for 5 seconds using a Sonic Dismembrator (Model 100, Fisher Scientific, Pittsburgh, Pa.). The dissolved protein was obtained by centrifugation at 15,000 g for 10 minutes at a temperature of 4 ° C. And used for enzyme activity analysis. AGP activity was measured directly via starch synthesis (ADP-Glc formation) as described in Hwang et al. (2007). Specifically, the reaction was carried out by adding 100 mM HEPES-NaOH (pH 8.0), 5 mM DTT, 10 mM MgCl ₂ , 2 mM ATP, 5 mM 3-phosphoglycerate, 0.15 units / reaction inorganic pyrophosphatase (Sigma) Was carried out in 0.1 mL of a solution containing 0.4 mg / mL BSA, 2 mM [14C] Glc-1-P (517 dpm / nmol). [ ^14C ] ADP-Glc formulations were measured using a Tri-Carb 2100TR Liquid Scintillation Counter (PerkinElmer, Boston, Mass., USA).

&Lt; Example 1-8: Pollen staining and optical microscopic analysis >

The pollen was incubated in phosphate-buffered saline containing 4 ng / mL Hoechst 33342 (Sigma, St. Louis, Mo., USA) at 65 ° C for 1 hour to stain the nuclei of the pollen. Pollen starches were stained with 10% (v / v) Lugol solution (Sigma). Nuclear and starch-stained pollen were monitored under UV and white light, respectively, on an Olympus BX61 microscope.

&Lt; Example 1-9: Transmission electron microscopy analysis >

During development, pollen at the mature stage was fixed in phosphate buffer containing 3% glutaraldehyde. Subsequently, 2% osmium tetroxide was used for subsequent fixation. After dehydration, the sample was placed in a low viscosity, formazed mixture of Spurr. Thin sections (40-60 nm thickness) were stained with 2.5% uranyl acetate and 2.5% citric acid lead salt aqueous solution. And observed with an electron microscope (Tecnai G2 Spirit (FEI Co., Hillsboro, OR, USA)).

Example  2: derived from rice OsAGPL4  Pollen development of gene By stage  Expression analysis

RT-PCR was performed as in Example 1-2, and the synthesized DNA was observed at each stage of pollen development. It was confirmed that the expression of ADP-glucose pyrophosphorylase large subunit genes was particularly enhanced only at the pollen development stage, that is, at the late stage of development in which starch was synthesized, and this result was consistent with the results of the Genevestigator database ). this is OsAGPL4 may be important for pollen synthesis.

Example  3: OsAGPL4  Mutant production

OsAGPL4 mutants were prepared using the methods of Examples 1-3 and 1-5. After preparing the preparation, one OsAGPL4 mutant which lost the function of the wild-type OsAGPL4 gene was prepared by inserting T-DNA into OsAGPL4 of rice and named osagpl4-1. Also CRISPR / Cas 1 using the fourth exon of OsAGPL4 or two nucleotide sequences is inserted each mutant were named respectively osagpl4 -2 or osagpl4-3 (Fig. 2). The double T-DNA insertion is specifically performed using a Ti plasmid binary vector pGA2144 (Jeon et al., The Plant Journal (2000) 22 (6), 561-570) and rice cells (callus derived from Dongjin- Were co-cultured and T-DNA was inserted into the plant. osagpl4 -1 includes a T-DNA insertion in the ninth exon.

Example  4: OsAGPL4 Including Mutants Male sterility  Production of rice seedlings (T2)

The OsAGPL4 mutant (T1) prepared in Example 3 was self-hydrated to produce T2 progeny. As a result, the ratio of wild type (WT): heterozygote: hemozygote was 1: 1: 0 without normal isolation ratio of 1: 2: 1. Since this is a typical genetic type isolation of the infertile lineage, it is predicted that OsAGPL4 will have a function to induce infertility. Table 3 shows the ratio (%) / predicted ratio (%) observed in T2 and the number of plants observed / the number of plants estimated.

