KR20210077585A - Manufacturing method of non-functional mutant in first filial generation using CRISPR/Cas system - Google Patents

Abstract

The present invention relates to: a method for preparing a homozygous mutant or heterozygous mutant of a target gene in an F1 hybrid by preparing a transgenic plant in which a mutation for a target gene is induced, by using a CRISPR/Cas system, and crossing the transgenic plant with a wild-type plant; and a method for preparing a male sterile maintainer line or non-GMO plant that can be classified through fluorescence, by using a recombinant vector to which a fluorescently labeled gene is added.

Description

Method for manufacturing loss-of-function mutants in one-to-one hybrids using CRISPR/Cas system {Manufacturing method of non-functional mutant in first filial generation using CRISPR/Cas system}

The present invention provides a method for producing a mutant for a target gene using the CRISPR / Cas system; Method for producing male infertility eujichin; And it relates to a method for producing a Non-GMO plant.

Male sterile mutations due to natural and induced mutations have been reported in several species of higher plants. These mutations have been associated with several different phenotypes, which include structural variations, such as short filaments, lack of dehiscence or flat surfaces, and functional defects associated with gamete formation, particularly meiosis. contains pollen. Both of these mutations produce non-functional pollen.

Male infertility can be divided into nuclear genotype (genic male sterility) and cytoplasmic genotype (cytoplasmic male sterility) according to the genetic pattern. Nuclear genotype male infertility is found because it adversely affects survival. It is mainly recessive, and in the case of homozygous recessive, it takes sterility, so it takes a lot of effort to maintain and propagate sterility. Depending on the flower, it is difficult to determine fertility due to small flowers, and it is difficult to apply to crops that take a lot of time to bloom.

Because cytoplasmic male sterility produces 100% sterile strains by crossing any fertile strain, individuals and strains that can produce 50% or 100% sterility by crossing various fertile strains to sterile strains, that is, maintainers (maintainers) ) is found and planted, so it is inconvenient, but the intended purpose of infertility can be achieved. However, for one-to-one hybrid breeding, artificial male infertility through radiation and chemical agents for obtaining male sterility has also been attempted, but there is a problem in that side effects must be resolved.

Although a lot of investment is being made in the development and research of male sterile plants for producing F1 seeds, the research results on this are very insignificant due to problems with male sterile plants so far. In addition, in many male sterile plant development methods using genetic engineering techniques, most of the cases in which one-to-one hybrids include foreign genes such as herbicide resistance genes, and their use is very limited due to regulations on various GMO crops. If you can overcome the disadvantages of these male sterility plants, that is, if you can secure a stable male sterility and maintain sterility without the need for other maintenance systems, it can be usefully used for easy new variety development and high value-added industrial production. There will be. Therefore, it is possible to secure stable male sterility, and there is a need for research on novel methods or novel genes for maintaining male sterility.

Korean Patent Publication No. 10-2018-0077370

It is an object of the present invention to transform with a recombinant vector into which (a) a polynucleotide encoding a single guide RNA (sgRNA) capable of recognizing a target gene and a polynucleotide encoding a CRISPR-associated nuclease (Cas) protein are inserted. preparing a converted plant; And (b) a method for producing a homozygous mutant or biallelic mutant for the target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant is to provide

Another object of the present invention is to transform with a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a converted plant; (b) crossing the transgenic plant and the wild-type plant; And (c) to provide a method for producing a male sterile maintainer comprising the step of selecting a plant expressing the fluorescent marker protein.

Another object of the present invention is to transform with a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a converted plant; (b) crossing the transgenic plant and the wild-type plant; And (c) to provide a method for producing a Non-Genetically Modified Organism (Non-GMO) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.

Another object of the present invention is a recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent label protein, the polynucleotide encoding the sgRNA Nucleotides are to provide a recombinant vector, characterized in that at least one selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9.

Another object of the present invention is to provide a transgenic plant transformed with the recombinant vector.

Another object of the present invention is to provide a seed of the transgenic plant.

In order to achieve the above object, the present invention provides a recombinant vector into which (a) a polynucleotide encoding a single guide RNA (sgRNA) capable of recognizing a target gene and a polynucleotide encoding a Cas (CRISPR-associated nuclease) protein are inserted Transforming to prepare a transgenic plant; And (b) a method for producing a homozygous mutant or biallelic mutant for the target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant provides

In one embodiment of the present invention, the polynucleotide encoding the sgRNA may be any one or more selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 13 have.

In one embodiment of the present invention, the target gene may be a gene related to male infertility, but is not limited thereto.

In one embodiment of the present invention, the target gene may be any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene, but is not limited thereto.

In one embodiment of the present invention, the Os12BGlu38 gene consists of the nucleotide sequence of SEQ ID NO: 1, the OsHXK5 gene consists of the nucleotide sequence of SEQ ID NO: 4, and the OsPLGG1 gene consists of the nucleotide sequence of SEQ ID NO: 7 can

In one embodiment of the present invention, the transgenic plant of step (a) may be a homozygous mutant or a biallelic mutant.

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a male sterile maintainer comprising the step of selecting a plant expressing the fluorescent marker protein.

In one embodiment of the present invention, the plant expressing the fluorescent marker protein may be a homozygous mutant or a biallelic mutant.

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a Non-GMO (Non-Genetically Modified Organism) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.

In one embodiment of the present invention, the plant that does not express the fluorescent marker protein may be a heterozygous mutant.

In addition, the present invention is a recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein, wherein the polynucleotide encoding the sgRNA comprises: SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11 and provides a recombinant vector, characterized in that any one or more selected from the nucleotide sequence consisting of SEQ ID NO: 13.

In one embodiment of the present invention, the polynucleotide encoding the sgRNA may be at least one selected from the group consisting of the nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 11, and SEQ ID NO: 13.

In one embodiment of the present invention, the target gene may be any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene.

In one embodiment of the present invention, the fluorescent label protein may be one selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP) and cyan fluorescent protein (CFP). , but is not limited thereto.

In addition, the present invention provides a transgenic plant transformed with the recombinant vector.

In one embodiment of the present invention, the plant may be a homozygous mutant or a biallelic mutant for the target gene.

In addition, the present invention provides a seed of the transgenic plant.

The method according to the present invention induces a mutation for a target gene using the CRISPR/Cas system, and then crosses a wild-type plant to generate a homozygous mutant or a biallelic mutant for the target gene in a one-to-one hybrid (F1). It can be manufactured, and by adding a fluorescent labeling protein to the recombinant vector, it is possible to easily classify male sterile oleaginous or Non-GMO plants through fluorescence, so that various applications are possible in the agricultural field.

