WO2021125503A1

WO2021125503A1 - Method for preparing loss-of-function mutant in f1 hybrid using crispr/cas system

Info

Publication number: WO2021125503A1
Application number: PCT/KR2020/012037
Authority: WO
Inventors: 전종성; 이상규; 심수현
Original assignee: 경희대학교 산학협력단
Priority date: 2019-12-17
Filing date: 2020-09-07
Publication date: 2021-06-24

Abstract

The present invention relates to: a method for preparing a homozygous mutant or heterozygous mutant of a target gene in an F1 hybrid by preparing a transgenic plant in which a mutation for a target gene is induced, by using a CRISPR/Cas system, and crossing the transgenic plant with a wild-type plant; and a method for preparing a male sterile maintainer line or non-GMO plant that can be classified through fluorescence, by using a recombinant vector to which a fluorescently labeled gene has been added.

Description

Method for producing loss-of-function mutants in one-to-one hybrids using the CRISPR/CAS system

The present invention provides a method for producing a mutant for a target gene using the CRISPR / Cas system; Method for producing male infertility eujichin; And it relates to a method for producing a Non-GMO plant.

Male sterile mutations due to natural and induced mutations have been reported in several species of higher plants. These mutations have been associated with several different phenotypes, which include structural variations, such as short filaments, lack of dehiscence or flat surfaces, and functional defects associated with gamete formation, particularly meiosis. contains pollen. Both of these mutations produce non-functional pollen.

Male infertility can be divided into nuclear genotype (genic male sterility) and cytoplasmic genotype (cytoplasmic male sterility) according to the genetic pattern. Nuclear genotype male infertility is found because it adversely affects survival. It is mainly recessive, and in the case of homozygous recessive, it takes sterility, so it takes a lot of effort to maintain and propagate sterility. Depending on the flower, it is difficult to determine fertility due to small flowers, and it is difficult to apply to crops that take a lot of time to bloom.

Because cytoplasmic male sterility produces 100% sterile strains by crossing any fertile strain, individuals and strains that can produce 50% or 100% sterility by crossing various fertile strains to sterile strains, that is, maintainers (maintainers) ) is found and planted, so it is inconvenient, but the intended purpose of infertility can be achieved. However, for one-to-one hybrid breeding, artificial male infertility through radiation and chemical agents for obtaining male sterility has also been attempted, but there is a problem in that side effects must be resolved.

Although a lot of investment is being made in the development and research of male sterile plants for producing F1 seeds, the research results on this are very insignificant due to problems with male sterile plants so far. In addition, in many male sterile plant development methods using genetic engineering techniques, most of the cases in which one-to-one hybrids include foreign genes such as herbicide resistance genes, and their use is very limited due to regulations on various GMO crops. If you can overcome the disadvantages of these male sterility plants, that is, if you can secure a stable male sterility and maintain sterility without the need for other maintenance systems, it can be usefully used for easy new variety development and high value-added industrial production. There will be. Therefore, it is possible to secure stable male sterility, and there is a need for research on novel methods or novel genes for maintaining male sterility.

[Prior art literature]

[Patent Literature]

Korean Patent Publication No. 10-2018-0077370

It is an object of the present invention to transform with a recombinant vector into which (a) a polynucleotide encoding a single guide RNA (sgRNA) capable of recognizing a target gene and a polynucleotide encoding a CRISPR-associated nuclease (Cas) protein are inserted. preparing a converted plant; And (b) a method for producing a homozygous mutant or biallelic mutant for the target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant is to provide

Another object of the present invention is to transform with a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a converted plant; (b) crossing the transgenic plant and the wild-type plant; And (c) to provide a method for producing a male sterile maintainer comprising the step of selecting a plant expressing the fluorescent marker protein.

Another object of the present invention is to transform with a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a converted plant; (b) crossing the transgenic plant and the wild-type plant; And (c) to provide a method for producing a Non-Genetically Modified Organism (Non-GMO) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.

Another object of the present invention is a recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent label protein, the polynucleotide encoding the sgRNA Nucleotides are to provide a recombinant vector, characterized in that at least one selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9.

Another object of the present invention is to provide a transgenic plant transformed with the recombinant vector.

Another object of the present invention is to provide a seed of the transgenic plant.

In order to achieve the above object, the present invention provides a recombinant vector into which (a) a polynucleotide encoding a single guide RNA (sgRNA) capable of recognizing a target gene and a polynucleotide encoding a Cas (CRISPR-associated nuclease) protein are inserted Transforming to prepare a transgenic plant; And (b) a method for producing a homozygous mutant or biallelic mutant for the target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant provides

In one embodiment of the present invention, the polynucleotide encoding the sgRNA may be any one or more selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 13 have.

In one embodiment of the present invention, the target gene may be a gene related to male infertility, but is not limited thereto.