T1 T2 Observed (%) / predicted (%)
Number of plants observed / number of plants estimated OsAGPL4 / OSagpl4 -One OsAGPL4 / OsAGPL4 OsAGPL4 / OSagpl4 -One OSagpl4 -One/ OSagpl4 -One 48.5 / 25
50/103 51.5 / 50
53/103 0/25
0/103

Example  5: OsAGPL4 / OSagpl4 Male sterility  Phenotype verification

In order to verify the male sterility phenotype of the OsAGPL4 / osagpl4 strain, the genotype of the later seeds was examined after reverse mating according to Example 1-4. As a result, when the ovalbumin was OsAGPL4 / osagpl4 and the sample was OsAGPL4 / OsAGPL4 , Genotype did not appear. On the other hand, the ratio of wild-type (WT): heterozygote: homozygote to that of OsAGPL4 / OsAGPL4 and OsbergPL4 / OsagPL4 is the ratio of 1: 1: 0 (Table 4). Thus, it was confirmed that OsAGPL4 gene induces male sterility.

Reciprocating target Reverse mating result counterpart Example Observed (%) / predicted (%))
Number of plants observed / number of plants estimated OsAGPL4 / OSagpl4 -One OsAGPL4 / OsAGPL4 OsAGPL4 / OsAGPL4 OsAGPL4 / OSagpl4 -One 100/50
87/87 0/50
0/87 OsAGPL4 / OsAGPL4 OsAGPL4 / OSagpl4 -One OsAGPL4 / OsAGPL4 OsAGPL4 / OSagpl4 -One 48.4 / 50
45/93 51.4 / 50
48/93