1 shows a schematic diagram of an inserted gene for inducing mutation of the Os12BGlu38 gene using the CRISPR/Cas system.
2 is a result of confirming the genotype by analyzing the nucleotide sequence of the Os12BGlu38 gene target site in the T0 plant produced using CRISPR/Cas9.
3 is a result of confirming whether the CRISPR/Cas9 transporter is inserted in a one-to-one hybrid (F1).
4 is a result of confirming the genotype of an individual in which the CRISPR/Cas9 transporter is not inserted in a one-to-one hybrid (F1).
5 is a result of confirming the genotype of the CRISPR/Cas9 transporter inserted in the one-to-one hybrid (F1).
6 shows a schematic diagram of an inserted gene for inducing mutation of the OsHXK5 gene using the CRISPR/Cas system.
7 is a result of confirming the genotype by analyzing the nucleotide sequence of the OsHXK5 gene in the T0 plant produced using CRISPR/Cas9.
Figure 8A is a genotype analysis result by analyzing the nucleotide sequence of the OsHXK5 gene target site in an individual having a CRISPR/Cas9 transporter inserted in a one-to-one hybrid (F1) using a wild type as a model, and 8B is a one-to-one hybrid using a wild type as a copy ( This is the result of genotype analysis by analyzing the nucleotide sequence of the OsHXK5 gene target site in the CRISPR/Cas9 transporter inserted in F1).
9 shows a schematic diagram of an inserted gene for inducing mutation of the OsPLGG1 gene using the CRISPR/Cas system.
Figure 10A is a genotype analysis result by analyzing the nucleotide sequence of the OsPLGG1 gene target site in an individual having a CRISPR/Cas9 transporter inserted in a one-to-one hybrid (F1) using a wild type as a model, and 10B is a one-to-one hybrid using a wild type as a copy ( In F1), the genotype analysis result by analyzing the nucleotide sequence of the OsPLGG1 gene target site in the CRISPR/Cas9 transporter inserted.
11 shows a schematic diagram of an applied carrier (recombinant vector).
Figure 12 shows a schematic diagram of male infertility maintenance parent (maintainer line) and Non-GM (Transgene free) hybrid development using the CRISPR / Cas system.

Throughout this specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

As used throughout this specification, the terms “step of” or “step of” do not mean “step for”.

The present invention comprises the steps of (a) transforming a polynucleotide encoding a single guide RNA (sgRNA) capable of recognizing a target gene and a polynucleotide encoding a Cas protein into a recombinant vector to prepare a transgenic plant; And (b) a method for producing a homozygous mutant or biallelic mutant for the target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant provides

In the above, "gRNA (guide RNA) or sgRNA (single guide RNA)" refers to an RNA molecule that can bind to a Cas protein and is involved in gene editing by recognizing a specific location within a target gene of the Cas protein. , gRNA includes crRNA (CRISPR RNA) that specifically targets Cas9 (CRISPR-associated nuclease) protein and tracrRNA (trans-activating crRNA) that forms a partial complementary bond with pre-crRNA.

In the present invention, the polynucleotide encoding the sgRNA may be any one or more selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 9.

In the above, "Cas (CRISPR-associated nuclease)" is an RNA-guided DNA endonuclease enzyme related to CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), and is used for gene editing.

In the present invention, the target gene may be a gene related to male infertility, that is, a male infertility gene, or a general gene other than a male infertility gene. Preferably, it may be a male infertility gene, Os12BGlu38 gene or OsHXK5 gene, and may be a general gene, OsPLGG1 gene, but is not limited thereto.

As used above, "male sterile" refers to a phenomenon in which pollination, fertilization, and seed formation are not made due to morphological or functional abnormalities of the male organ, and when expressed as a temporary environmental mutation or expressed as a genetic trait In some cases, male infertility in the present invention may be induced as a genetic trait.

The Os12BGlu38 gene may consist of the nucleotide sequence of SEQ ID NO: 1, the OsHXK5 gene may consist of the nucleotide sequence of SEQ ID NO: 4, and the OsPLGG1 gene may consist of the nucleotide sequence of SEQ ID NO: 7, but is limited thereto no.

As used herein, the term "recombinant vector" refers to a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert. As used herein, the term “operably linked” means that a nucleic acid expression control sequence and a nucleic acid sequence (nucleotide sequence) encoding a target protein or RNA are functionally linked to perform a general function. say that For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the encoding nucleic acid sequence. The operable linkage with the recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation using enzymes generally known in the art.

The recombinant vector of the present invention may include a polynucleotide encoding an sgRNA capable of recognizing a target gene and a polynucleotide encoding a Cas protein, and may further include a polynucleotide encoding a fluorescent label protein. . In addition, it may include a polynucleotide encoding two or more sgRNAs capable of recognizing one target gene, and a polynucleotide encoding two or more sgRNAs capable of recognizing two or more target genes, respectively. it could be

For example, two or three different polynucleotides may be inserted from among polynucleotides encoding sgRNA consisting of the nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 11 and SEQ ID NO: 13 that can recognize the Os12BGlu38 gene, Preferably, the polynucleotide encoding the gRNA consisting of the nucleotide sequence of SEQ ID NO: 3 may be inserted.

In addition, any one of the polynucleotides encoding the sgRNA consisting of the base sequence of SEQ ID NO: 3, SEQ ID NO: 11 and SEQ ID NO: 13 capable of recognizing the Os12BGlu38 gene; a polynucleotide encoding an sgRNA consisting of the nucleotide sequence of SEQ ID NO: 6 capable of recognizing the OsHXK5 gene; and two or three different polynucleotides from among polynucleotides encoding sgRNA consisting of the nucleotide sequence of SEQ ID NO: 9 capable of recognizing the OsPLGG1 gene may be inserted.

As used herein, "transformation" refers to a change in the genetic characteristics of a cell by injecting a DNA molecule such as the recombinant vector into a host cell and binding it with the DNA of the host cell. As the transformation method, techniques well known in the art such as microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection and DEAE-dextran treatment and Agrobacterium mediated transfection may be used.

In the above, "crossing" may be made through back cross (back cross) or reciprocal cross (reciprocal cross).

In the above, "homozygous mutant" refers to a plant in which the same mutation appears in two alleles, and "biallelic mutant" refers to a plant that is identical to two alleles. However, it refers to a plant in which all mutations appear, and "heterozygous mutant" refers to a plant in which only one of the two alleles has a mutation.

In the present invention, a transgenic plant transformed with a recombinant vector was shown as a homozygous mutation or a biallelic mutation, and the mutated transgenic plant and a wild-type plant were backcrossed or crossed. In the case of one-to-one hybrids (F1), it was confirmed that not only heterozygous mutations appeared according to Mendel's law, but also homozygous mutations or biallelic mutations appeared in one-to-one hybrids (F1) depending on whether the recombinant vector was included. That is, a genotype that is a homozygous mutation or a biallelic mutation in a one-to-one hybrid (F1) can be prepared.