In one embodiment of the present invention, the target gene may be any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene, but is not limited thereto.

In one embodiment of the present invention, the Os12BGlu38 gene consists of the nucleotide sequence of SEQ ID NO: 1, the OsHXK5 gene consists of the nucleotide sequence of SEQ ID NO: 4, and the OsPLGG1 gene consists of the nucleotide sequence of SEQ ID NO: 7 can

In one embodiment of the present invention, the transgenic plant of step (a) may be a homozygous mutant or a biallelic mutant.

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a male sterile maintainer comprising the step of selecting a plant expressing the fluorescent marker protein.

In one embodiment of the present invention, the plant expressing the fluorescent marker protein may be a homozygous mutant or a biallelic mutant.

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a Non-GMO (Non-Genetically Modified Organism) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.

In one embodiment of the present invention, the plant that does not express the fluorescent marker protein may be a heterozygous mutant.

In addition, the present invention is a recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein, wherein the polynucleotide encoding the sgRNA comprises: SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11 and provides a recombinant vector, characterized in that any one or more selected from the nucleotide sequence consisting of SEQ ID NO: 13.

In one embodiment of the present invention, the polynucleotide encoding the sgRNA may be at least one selected from the group consisting of the nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 11, and SEQ ID NO: 13.

In one embodiment of the present invention, the target gene may be any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene.

In one embodiment of the present invention, the fluorescent label protein may be one selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP) and cyan fluorescent protein (CFP). , but is not limited thereto.

In addition, the present invention provides a transgenic plant transformed with the recombinant vector.

In one embodiment of the present invention, the plant may be a homozygous mutant or a biallelic mutant for the target gene.

In addition, the present invention provides a seed of the transgenic plant.

The method according to the present invention induces a mutation for a target gene using the CRISPR/Cas system, and then crosses a wild-type plant to generate a homozygous mutant or a biallelic mutant for the target gene in a one-to-one hybrid (F1). It can be manufactured, and by adding a fluorescent labeling protein to the recombinant vector, it is possible to easily classify male sterile oleaginous or Non-GMO plants through fluorescence, so that various applications are possible in the agricultural field.

1 shows a schematic diagram of an inserted gene for inducing mutation of the Os12BGlu38 gene using the CRISPR/Cas system.

2 is a result of confirming the genotype by analyzing the nucleotide sequence of the Os12BGlu38 gene target site in the T0 plant produced using CRISPR/Cas9.

3 is a result of confirming whether the CRISPR/Cas9 transporter is inserted in a one-to-one hybrid (F1).

4 is a result of confirming the genotype of an individual in which the CRISPR/Cas9 transporter is not inserted in a one-to-one hybrid (F1).

5 is a result of confirming the genotype of the CRISPR/Cas9 transporter inserted in the one-to-one hybrid (F1).

6 shows a schematic diagram of an inserted gene for inducing mutation of the OsHXK5 gene using the CRISPR/Cas system.

7 is a result of confirming the genotype by analyzing the nucleotide sequence of the OsHXK5 gene in the T0 plant produced using CRISPR/Cas9.

Figure 8A is a genotype analysis result by analyzing the nucleotide sequence of the OsHXK5 gene target site in an individual having a CRISPR/Cas9 transporter inserted in a one-to-one hybrid (F1) using a wild type as a model, and 8B is a one-to-one hybrid using a wild type as a copy ( This is the result of genotype analysis by analyzing the nucleotide sequence of the OsHXK5 gene target site in the CRISPR/Cas9 transporter inserted in F1).

9 shows a schematic diagram of an inserted gene for inducing mutation of the OsPLGG1 gene using the CRISPR/Cas system.

10A is the result of genotype analysis by analyzing the nucleotide sequence of the OsPLGG1 gene target site in an individual having a CRISPR/Cas9 transporter inserted in a one-to-one hybrid (F1) using a wild type as a model, and 10B is a one-to-one hybrid using a wild type as a copy ( This is the result of genotype analysis by analyzing the nucleotide sequence of the OsPLGG1 gene target site in an individual with the CRISPR/Cas9 transporter inserted in F1).

11 shows a schematic diagram of an applied carrier (recombinant vector).

Figure 12 shows a schematic diagram of male infertility maintenance (maintainer line) and Non-GM (Transgene free) hybrid development using the CRISPR / Cas system.

Throughout this specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

As used throughout this specification, the terms “step of” or “step of” do not mean “step for”.

The present invention comprises the steps of (a) transforming a polynucleotide encoding a single guide RNA (sgRNA) capable of recognizing a target gene and a polynucleotide encoding a Cas protein into a recombinant vector to prepare a transgenic plant; And (b) a method for producing a homozygous mutant or biallelic mutant for the target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant provides

In the above, "gRNA (guide RNA) or sgRNA (single guide RNA)" refers to an RNA molecule that can bind to a Cas protein and is involved in gene editing by recognizing a specific location within a target gene of the Cas protein. , gRNA includes crRNA (CRISPR RNA) that specifically targets Cas9 (CRISPR-associated nuclease) protein and tracrRNA (trans-activating crRNA) that forms a partial complementary bond with pre-crRNA.