On the other hand, osagpl4 -1 strains osagpl4 -2 or osagpl4 -3, while using the system, CRISPR / CAS method is not able to produce a homozygous modifications could be separated from a homozygous transgenic contemporaries. Using this, iodine staining of the amount of starch in the pollen of OsagPL4 / osagpl4 -1 , osagpl4-2 / osagpl4-2 and osagpl4 -3 / osagpl4 -3 showed that the wild type (FIG. 3 (a) Although many starches were stained, only 50% of the pollen of OsAGPL4 / osagpl4-1 (Fig. 3 (b)) was stained. Also osagpl4-2 / osagpl4-2 ((c) in Fig. 3), osagpl4 -3 / -3 osagpl4 ((d) in Fig. 3) was identified that is not all pollen staining (Fig. 3). Through this, OsAGPL4 Mutant mutants were identified as male sterile phenotype due to lack of starch in pollen. In addition, Figure 4 is wild-type, osagpl4 -2 / osagpl4 osagpl4 -2 and -3 / osagpl4 will measurement of the ADP-glucose pyrophosphorylase activity of the -3, 5 is a wild type, osagpl4 -2 / osagpl4 -2 and osagpl4-3 / osagpl4 -3 mature pollen was collected and the content of starch was measured to measure ADP-glucose pyrophosphorylase activity. As a result, even through the 4 osagpl4-2 / osagpl4-2 and osagpl4 -3 / osagpl4 - 3 It was verified that each of ADP-glucose pyrophosphorylase activity was reduced to 18.6% and 23% as compared to the wild type. Also through 5 osagpl4 -2 / osagpl4 -2 and -3 osagpl4 / osagpl4 - 3 was confirmed that the starch content decreases by about 65% as compared to the wild type.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Preparation method of male sterility rice using OsAGPL4 gene,          composition for inducing male sterility of rice and male          sterility rice <130> KPA161099-KR <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 6783 <212> DNA <213> Oryza sativa <400> 1 tcccctcccc tctcctactc cgccaccttc gcccttctag aaccttcccg cgtccgccaa 60 tggcgacctg ctcgtgggcc gccaccacgg cggcggcggc gcccccccgc ccgcccgcca 120 ggtgccgctc gcgcgtcgcc gcgctccgcc gcacggccgc cgcctccgcc gccgccgcca 180 gctgcgtcct cgccgaagcg cccaaggggc tcaaggtagg tggctggcta gctccgtgtt 240 cgcgcgtgcg cgcgtgcgtg cgtgttggga ttgcgtgagc tgatctcctg tgcgttgggt 300 gcggattcat tggtttggtt ttgtgttttg gtgtgccaag gtggagcagg cggatgcggt 360 cgagccagcg gcggcggcgg cggcgcggag ggacgtgggg ccggacacgg tggcgtccat 420 catcctcggc ggcggcgccg gcacgcgcct cttccctctc acgcggacca gggccaagcc 480 cgcggtaatc aaatcacatt atcctttctt tacagtgttt acacgcacat ttcgtcatgc 540 atttgataag catttcattg gttgtgtgca atagtgggga tttcggttgc tattgacacc 600 attgactatt ggttgattga atcgtgagat gcttacatca ttagtgattg agctgtatgt 660 tcttggtacg tcaggtgcct gttgggggat gttacaggct gatcgatatc ccgatgagca 720 actgcataaa cagcaagatc aacaagatct acgttctcac ccagttcaac tcccagtctc 780 tcaaccgtca catcgcgcgc acttataaca ttggcgaggg ggttggattt ggtgatggct 840 ttgtggaggt aagattagtg tttgttatga ggtgaaatcg agtggaaaca tgcagctgtg 900 gcaatgggtc ggtgatctct aattgataat gttctacggt ggtttgtttt gattgttggg 960 taggtgctgg cagctaccca gacaacaggg gaatcaggaa agcgatggtt ccagggaaca 1020 gccgatgctg tcaggcagtt cctgtggcta tttgaggttt gtctagtgtc atctcatgat 1080 attgtactct tatcacggga tgttatcgct ttcccagttt taacttgcct gattttttta 1140 caaggatgca aggctcaaac gcatagagaa catactaatt ctatctggtg atcatctgta 1200 taggatggat tatatggact ttgtccaggt gaacttcatg ttgatattct agagcaaaga 1260 ttatttttgc actttatttg agtattgtaa aaaaaaaaaa tctaaatgat gagttgtttt 1320 gcagaagcat gttgacaaag gtgctgatat ttcagtcgct tgtgttcctg tggatgagag 1380 gttattcata attgccctat ctgaatcgtt ttcttttttt taatctgtct ttattctagc 1440 tagttagcag gactgtacat gctgtaattc ttcacagttt tagaagttta ctttttgtca 1500 cgctaatcat caatattact tgtgaatatc ataatattgt attgcaaatt aacaagtaga 1560 caatacacgt ggatttccat atttaattga tgggtcagat gatgacatac acctctcata 1620 tttttttaaa atttgtgtca