Plants of the present invention include monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats and onions, cotton, tomatoes, Arabidopsis thaliana, eggplant, tobacco, red pepper, burdock, sagebrush, lettuce, bellflower, spinach, chard , sweet potato, celery, carrot, water parsley, parsley, Chinese cabbage, cabbage, radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean and pea, etc. may be dicotyledonous plants, but is not limited thereto. .

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a male sterile maintainer line comprising the step of selecting a plant expressing the fluorescent marker protein.

As used above, "male sterile maintainer line" refers to a parent or line capable of maintaining male sterility. In the present invention, a plant expressing a fluorescent label protein can become a male infertility parent as a homozygous mutant or biallelic mutant having CRISPR/Cas9. have.

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a Non-Genetically Modified Organism (Non-GMO) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.

In the above, "Non-GMO" refers to non-genetically modified organisms. In the present invention, a plant that does not express the fluorescent marker protein is a heterozygous mutant that does not have CRISPR/Cas9, and can be a plant in which a foreign gene is not inserted. There are advantages.

In addition, the present invention is a recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein, wherein the polynucleotide encoding the sgRNA comprises: It provides a recombinant vector, characterized in that at least one selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9.

The target gene may be any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene, but is not limited thereto. In addition, it may include a polynucleotide encoding two or more sgRNAs capable of recognizing one target gene, and a polynucleotide encoding two or more sgRNAs capable of recognizing two or more target genes, respectively. it could be

The fluorescent label protein may be selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and cyan fluorescent protein (CFP), but is not limited thereto.

In addition, the present invention provides a transgenic plant transformed with the recombinant vector and a seed of the transgenic plant. The plant or seed may be a homozygous mutant or a biallelic mutant for the target gene.

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to these examples.

Example 1. Using the CRISPR/Cas9 system Mutation of the Os12BGlu38 gene

As a result of analyzing the genotypes of various transformants and progeny plants made using the CRISPR/Cas9 system, the present inventors found that when a plant expressing Cas9 protein and sgRNA (single guide RNA) at the same time was crossed with a wild-type plant, the wild-type chromosome In the target gene delivered from the fertilization or embryogenesis, mutations are continuously induced during the early stage of embryogenesis, so that a heterozygous mutant of the target gene is identified as a homozygous mutant of the target gene or a heterozygous allele of the target gene. The phenomenon of making it a biallelic mutant was discovered.

Accordingly, the present inventors applied to the male sterile gene to prepare a stable male infertility plant, and to recognize TCCATGATCAATACAAGGGA (SEQ ID NO: 2) among the nucleotide sequences of the Os12BGlu38 gene (SEQ ID NO: 1), which is a gene inducing male infertility. The nucleotide sequence (SEQ ID NO: 3) corresponding to the capable sgRNA and the nucleotide sequence encoding the Cas protein were inserted into the carrier (recombinant vector, FIG. 1) to transform rice, and the transformed plant was named “T0”. .

Then, the present inventors performed an experiment to confirm the genotype through the analysis of the nucleotide sequence TCCATGATCAATACAAGGGA of the Os12BGlu38 gene in three T0 plants transformed using CRISPR/Cas9. Briefly, a 24-bp primer sequence capable of amplifying a section containing the Os12BGlu38 target sequence (SEQ ID NO: 2) by extracting DNA from the leaves of wild-type (WT) and one-to-one hybrid (F1) plants to be used as a control. By making a pair, PCR (Polymerase Chain Reaction) was performed. When the DNA amplified through PCR was electrophoresed, a band with a size of 708bp or a band larger or smaller than this was confirmed depending on the mutation pattern. Then, when the nucleotide sequence was determined using the corresponding band, mutations of a different aspect from the wild type were identified within the 708bp section including the target sequence, and all three T0 plants were confirmed to be biallelic mutants. (Fig. 2).

In addition, the present inventors performed an experiment to confirm the genotype of the one-to-one hybrid (F1) after backcrossing one of the three T0 plants with the wild-type Dongjinbyeo. Polymerase Chain Reaction (PCR) was performed by preparing a pair of 24 bp primer nucleotide sequences that are present in the CRISPR/Cas9 transporter but not in wild-type rice. When the DNA amplified through PCR is electrophoresed, if the carrier DNA is amplified and a band with a size of 931 bp is confirmed, it is a plant containing the CRISPR/Cas9 carrier, and if it is not confirmed, it can be called a plant without the carrier. First, it was confirmed whether the CRISPR/Cas9 transporter was inserted in the one-to-one hybrid (F1), #2, #4, #7, #9, #10, #12, #13, #18, #19, #24 and # It was confirmed that the CRISPR/Cas9 transporter was inserted in 25 subjects ( FIG. 3 ).

According to the above results, the present inventors found that the remaining individuals (#1, #3, #5, #6, #8, #11, #14, #15, # The genotype of the Os12BGlu38 gene was confirmed in 16, #17, #20, #21, #22 and #23). As a result, it was confirmed that all of the individuals were heterozygous mutants ( FIG. 4 ). In addition, the CRISPR/Cas9 transporter inserted in the co-hybrid (F1) (#2, #4, #7, #9, #10, #12, #13, #18, #19, #24 and #25) It was confirmed that all genotypes of the Os12BGlu38 gene were homozygous or biallelic mutations (FIG. 5).

Thus, all of the CRISPR/Cas transporter-introduced one-to-hybrid (F1) plants are either homozygous or biallelic mutants, and all mutants maintain male sterility, whereas one-to-one CRISPR/Cas transporters are not inserted. (F1) It was confirmed that all of the plants were heterozygous mutants.

In addition, when the CRISPR/Cas transporter was not inserted into a direct hybrid, all of the offspring did not show the male infertility phenotype, and in the case of the genotype, the ratio of heterozygous mutation to wild type was 1:1, resulting in a general mutation separation ratio. confirmed to follow.

Example 2. Using the CRISPR/Cas9 system Mutation of the OsHXK5 gene

The present inventors performed the same experiment as in Example 1 to produce stable male infertility plants using the OsHXK5 gene, which is another gene inducing male infertility. First, a nucleotide sequence corresponding to sgRNA that can recognize GCGGGGCATCTCGGACGCCA (SEQ ID NO: 5) among the nucleotide sequences of the OsHXK5 gene (SEQ ID NO: 4), which is a gene inducing male infertility (SEQ ID NO: 6) and a nucleotide sequence encoding a Cas protein was inserted into a carrier (recombinant vector, FIG. 6) to transform the rice.

Thereafter, an experiment was performed to confirm the genotype through analysis of the base sequence GCGGGGCATCTCGGACGCCA of the OsHXK5 gene in 10 transformed plants. As a result, it was confirmed that all 10 plants were homozygous or biallelic mutants ( FIG. 7 ).