In the present invention, the polynucleotide encoding the sgRNA may be any one or more selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 9.

In the above, "Cas (CRISPR-associated nuclease)" is an RNA-guided DNA endonuclease enzyme related to CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), and is used for gene editing.

In the present invention, the target gene may be a gene related to male infertility, that is, a male infertility gene, or a general gene other than a male infertility gene. Preferably, it may be a male infertility gene, Os12BGlu38 gene or OsHXK5 gene, and may be a general gene, OsPLGG1 gene, but is not limited thereto.

As used above, "male sterile" refers to a phenomenon in which pollination, fertilization, and seed formation are not made due to morphological or functional abnormalities of the male organ, and when expressed as a temporary environmental mutation or expressed as a genetic trait In some cases, male infertility in the present invention may be induced as a genetic trait.

The Os12BGlu38 gene may consist of the nucleotide sequence of SEQ ID NO: 1, the OsHXK5 gene may consist of the nucleotide sequence of SEQ ID NO: 4, and the OsPLGG1 gene may consist of the nucleotide sequence of SEQ ID NO: 7, but is limited thereto no.

As used herein, the term "recombinant vector" refers to a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert. As used herein, the term “operably linked” means that a nucleic acid expression control sequence and a nucleic acid sequence (nucleotide sequence) encoding a target protein or RNA are functionally linked to perform a general function. say that For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the encoding nucleic acid sequence. The operable linkage with the recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation using enzymes generally known in the art.

The recombinant vector of the present invention may include a polynucleotide encoding an sgRNA capable of recognizing a target gene and a polynucleotide encoding a Cas protein, and may further include a polynucleotide encoding a fluorescent label protein. . In addition, it may include a polynucleotide encoding two or more sgRNAs capable of recognizing one target gene, and a polynucleotide encoding two or more sgRNAs capable of recognizing two or more target genes, respectively. it could be

For example, two or three different polynucleotides may be inserted from among polynucleotides encoding sgRNA consisting of the nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 11 and SEQ ID NO: 13 that can recognize the Os12BGlu38 gene, Preferably, the polynucleotide encoding the gRNA consisting of the nucleotide sequence of SEQ ID NO: 3 may be inserted.

In addition, any one of the polynucleotides encoding the sgRNA consisting of the base sequence of SEQ ID NO: 3, SEQ ID NO: 11 and SEQ ID NO: 13 capable of recognizing the Os12BGlu38 gene; a polynucleotide encoding an sgRNA consisting of the nucleotide sequence of SEQ ID NO: 6 capable of recognizing the OsHXK5 gene; and two or three different polynucleotides from among polynucleotides encoding sgRNA consisting of the nucleotide sequence of SEQ ID NO: 9 capable of recognizing the OsPLGG1 gene may be inserted.

As used herein, "transformation" refers to a change in the genetic characteristics of a cell by injecting a DNA molecule such as the recombinant vector into a host cell and binding it with the DNA of the host cell. As the transformation method, techniques well known in the art such as microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection and DEAE-dextran treatment and Agrobacterium mediated transfection may be used.

In the above, "crossing" may be made through back cross (back cross) or reciprocal cross (reciprocal cross).

In the above, "homozygous mutant" refers to a plant in which the same mutation appears in two alleles, and "biallelic mutant" refers to a plant that is identical to two alleles. However, it refers to a plant in which all mutations appear, and "heterozygous mutant" refers to a plant in which only one of the two alleles has a mutation.

In the present invention, a transgenic plant transformed with a recombinant vector was shown as a homozygous mutation or a biallelic mutation, and the mutated transgenic plant and a wild-type plant were backcrossed or crossed. In the case of one-to-one hybrids (F1), it was confirmed that not only heterozygous mutations appeared according to Mendel's law, but also homozygous mutations or biallelic mutations appeared in one-to-one hybrids (F1) depending on whether the recombinant vector was included. That is, a genotype that is a homozygous mutation or a biallelic mutation in a one-to-one hybrid (F1) can be prepared.

Plants of the present invention include monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats and onions, cotton, tomatoes, Arabidopsis thaliana, eggplant, tobacco, red pepper, burdock, sagebrush, lettuce, bellflower, spinach, chard , sweet potato, celery, carrot, water parsley, parsley, Chinese cabbage, cabbage, radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean and pea, etc. may be dicotyledonous plants, but is not limited thereto. .

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a male sterile maintainer line comprising the step of selecting a plant expressing the fluorescent marker protein.