tctacttgca gtcgagcttc tgattttgga ttgatgaaga 1680 ctgacaagaa tggacgcatt actgattttc tcgaaaagcc caaggatgaa agcttgaaat 1740 caatggtata tgcctcttca ctgaatcaaa gacaaatgaa tactaaaaat tatttgttta 1800 cacatgttta aactgaattg ttacctgaaa aaggtgtaaa atgaatgcat tccatcacct 1860 ttaattgcat atgttaaatc atccacggtt ttattcacaa ggcttttgtt ttgcttttgt 1920 gaatgttatc tagattattg gagatttgtt ctttatttct ttatcattag ctcaatttcc 1980 ttgatttatt ggctctaacg aataagtttt taaataatct aagatattta ttaatgcagc 2040 aactagatat gggaactttt ggtttgcgcc cagaagttgc agatacatgc aaatacatgg 2100 cttcaatggg aatatatgta ttcaggactg atatcttgtt aagacttcta aggtaaatgc 2160 taatgattaa gactaaggta aattctaatg ataatatctc atgagcaatg ctttccttaa 2220 tcttggaaac taggtttgca tgataaataa atgttccagt tgcattgtag ttttatcttc 2280 tatatcaagc atttggtttc tgtaacttta ttttctgatg catggcaaag tcaaatgtgc 2340 aaaaataaca aatggtttgt tatatatgat aagacatact gttggtttta tttgctgaga 2400 tagcattcct gggattgtct gcactccttg gttcttattt ttcttgccag tttgaggtat 2460 gctgatactc tttctctttg ttctgtatct tttagaggac attatcctac agcgaatgat 2520 tttgggtcag aagttatccc aatggctgca aaagactaca atgtgcaggt atttacaact 2580 tcataatcct tcaaactgta tgtacgcaag aaattccatt gtcataaatc aaccgttaga 2640 aattcttcaa atcccaaaat gagcatgtga tcttactttt cacaaaaccc tgaatatgaa 2700 tgcaatattc cttgttctgt ggtgacaggc ctatctattt gatggttact gggaagatat 2760 tgggacaata aagtcattct ttgaggcaaa tcttgctctc acagatcagg tttacttttt 2820 tagttaacat catctccatc tatatcttta tgtgcgtgga caatttatct aaattcagtt 2880 atcttctttg tagtcgccaa acttctattt ttatgatcct gtgaagccca tattcacatc 2940 tcctagattt ttacctccaa cgaaagtaga aaactgcaag gtcagattct cttagagatg 3000 gtttctttgg ttataccttc agtagcagct ttttttgatc taaccattta cgtgcaggtt 3060 ctgaactcta tagtttccca tgggtgcttt ctaacagaat gtagtgttga tcgctctgtt 3120 attggtgtcc gttcaagatt agaaccgggg gtgcagctga aggtgaattg ttgaatactc 3180 ataattcaat gtacttgaca gttatttgga actcataagt ttgccattca aataattgag 3240 gcagagatgg atgaaagcat accaatacag aatcttagga actaagcctg cacgaacaat 3300 cttcggaaat tgtatttaaa gagaaaatac tgtttcccaa atcccaatgc tagataaacc 3360 agagataaat tagtcttttt tctaatattt tggccatttg gatacaatcc atttatttta 3420 gcttctatta tcattaacat tattagaacc acaggaaaca ggttgcaagt tccatttatt 3480 ttcccttgat cacagtgttc tctttttttc ttcaatacct gcatttactg cagtctcgcc 3540 atgtcctatt gatgccatgc gagttttttc ccctagtttt gttggcattt atgcccttaa 3600 ccatgaaaga tttgcacata gtttttaaac cacagaaagt acatttagtc ataccaactt 3660 atgctgaagc aatcactaag taccctacat gttggtaatg gtctaatgga tttttttttt 3720 catttttatt gaacaatgga tgtttaatta tttcaatatc gttaacaaaa agaaaatcaa 3780 ctgggtatag gacaccatga tgatgggggc agattactat cagactgaag ctgagagatt 3840 ttctgaattg tctgatggaa aagtaccagt tggcgttgga gaaaacacca taataaggtc 3900 agtatgagca atgatgcata tatgtatttg gtaacttgcc tgttatgtaa tgctaagttt 3960 tgacatacag gaactgtatc atcgacaaga atgctcgaat tggaaagaat gtaatgatta 4020 tgaactcaca ggtatgaccc ccatgcataa gactatttct tagtatcatt gtctaggaga 4080 gccttctgga ttcttctttg caatgatctt tataacattt gcaagctcat ttccacaacc 4140 gtttagtgaa gataagatga ctccattaaa ttcattcact tcattgagca tgttggtttt 4200 atggaattcg aaatttgtaa caagtatgta tcgcaggagc aaggaaaaaa tgcacttttt 4260 ggaaaggtag caaagtatgt attagtgtta atgtctactt agagaaaaaa aaagcctcat 4320 atctaaaatgg tgggaggaaa attcattcaa tctactaaag cgctctttca 4380 acctatttgg ccttcattgc acatagttca tcgtagcagc ttttgcaact tgcttgtcta 4440 tgctattaaa tatatatgca gtttttcttt agtcattaag tttacagttc aaatgctgag 4500 acctaagagt tttcccttgc ttgtgtgaat gcagaatgtg caagaagcag agagaccatt 4560 agagggtttc tacattcgtt ctgggataac ggtagtgctt aaaaatgcgg tgattccaga 4620 tggtacagtt atctagagaa tcaccaaagg aaatatttgc aggtgagttt ctccaaatgc 4680 tttattcaat taggattata aaaatatcag ttcgattgga caaaagcgca ccattctgaa 4740 gtttggtaga caagaaatgc tcctcgtaaa tgttggtatc aataaacaag aatatatacg 