In addition, the present inventors performed a reciprocal cross between a plant in which the CRISPR/Cas carrier was inserted and a wild-type Dongjinbyeo among T1 plants obtained by self-fertilizing plant #2 among the 10 plants, and then a one-generation hybrid (F1) An experiment was performed to confirm the genotype through analysis of the nucleotide sequence GCGGGGCATCTCGGACGCCA of the OsHXK5 gene in plants. As a result, it was confirmed that all of the CRISPR/Cas9 transporter inserted individuals among the one-to-one hybrid (F1) plants using the wild type as a model were homozygous or biallelic mutations ( FIG. 8A ), and the one-to-one hybrids using the wild type as a parent ( FIG. 8A ). F1) All of the CRISPR/Cas9 transporters in plants were confirmed to be homozygous or biallelic mutations (FIG. 8B), so all of the plants in which CRISPR/Cas transporters were inserted were homozygous or biallelic mutations. was confirmed to be.

Example 3. Using the CRISPR/Cas9 system Induction of mutations in the OsPLGG1 gene

The present inventors performed the same experiment as in Example 1 using the OsPLGG1 gene in order to check whether the same results are shown in general genes other than male infertility genes. OsPLGG1 loss-of-function In rice, photorespiration is restricted and the chlorophyll content of leaves is reduced, paying attention to the phenotype of the OsPLGG1 gene (SEQ ID NO: 7). A nucleotide sequence corresponding to sgRNA that can recognize CCTCTTCTACGTCCCTTCCC (SEQ ID NO: 8) (SEQ ID NO: 9) and a nucleotide sequence encoding a Cas protein were inserted into a carrier (recombinant vector, FIG. 9) to transform rice.

Thereafter, an experiment was performed to confirm the genotype through analysis of the nucleotide sequence CCTCTTCTACGTCCCTTCCC of the OsPLGG1 gene in the four transformed plants, and it was confirmed that all of them were biallelic mutants. In addition, after performing a reciprocal cross between a plant having the nucleotide sequence of CCTCTTCTACGTCCCTTCCC and a wild-type Dongjinbyeo in which T was inserted among the self-fertilized T1 plants, an experiment was performed to confirm the genotype in a one-to-one hybrid (F1) plant. As a result, it was confirmed that all 41 individuals into which the CRISPR/Cas9 transporter was inserted among cohort hybrid (F1) plants using the wild type as a model were homozygous or biallelic mutations (FIG. 10A), and the cohort using the wild type as a copy. Among hybrid (F1) plants, all 9 individuals into which the CRISPR/Cas9 transporter was inserted were also confirmed to be homozygous or biallelic mutations (FIG. 10B), so that all plants in which the CRISPR/Cas transporter was inserted were homozygous or biallelic. It was confirmed that it was a factor mutation. In addition, it was confirmed that all 50 one-to-one hybrid (F1) plants exhibited a phenotype in which the chlorophyll content was decreased.

Example 4. Preparation of oleaginous and Non-Genetically Modified Organism (GM) plants using the CRISPR/Cas9 system

The present inventors inserted the sgRNA for the male infertility gene into the CRISPR/Cas9 carrier to induce gene mutation and at the same time insert the fluorescent marker gene together to create a carrier (recombinant vector) so that the transformed seed can be easily separated by fluorescence (Fig. 11A).

In addition, when male infertility gene mutation is induced after fertilization, one male infertility gene is added to the CRISPR/Cas9 carrier in case three or a multiple of 3 genes are accidentally inserted/deleted to maintain the activity of the wild-type male infertility protein. Inducing two different mutations or deletion of long nucleotide sequences in one individual by inserting two different sgRNAs for A carrier (recombinant vector) was constructed so that the

In addition, when the male infertility gene mutation is induced after fertilization, two different types of CRISPR/Cas9 transporters are added to the CRISPR/Cas9 transporter in case three or a multiple of three genes are accidentally inserted/deleted to maintain the activity of the wild-type male infertility protein. By inserting two different sgRNAs for the male infertility gene, two different mutations are induced in one individual, and at the same time, a fluorescent marker gene is inserted into the CRISPR/Cas carrier so that the transformed seeds can be easily separated by fluorescence. A vehicle (recombinant vector) was constructed ( FIG. 11C ).

As the fluorescent marker gene, mCherry cDNA (SEQ ID NO: 14), which is mRFP (monomeric red fluorescent protein), was used to transform a plant transformed with the carrier into a red color, so that it could be selected by fluorescence spectroscopy.

Among the plants transformed with the carrier (recombinant vector), the homozygous mutant or the biallelic mutant is backcrossed with the wild type, and then the plant into which the CRISPR / Cas9 carrier is inserted is selected using the expression of the fluorescent marker protein. genotype can be identified. In this case, if all plants expressing the fluorescent marker protein are confirmed to be male infertile, it means that CRISPR/Cas9-derived mutations were induced even in the chromosomes received from the wild-type during fertilization. ) can be used as In addition, a plant that does not express the fluorescent marker protein is a heterozygous mutation for the male infertility gene and at the same time is a Non-GMO (Non-Genetically Modified Organism) because a foreign gene is not inserted. can

Example 5. Using the CRISPR/Cas9 system Comparison of Os12BGlu38 gene mutant plants

The present inventors constructed sgRNA sequences targeting various regions of the Os12BGlu38 gene in order to confirm the production efficiency of transgenic plants using the CRISPR/Cas9 system, and prepared various mutated plant preparations using the sgRNA sequences.

Specifically, the sgRNA nucleotide sequence (SEQ ID NO: 3) capable of recognizing TCCATGATCAATACAAGGGA (SEQ ID NO: 2) among the nucleotide sequences of the Os12BGlu38 gene (SEQ ID NO: 1) described in Example 1, and GACACCTTCCTGATGCAACC (SEQ ID NO: 10) capable of recognizing One of the gRNA sequences (SEQ ID NO: 13) capable of recognizing the sgRNA sequence (SEQ ID NO: 11) and GGTCTCGCATTTTCCCCAGT (SEQ ID NO: 12), and a carrier (recombinant vector) encoding the Cas9 protein was prepared. The prepared vehicle was transformed into rice.

Then, the present inventors performed mutation efficiency evaluation by confirming the genotype through sequencing of the Os12BGlu38 gene using the method disclosed in Example 1 in three plants using each sgRNA. As a result, the recombinant vector encoding the sgRNA of SEQ ID NO: 3 had a higher mutation probability than the sgRNAs of SEQ ID NO: 11 and SEQ ID NO: 13 targeting other sites of Os12BGlu38.

According to the above results, the mutation probability of the sgRNA target sequence was different, and the sgRNA of SEQ ID NO: 11 and SEQ ID NO: 13 was found to have low efficiency as an off-target, whereby the sgRNA nucleotide sequence of SEQ ID NO: 3 was high. It was confirmed that Os12BGlu38 male sterile plants could be produced with probability.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Manufacturing method of non-functional mutant in first filial generation using CRISPR/Cas system <130> PO2009-042 <150> KR 10-2019-0168711 <151> 2019-12-17 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 3139 <212> DNA <213> Oryza sativa <400> 1 actctcaccg ccgctctctc ttcctctcca acatgaatat gccattgcta ctcctcatcg 60 ccatcgtcgt cgtctccctc tcccatggca acggggagca gaccgacctc acgcgggaga 120 cgttccccgc gggcttcgtc ttcggcaccg cgtcgtcggc gtaccaggtg gaggggaacg 180 ccctccagta tggccgaggg ccctgcatct gggacacctt cctgatgcaa cctggtgaga 240 tcgatgatac atgttcaggc aaaactagca atgtggtatc taaatataca gatcataaac 300 agtttgtcgc atttttcaaa taatggaatt aacaatgtgt tgggacgatc cacctaaaaa 360 gagaatatga caacaacaat ctaaaaagaa ttacatagcc tgatattgaa atgttgttgc 420 attacggcgc gttgcatttt gtacgtctct agtggatgta tgactggttg ttgatttggc 480 tctgattgtt cctttggata ggtgtaactc ctgataattc gaccgcgaat gtgaccgtcg 540 acgagtacca ccgctacatg gtcagtgaaa gtctcatgtg tttcagtgcc tgttctaatg 600 ggtttctgtt cctctgtatg actcttgatt tgtagcttat gtggctcctc tgatgatctt 660 ctttgcagga tgatgtggac aacatggtga gagtgggctt cgacgcgtat cgcttctcga 720 tctcctggtc tcgcattttc cccagtaagt taccggctga aacatggtca ggcacagtga 780 tgagatcatg ggatattcct ttcattgatg gtttttcttc tgcgtgttgt aggtggactt 840 gggaagatta acaaagacgg cgtggattat taccacaggc tcattgatta catgcttgct 900 aacagtacgt tggtcttggc atttcttcta gttcttgccc atttcggatt tcatgatctc 960 gaattaatag gttttttttt ggtttgattt gcacatcaga cattattcca tatgttgtgc 1020 tctaccacta cgaccttcca caggtgctcc atgatcaata caagggatgg ctacacccca 1080 gaattgtgta agtgttcgtg atcaaagcca tctgtttggc tgtaaaactt aaaattaaat 1140 accctttaaa ttgtttgaca aactacagaa gcacctctga agattttgtg ctaaattatg 1200 aaacccatag ctctctaact gcgaaatcct gacagtgaaa gttctgcagg tgtttaacca 1260 aaataggttt cactgtagca tatccgacat acacaaatat caaacccaga caatctgtat 1320 cctccctttc ttacgttcct tactcccttt ttcttgaatt aatgtgtgat tcatgtctgc 1380 gacttcattt tgcaggagag attttgtgag atttgcagac ttctgcttca agacatatgg 1440 tcataaggtg aagaactggt ttaccattaa cgaacctagg atgatggcaa atcatggcta 1500 cggtgacggc ttcttccccc ctggcagatg caccggctgc caacccggtg ggaattccgc 1560 caccgagcct tacatcgcag cccataacct tctcctttca catgccgctg ctgtcaggac 1620 atatcgtgac aagtaccagg ctagtgaatg atatccatgc ccctactatc caattcaaca 1680 tttcttaaaa tctccaatgt atcagctcat gttcatgata ccttgcgatt ttcaggctat 1740 tcagaagggg aagattggca tccttctcga ttttgtatgg tatgagccac tcaccgacaa 1800 agaagaggat cacgcagctg cacatagagc cagggagttt acccttggct ggtgatacat 1860 cttacactgt tcatcaatca ttgctcttac acggtgtccg catgaaggtt gaactgaact 1920 tccacttgaa acttttgcta ggtacctgca cccgattaca tatggtcatt acccagaaac 1980 tatgcagaat gctgttaagg aaaggctgcc caatttcaca cgtgagcagt ctgagatgat 2040 aaaaggatca gcggattata ttgcgatcaa ccattacaca acttattatg tcagtcacca 2100 cgtcaacaag acatccatca gctatctcaa tgattgggat gtgaaaattt catgtatgac 2160 actttcaaat cacacagtat tagaccagaa atatttgtac cttttcaatt ctttgccttc 2220 ctagctaaca cattttggtc ctctattcag atgagcgtaa cggtgtgcca attgggaaac 2280 aggtaagcaa caatttacaa gaaaggttga aaagaatggt agatcatgaa ctaaattctg 2340 gtttttaaac atctatgcag gcgtactcga actggcttta tgttgttcct tgggggatct 2400 acaaagctgt catgcatgtc aaggagaagt acaaggaccc cattataatc atcggagaaa 2460 atggtaaata aagataatac tggagaccct ttcaattttc ggacagtgaa cagtacaact 2520 ataaaagtgc tctgcagaat gaatctagga gcaaaatcta acaagaacct tttgcaggca 2580 ttgaccagcc aggcaatgag accctacctg gtgcactgta tgacttcttc aggatacaat 2640 attttgatca gtacctccat gagcttaaga gggcgatcaa ggatggtgca agggtcactg 2700 ggtattttgc ttggtccctg cttgacaact tcgagtggcg gctcgggttc acttcaaaat 2760 tcggaatcgt ctatgtagac cggagcactt tcacacggta ccctaaagac tcaacacgtt 2820 ggttcaggaa gatgataaaa agtgaggttt gagttggatt attatcactg ttggcagctg 2880 ctggagtgct tttttgttat gctagttttg gttgtatgaa taataagatg tcttgtacta 2940 gttgagaact tcttcagatt ttgtacttct agtattctac tttttgtact tcagattttg 3000 caagcaagga tgattttagt ttaatagatt caggacatct atatatactg gtgataagag 3060 aggcagattt caatttttgg cttgaattgc ccatatttgt gttttccaat gttttttaac 3120 ttcaaatttt aaactttgg 3139 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Os12Bglu38 target site <400> 2 tccatgatca atacaaggga 20 <210> 3 <211> 104 <212> DNA <213> Artificial Sequence <220> <223> Os12Bglu38 sgRNA <400> 3 tccatgatca atacaaggga gttttagagc tatgctgaaa agcatagcaa gttaaaataa 60 ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgc 104 <210> 4 <211> 5643 <212> DNA <213> Oryza sativa <400> 4 accggttaaa acgcccaagt cagtggctct cgtcctcctt tctcctacgc ggccggagag 60 aggagggggg aagagaggat ctcgcagagc gccatagcct cggatccaga agcggaattc 120 ggtggaggtc tcgggcacct ggatcgatcg gaggaaggga aggcggagca gcggtgatgg 180 ggaaggcggc ggcggtgggg acggcggtgg tggtggccgc ggcggtcggg gtggcggtgg 240 tgctggcgcg gaggcggagg aggagggacc tggagctggt ggagggagcc gcggcggaga 300 ggaagaggaa ggtggcggcg gtgatcgagg acgtggagca cgcgctgtcg accccgacgg 360 cgctgctgcg gggcatctcg gacgccatgg tcaccgagat ggagcgaggc ctgcgcgggg 420 acagccacgc catggttaag atgctcatca cctacgtcga caacctcccc accgggtaag 480 cgcctcgatt ccgatctgat gtctgattcc tttcgttttt cgtattatgt ttcctttcgt 540 ttttagtatt atgggtttgg aactttgtga tctaaaaagt ttggaattgg gaaaggtctc 600 gtattgatgc gaatcgttcg ggaacaaatc tagtagtgac gcgcgtaacc gtgggaattt 660 atctccgtgc tctgattagg accgactgac cttttgatgg gatggtagga aatgtgcgaa 720 ttctttttat gatgtttgta cgaaaatcag attcccccga aaattgcgcc tagtggtgat 780 ccgaagagaa