4800 cacacaataa acaaaaaaaa attccaaagc tgtttattgt ttacaacacc tgaattgcct 4860 atgtggtacg gtattttctt ctgcaaacta acaagatgca taatcatttt gatattgata 4920 gctggaagga tattatagat gtccaactac tccatataca tgttacatgg cttataatag 4980 aaaagttctg ccactaagct tagcatagat attgtggatg ttcattctag aaagtttctt 5040 tatcttgttt atgactcctt tgtgaggaca gtaacatatt cttttgatag gagtttaacg 5100 acagctacca tattctcaat aacctcccac acactgcata gtagatttat tgtcccaaaa 5160 acaatttcac ggtatttggt gtgacatgga atttagatac tatgacttgg atgactgttc 5220 aaaatttcaa ataactcaga acttaggtct gatatgtcgg tcatatctgg atctgtagta 5280 ccgtgagata tggcatgagc acgagtttat ttgtagctct cagatctaga atgtccaaac 5340 atcaactttc ataaaattag ttgatccgag gtgtgtttat ggtttttttt ctttttgtga 5400 gaggaggtgt gtttatggtt attacatgga tttccaactt caatcatgac tgagtttttg 5460 ttaacttctc ggggttggcc ttttcttttt ttagtctgtg catgaacaaa gaaagacatt 5520 aaaattaagt taccaaatag tttttgtcat tgtagtatgt acaggacttt gtcaggatcc 5580 attaccaact tactggatgt gtagcatcat ctattgcttt taaatacaaa tcttgctact 5640 tgcagatatc aatcccttct ggtttgttgc atttgaagta catctttgaa actcataagg 5700 ggatctgagt tcgaccttca acgtcgatgc agcaaataaa cttaatacag tgcaaaggtt 5760 gccagcttat gaatgaggct aggaactgag ggatatatca cctgcatcgg catggcaaga 5820 acgttttggt tctttcgtaa gcgtcaaaag caatatatca agaacttctg ccatgcacat 5880 gaatacagga tatatataat acttagaaat atttcatgtc ggtaattgta tatgcatgta 5940 gaagcgagag ggtataatct gttgtgagtt aaatgtgatt acattgagta ataataatta 6000 cttgtagaag aagtacattt ctgtcacgtt gtagggttta tcttgtaccg caaaaaatca 6060 ctgactgttg cttatccatg aattaacttc ctctgatgta tatttatatt tgtgaattat 6120 caagagatcg aaataaatac tgtactactc tttgattgat gaaacatatc acatgagaag 6180 tagagaagta atcgcatcat ggatcagaat caacaaagtg gtatgtatgt ttgcgagccc 6240 ttaaatcaga ttatcagaat caagtcatgg agctttcttc ttcagacagt agcagatatg 6300 agttcggcgt ctactctttc ttggagaaga gcccgccaaa gctgaacccg ccgtcgccgt 6360 cgccgtcgcc ggccgccttc ttggccggag cgccgctggc cttggtggcc ctggacgcgg 6420 cggcgggggc cttctcctcg accttgttga ggatggggtc ggtctccagc agctgctcct 6480 ccttgtacag cgcgccgaag atggcgtcga agaggccctt ctcctccgtc gccgccgccg 6540 ccgtgacgct cttcgtcgcc gacggccgcg ccacgcgtgc ggacggcggc ggcggcgccg 6600 ccgcccgacg gtggctcagg cgtctcccgg cggccaccgc cggcgccacc gtggtgccga 6660 aaccaaccga cgccatcgct agcttttgtg tgcctacgtg atgtgtgtgc gcctgtgaag 6720 cgtgggcgtg tgcacggtca cttctttttt ttgtggtgcg ttttgagctc tcgtgggtct 6780 tga 6783 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL1 Forward primer <400> 2 ttccttttct tgatctctct tcta 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL1 Reverse primer <400> 3 ctcctgacaa gattaaaatg tgtt 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL2 Forward primer <400> 4 agaggttgat ggaaagattg aata 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL2 Reverse primer <400> 5 ctgatctcca cacaagatta caac 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL3 Forward primer <400> 6 gctaataaac caatgtacac atca 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL3 Reverse primer <400> 7 gatgactaat ccatctgcaa ttat 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL4 Forward primer <400> 8 gatatgggaa cttttggttt g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OsAGPL4 Reverse primer <400> 9 tgcagttttc tactttcgtt g 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OsUBQ5 Forward primer <400> 10 gactacaaca tccagaagga gtc 23 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsUBQ5 Reverse primer <400> 11 tcatctaata accagttcga tttc 24 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> LF1 <400> 12 tgcatatgtt aaatcatcca cggttttat 29 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> LR1 <400> 13 accaataaca gagcgatcaa cactacatt 29 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G1 <400> 14 atccagactg aatgcccaca 20