tggaactata atctcccatt tgatcttcat gtggttttgg tgtctcgtat 840 tcgtgaattg ggattttttt tgtacgttcc gatcgaagct agatcaatcc tagctttgcc 900 aaacaatata agccatttgt tataactgaa ataagttatg taaccacaag gaaacgcttg 960 ctctcggact ctgctgagga gagccaaggc aaattggctc ataccagtga ttgaaggaaa 1020 aatgtggagt cgtgggcatc tgaaattgct tctcatgcac caggacgcag gatttcggtg 1080 atgggggtac agagttacta aagcatcatg caatgagaaa aaaaatgaag tgctagtatg 1140 tgttattaac acaaacataa atcattgtta tagaaaaaaa tataaagtag ccaagagaaa 1200 atgataatac tcttgacaag gatgattttt gtgcttgaaa atgattgttt taatttagct 1260 gattgtgcat acacatacta tacatacatg ttatagatta tagatcacat ttgtttgcta 1320 aaacaatttg cggggtaccg gattacgaac tgtacccctc atgtccttgt gtaaacagga 1380 ttctacatag aactcaaaca agatagataa attggcctat ctaagctagg aaagataggt 1440 ctcccgtcaa catatcctat cgttctcaga tgatcttcgg ttttgtgatc tatagtagat 1500 cgtccatttg ttcctaattt ggctctttag gatttctgat tatgatatgt gattaattaa 1560 tttgatcgtc catttgttcc tactttggct ctttaggatt tctgattatg atatgtgatt 1620 aattaatttc ttgttggttt gatttgttaa ggcttcagtg acaggtaatt aactaatgta 1680 tggcagagag tttctttgca ttgtggtttc cttgttagca atctgaccaa tagatccat 1740 cagtcgagct tatctcatgg tatagttggt ctggtaataa gtttctctgt aacctccaca 1800 tcgttaagct aaatgtggca ggcacatcct gaaggaagtt tcttaaatat aatgattcat 1860 tcttattcta tcggatcctt ctaccagtct gttagaactc actcacccat aagcatacaa 1920 tgtttcctgc tgccttcttc caaaagtagt aatttcattc tttgatcata atgatttccc 1980 tttgcagaaa tgaacagggg ttgttttatg cattggatct tggaggaacc aacttccgcg 2040 tcctgcgagt ccaactcggt ggcaaggaga aacgtgtcgt ccaacaacag tacgaggaag 2100 tctcaattcc accacatctg atggttggaa cttccatggt aagcatttgc tgcttgattt 2160 taaatttctt ggagctgtac attccatgct tgtcttatgt attttctgac tattaatgca 2220 ggaactgttt gattttattg cttctgcatt gtcaaaattt gttgatactg aaggtgatga 2280 tttccacctc ccagaaggga gacagagaga gctgggcttc accttttcct tcccagtgag 2340 ccagacatca atatcgtcag gaacgctcat caagtggaca aagggtttct ccatcaatga 2400 cgcggtaaaa gtcaaaaata acttttggac ataccctgac tagaacacaa tcctgatcct 2460 tctttaaaca catgaattat gtcacaaggt tccttgataa agcttgattg aatatggcaa 2520 tggagtattt caattagcta tttgctacaa tctccctttg tgtacattgt aatcaactta 2580 actaggttag tgaaaagaaa tatcgacctt gatcaggaag catatttaat ttgaggatct 2640 ttaatagtac tcagtattat gtttgcctgg ttgatcatat ctgtgtgaac tgtcaagcat 2700 ccaataagaa taatttgatt ttgctatatt atctcctgaa ttaggttggc gaagatgttg 2760 tatctgagtt gggcaaggcc atggagaggc agggattaga tatgaaaatt gcagcattgg 2820 taagttaata tatattaatt tcgtcaattt cttacttcca cactatatct atgctcagct 2880 ccgttatctg aggcattgat aatcatttgt atcctgatgc tgcttttggg gtattcacat 2940 ctgatgatgt gatgcaaaca ttgttgacat gatttaccac tgatgttagg ttaatgacac 3000 tgtcggcaca ttggctggtg ggaggtatgc ggataacagt gttgttgctg ctataatatt 3060 gggcactggt acaaatgcag catatgttga gaatgctaat gcaattccta aatggaccgg 3120 tttactgcct aggtccggaa atatggttag tgtgtgaata ccttatgctt gggattatca 3180 ttagttgtct atgtcttata gatgatcaat gccaacactc ttgaatgtta accctactta 3240 aaaaaatatg taaacgtgga attatttggt attctctagg taatcaacac agaatggggg 3300 agctttaaat cagataagct tcctctttca gaattcgata aagcaatgga ttttgaaagc 3360 ttgaatcctg gagagcaggt attctatccc cagtattttc ctctcctttt agttttagcc 3420 ttttaggtgg accgcattaa cttgtatgta ttttccaaca gatatatgaa aagttgattt 3480 ctggcatgta tcttggagag atagtgcgaa gaatcttgct gaagcttgct catgatgcag 3540 ctttgtttgg ggatgttgtt ccatctaagc tagagcaacc gtttgtacta aggtatattt 3600 ctgtaccatc tctcttttga tcttcattcc ttccttttgt catggcaaaa gccgttttac 3660 tttgttgtta actatcatgc tggtcaagtt ttttttttca cgatttctgt gactacccct 3720 tggataagag tgcacatgat ataaagacgt tggcatcgtt tccattataa tattcgcact 3780 gttgataata tacccagata gattatggaa ggggaagttg tttgtatatc ttgaaattat 3840 catgctaaat cagttagcaa atccatggaa ggtgacaaac atacactttg ttgttttatc 3900 cattactact ttcttctggt tctggttgat tctcataatt gtgtgcaact agaagttatc 3960 tagcttggat aattagggtg gtttggtttt tgctcaccag tttttcttta tgcttctaac 4020 ccctcaatct tatgcaactc tggtagaatt ttttataagt atctcaattg ttgtatcaca 4080 ggacaccgga tatgtcagcc atgcatcatg actcgtcaca tgaccttaaa actgttggag 4140 ctaagctaaa ggatatcgtc ggggtatgaa atttcttgac ccaaagtgga tacgcaacat 4200 ccaacactgt tcaatgagta ctggttgctt atttatgatt tgatctttta ttcaggtccc 4260 agatacttcc ctggaagtaa gatacattac cagtcacatt tgtgacatag ttgcagagcg 4320 tgctgcacgc ttggctgctg ctggcatata tggggtccta aagaagctag gtcgggacaa 4380 gatgccaaaa gacggcagta agatgcctag gactgtcatt gccttggatg gtgggctcta 4440 tgaacattac aagaagttca gcagttgctt agaatcaact ctaacagacc ttcttgggga 4500 tgatgtctcg tcttcggtgg ttaccaagct ggccaacgat ggttctggca ttggagctgc 4560 tcttctcgca gcctcgcact cccagtatgc cgagatcgac tagctttaag gatgatcttg 4620 atgaatgatg aatcaaactc cgtttgtagg ttctcatttc ccccttcaaa atccacataa 4680 tactcctggc tccccccttg aaatcttacc atcttttttt ggctattctg agggcaaaca 4740 taagtgcctc tgcagcggga tatagctagt atagcgccaa tgagtttgga ggttttctaa 4800 tggcataaaa cgttggatgg cagtagcaga ctaacaggga aatggaggca caggcaattt 4860 ccattcctgt tctgtcagat tcttttcccc cttaattgat gttgagaacc aagatttttt 4920 tgctctgtat tttctcttcg taataaagaa ggggacataa tctaattgct cttgtttgat 4980 ctcatatatg tatgtgactg cactctcact gtcccaaaat tttatagatg catttacaaa 5040 gttacaatac tcattacat caaataactg aaggatggcg aatgtatttg tctggtatct 5100 acctgctctc ctaactagcg tgccatctct cctagatggt aaccattgga tcaggttata 5160 cttcttattg accattgttc tcatactatg ctgtccaagc tgccgttgcc gtcgtcgatg 5220 cctttggtgt ccgaaagctg cttccggcgg ctgccacccc tgatcggcag aaacggcgcg 5280 ccgtcgccgt cgtactccgc caccttcccg tccacggtgt tctggagcgc ctgctcgcac 5340 ctcaccagaa tctgcagaac gtccctcatt gtcggcctcg tcgccggctg cgcgccggtg 5400 cagatgatgc cgagcttgaa cacgacctcg gcgtcgtcgc cgtacccgga gtcggtgatg 5460 cacctgtcca ccgcgtcggc gatgctcctg cccgattgca ggtgccgcca cgcccactcc 5520 gccagcgagc cgtgctcgcc gccgtcgtgg gcttccctgc cggtgatcag ctcgaggagc 5580 accaccccga