Claims (18)

1. A method for producing male sterile rice comprising the step of suppressing the expression of the OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1 in rice.
The method according to claim 1,
Wherein said step is carried out by replacing or eliminating some bases of the OsAGPL4 gene.
The method according to claim 1,
Wherein said step is performed by T-DNA insertion.
The method according to claim 1,
The method includes OsAGPL4 A step of crossing the rice with the suppressed expression of the gene and with the rice of the parent male germ.
(T2), comprising the step of crossing the expression of the OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1 with a parent rice strain (T1), and the parent male parentage rice (T1) Way.
1. A composition for inducing male sterility in rice comprising an agent for inhibiting the expression of OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1.
The method according to claim 6,
Wherein the agent is selected from the group consisting of siRNA, shRNA, miRNA, and antisense oligonucleotides that specifically bind to the mRNA of the OsAGPL4 gene.
A male sterile rice wherein the expression of the OsAGPL4 gene containing the nucleotide sequence of SEQ ID NO: 1 is inhibited.
9. The method of claim 8,
The male sterility of the rice is reversible, male sterile rice.
And determining whether expression of the OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1 is present.
A composition for identifying the male sterility of rice, comprising an agent for measuring mRNA or protein level of OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1.
12. The method of claim 11,
The formulation is OsAGPL4 Is a primer or a probe capable of specifically binding to a gene.
12. The method of claim 11,
Wherein the agent is an antibody or an aptamer that specifically binds to the OsAGPL4 protein.
A method for regenerating the rice fungus , comprising overexpressing the OsAGPL4 gene in a male sterile rice plant in which the expression of the OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1 is inhibited.
15. The method of claim 14,
Wherein said step is carried out by transforming a vector comprising OsAGPL4 gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1 into rice.
1. A composition for restoring the fertility of rice comprising OsAGPL4 gene consisting of a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 1.
And measuring the expression level of the OsAGPL4 gene comprising the nucleotide sequence of SEQ ID NO: 1 in the rice treated with the candidate substance.
18. The method of claim 17,
Wherein the method further comprises the step of determining that the measured expression level is a male sterility inducer of rice when the measured amount of expression is inhibited as compared with the expression level of rice not treated with the candidate substance.

Images