agctgtacac gtcgaccttc tcgttcacct tcctcgtgta cgcgcactct 5640 gca 5643 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsHXK5 target site <400> 5 gcggggcatc tcggacgcca 20 <210> 6 <211> 104 <212> DNA <213> Artificial Sequence <220> <223> OsHXK5 sgRNA <400> 6 gcggggcatc tcggacgcca gttttagagc tatgctgaaa agcatagcaa gttaaaataa 60 ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgc 104 <210> 7 <211> 3312 <212> DNA <213> Oryza sativa <400> 7 ggccaaagga gaaggagaag aagagaagag aagagaagag atggcagcga cctcatcatc 60 atcctccccc tgcatgattg cctcgctacg cagcagccat cgctgccgcc tttcgccctc 120 cgccaccgcc acgtcgccgc cccgcctccg cacgcttcct ccccgccgat gccgacgcaa 180 cccctcctcc tcctcctcct cctcccgcca agcggcggca atctccatgg ctccccgccaa 240 tcctcgccac cgcctcatcg ccccgatcca cgccgccgcc gccgccggag gaggaggagg 300 aggcgcgggc gccacctctc cctcgggcct acccagcgtg agtcgtcaat cagtcaaaat 360 gcaccgcagcc tcgtcgcgat ttcgcatgac ctgccgatcg aactgacatg cgtgagctat 420 gtatggattt tatagctcgt cgggatcgcg cacctgctgg tgtcgctggg gatcgtgctg 480 gcctccgaca agttcctgaa gcaggcgttc gcggcggcgt ccatcaagtt ccccagcgcc 540 ctcttcggca tgttctgcgt cttctccgtc ctcgtcgtcc tcgacgcctt cgcgcccgcg 600 ctcgccaagg ggttcatgga cttcttcgag ccggccaccc tcttcatcca gaggtggctg 660 cccctcttct acgtcccttc cctggtcgtc ctgccgctcg ccgtcaggga cgtcccggct 720 gcttccggcc tcaagatctt cctcatcatt tgtatgcaca tcactacgct cctatcgttg 780 catgcattct gctacttctt tcttcctcct gatcatcgtg cttatctgct ccgcctctgc 840 ttcctccgga ttttacattc tactacttcg tatttgatat gctgatcaat taacttgcag 900 taaatattac cacaccaact tgcattgtgg attggcccca ttcataaatc acaacaattt 960 tacttagagg gtgtttagat tcaggggtgt aaagttttac cgtgtcacat cggatattat 1020 atagggtgtc gtaatagggt gtttggatac taataaaaaa aactaattac agaatccggc 1080 agtaaactgc gagacgaatt tattaagtct aattaatccg tcattagcaa atgtttactg 1140 taaaaccaca ttatcaaatc atagagcaat tagacttaaa agattcgtct cgcaaattag 1200 tggcaatctg tgcaattagt tattttttta gcctatattt aatacttcgt gcaagtgttc 1260 aaacgttcga tgtgacaggg tgtaaaattt tagggtggga tctaaacatg cccttggttt 1320 cagattaatt tgcattcaat ctgaaaaaac cgatggtgtg atgttatctg gttttcattt 1380 cccagttggt ggctggtttg cttcactcat ggtggccgga tacacagcac tcaccgtgag 1440 gaagattgtc cagacacagc ttataccagc tgagccgatg agcaagccgt ctccgttcgc 1500 gacgctggaa ttctgggcct ggggtgctgt ctttgtcgca tcgtttgctg ttgcgtatgt 1560 taaccccaca gcgcttggca ccacggcaag aacatgtctt cctttcctcc tcgcttcaac 1620 tgtactggga tacatggttg gttctgggta aatacatatg ctttttgtat acacttaatc 1680 tgtaagatct gacgaagcca ccagctgcct tgtttactcc atttctctaa caacatacat 1740 gggtcttatt gattacttgg caggatacca tctggtgtca agaaagtgct tcacccaatc 1800 atttgttgtg cactctctgc agatttggca gcaatagcat atgggtatct ctcccggtct 1860 ggagttgatg cagtgctagg ttgtaaacta aaccctgatc aatagtgctc taatcaagtt 1920 gtgaattctg aaataagttg gttttaattg ccaggtgatt acctcacaaa ggcgccatct 1980 aatcctggag ctggtgacgt cctgatggga tttcttggtt cagtcatcat atcgtttgca 2040 ttctcaatgt tcaagcagag aaaggtagtg cttgctgctg tttctgcaga attattctca 2100 gttagcatgc atggttatgg tgtgagatga ttcatatata tcctgaggct ctgtgtttgt 2160 tgttgctggt gtgtgttggc taatcaacta ataatgtttt gcggtgggta aaactcagct 2220 tgtgaagagg catgcagcgg aaattttcac atcaattgcc atcgcatcaa cattctcgtt 2280 atactcaact gccatcctag gacgggtgat agggctagag ccttcactga ccatatcaat 2340 attaccgagg tgcataaccg tggcgttggc tctgagcatc gtgtctttct ttgaaggtac 2400 ggacctagta catacttata ttgctggaaa tcaatttctg ttcttgctgg tcgatcagct 2460 agatatataa tatggagtac tcagctagct tattatatat ggtatggatg acttagtttg 2520 tgtgtcccgg gcatgcaggt gtaaattctt cgctaaccgc tgcggtcgtc gtcctcaccg 2580 ggctgatcgg cgcaaatttt gtgcaagcag ccatggacaa gcttggcctc aacgacccca 2640 tcgcgcgagg aatagggacg gcttccaggt acatatatac ctttgagttt tacttttgag 2700 atttgttccg gtccaacaaa aagtatttcg agataccgat acctcagggg ttcacagtat 2760 caaatcgttt ccgatcgtta gatctaacaa tgtccatcct acataactag atccaatggt 2820 cggaaacgat tagatcaaa tgatcgaaaa tgatttggta taccacgaga tagcaaattt 2880 ctttactttt acctacctgc tggctgcttt ttttagtaag ttaagctgca tatatata 2940 tacatacagc agtatgctct atgaataatg tttgcattta cgttgcagtg ctcatggact 3000 gggaacagca gcgctgtcgg ccaaggagcc tgaagcgctg cccttctgcg ccatcgctta 3060 cggcctgacg gggatcttcg gttcgctcat ttgctcggtt ccggccgtca ggcagagctt 3120 agtgttcata gctggctgac aacacgcacg gtacatcagt tttgtttttg tttgtttttt 3180 ctttttcact ttcttttggg tcgtcgtgcg tgtatagagc gatgctcgca agattgcaag 3240 aatatatgta tacagacaca ttttttgtga ttatgtctcc gttgtaataa gaagcaagag 3300 agtaattttg ta 3312 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsPLGG1 target site <400> 8 cctcttctac gtcccttccc 20 <210> 9 <211> 104 <212> DNA <213> Artificial Sequence <220> <223> OsPLGG1 sgRNA <400> 9 cctcttctac gtcccttccc gttttagagc tatgctgaaa agcatagcaa gttaaaataa 60 ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgc 104 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Os12Bglu38 target site 2 <400> 10 gacaccttcc tgatgcaacc 20 <210> 11 <211> 104 <212> DNA <213> Artificial Sequence <220> <223> Os12Bglu38 sgRNA <400> 11 gacaccttcc tgatgcaacc gttttagagc tatgctgaaa agcatagcaa gttaaaataa 60 ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgc 104 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Os12Bglu38 target site 3 <400> 12 ggtctcgcat tttccccagt 20 <210> 13 <211> 104 <212> DNA <213> Artificial Sequence <220> <223> Os12Bglu38 sgRNA <400> 13 actggggaaa atgcgagacc gttttagagc tatgctgaaa agcatagcaa gttaaaataa 60 ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgc 104 <210> 14 <211> 705 <212> DNA <213> Artificial Sequence <220> <223> mCherry cDNA <400> 14 atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240 cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360 ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600 aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtac 705

Claims (19)

(a) Transforming with a recombinant vector into which a polynucleotide encoding a sgRNA (single guide RNA) capable of recognizing a target gene and a polynucleotide encoding a Cas (CRISPR-associated nuclease) protein are inserted to prepare a transgenic plant step; and
(B) a method of producing a homozygous mutant or biallelic mutant for a target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant. The method of claim 1,
The polynucleotide encoding the sgRNA is any one or more selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13. The method of claim 1,
The method, characterized in that the target gene is a gene related to male infertility. The method of claim 1,
The target gene is any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene. 5. The method of claim 4,
The Os12BGlu38 gene consists of the nucleotide sequence of SEQ ID NO: 1, the OsHXK5 gene consists of the nucleotide sequence of SEQ ID NO: 4, and the OsPLGG1 gene consists of the nucleotide sequence of SEQ ID NO: 7. Method, characterized in that. The method of claim 1,
The transgenic plant of step (a) is a method characterized in that it is a homozygous mutant or a biallelic mutant. (a) preparing a transgenic plant by transforming it with a recombinant vector into which a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted;
(b) crossing the transgenic plant and the wild-type plant; and
(c) a method for producing a male sterile maintainer comprising the step of selecting a plant expressing the fluorescent marker protein. 8. The method of claim 7,
The method, characterized in that the plant expressing the fluorescent marker protein is a homozygous mutant or a biallelic mutant. (a) preparing a transgenic plant by transforming it with a recombinant vector into which a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted;
(b) crossing the transgenic plant and the wild-type plant; and
(c) A method for producing a Non-Genetically Modified Organism (Non-GMO) plant comprising the step of selecting a plant that does not express the fluorescent marker protein. 10. The method of claim 9,
The method, characterized in that the plant that does not express the fluorescent marker protein is a heterozygous mutant. 10. The method of claim 9,
The method, characterized in that the polynucleotide encoding the fluorescent labeling protein consists of the nucleotide sequence of SEQ ID NO: 14. A recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent label protein,
The polynucleotide encoding the sgRNA is a recombinant vector, characterized in that at least one selected from the group consisting of the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13. 13. The method of claim 12,
The polynucleotide encoding the sgRNA is a recombinant vector, characterized in that at least one selected from the group consisting of nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 11 and SEQ ID NO: 13. 13. The method of claim 12,
The target gene is a recombinant vector, characterized in that any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene. 13. The method of claim 12,
The fluorescent label protein is a recombinant vector, characterized in that selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP) and cyan fluorescent protein (CFP). 13. The method of claim 12,
The polynucleotide encoding the fluorescent label protein is a recombinant vector, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 14. A transgenic plant transformed with the recombinant vector of claim 12 . 18. The method of claim 17,
The plant is a transgenic plant, characterized in that it is a homozygous mutant or a biallelic mutant for the target gene. The seed of the transgenic plant of claim 17 .

Images