As used above, "male sterile maintainer line" refers to a parent or line capable of maintaining male sterility. In the present invention, a plant expressing a fluorescent label protein can become a male infertility parent as a homozygous mutant or biallelic mutant having CRISPR/Cas9. have.

In addition, the present invention is a transgenic plant by transforming a recombinant vector into which (a) a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted. preparing a; (b) crossing the transgenic plant and the wild-type plant; And (c) provides a method for producing a Non-Genetically Modified Organism (Non-GMO) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.

In the above, "Non-GMO" refers to non-genetically modified organisms. In the present invention, a plant that does not express the fluorescent marker protein is a heterozygous mutant that does not have CRISPR/Cas9, and can be a plant in which a foreign gene is not inserted. There are advantages.

In addition, the present invention is a recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein, wherein the polynucleotide encoding the sgRNA comprises: It provides a recombinant vector, characterized in that at least one selected from the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9.

The target gene may be any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene, but is not limited thereto. In addition, it may include a polynucleotide encoding two or more sgRNAs capable of recognizing one target gene, and a polynucleotide encoding two or more sgRNAs capable of recognizing two or more target genes, respectively. it could be

The fluorescent label protein may be selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and cyan fluorescent protein (CFP), but is not limited thereto.

In addition, the present invention provides a transgenic plant transformed with the recombinant vector and a seed of the transgenic plant. The plant or seed may be a homozygous mutant or a biallelic mutant for the target gene.

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to these examples.

실시예 1. CRISPR/Cas9 시스템을 이용한Example 1. Using the CRISPR/Cas9 system Os12BGlu38 유전자의 돌연변이 유도Mutation of the Os12BGlu38 gene

As a result of analyzing the genotypes of various transformants and progeny plants made using the CRISPR/Cas9 system, the present inventors found that when a plant expressing Cas9 protein and sgRNA (single guide RNA) at the same time was crossed with a wild-type plant, the wild-type chromosome In the target gene delivered from the fertilization or embryogenesis, mutations are continuously induced during the early stage of embryogenesis, so that a heterozygous mutant of the target gene is identified as a homozygous mutant of the target gene or a heterozygous allele of the target gene. The phenomenon of making it a biallelic mutant was discovered.

Accordingly, the present inventors applied to the male sterile gene to prepare a stable male infertility plant, and to recognize TCCATGATCAATACAAGGGA (SEQ ID NO: 2) among the nucleotide sequences of the Os12BGlu38 gene (SEQ ID NO: 1), which is a gene inducing male infertility. The nucleotide sequence (SEQ ID NO: 3) corresponding to the capable sgRNA and the nucleotide sequence encoding the Cas protein were inserted into the carrier (recombinant vector, FIG. 1) to transform rice, and the transformed plant was named “T0”. .

Then, the present inventors performed an experiment to confirm the genotype through the analysis of the nucleotide sequence TCCATGATCAATACAAGGGA of the Os12BGlu38 gene in three T0 plants transformed using CRISPR/Cas9. Briefly, a 24-bp primer sequence capable of amplifying a section containing the Os12BGlu38 target sequence (SEQ ID NO: 2) by extracting DNA from the leaves of wild-type (WT) and one-to-one hybrid (F1) plants to be used as a control. By making a pair, PCR (Polymerase Chain Reaction) was performed. When the DNA amplified through PCR was electrophoresed, a band with a size of 708bp or a band larger or smaller than this was confirmed depending on the mutation pattern. Then, when the nucleotide sequence was determined using the corresponding band, mutations of a different aspect from the wild type were identified within the 708bp section including the target sequence, and all three T0 plants were confirmed to be biallelic mutants. (Fig. 2).

In addition, the present inventors performed an experiment to confirm the genotype of the one-to-one hybrid (F1) after backcrossing one of the three T0 plants with the wild-type Dongjinbyeo. Polymerase Chain Reaction (PCR) was performed by preparing a pair of 24 bp primer nucleotide sequences that are present in the CRISPR/Cas9 transporter but not in wild-type rice. When the DNA amplified through PCR is electrophoresed, if the carrier DNA is amplified and a band with a size of 931 bp is confirmed, it is a plant containing the CRISPR/Cas9 carrier, and if it is not confirmed, it can be called a plant without the carrier. First, it was confirmed whether the CRISPR/Cas9 transporter was inserted in the one-to-one hybrid (F1), #2, #4, #7, #9, #10, #12, #13, #18, #19, #24 and # It was confirmed that the CRISPR/Cas9 transporter was inserted in 25 subjects ( FIG. 3 ).

According to the above results, the present inventors found that the remaining individuals (#1, #3, #5, #6, #8, #11, #14, #15, # The genotype of the Os12BGlu38 gene was confirmed in 16, #17, #20, #21, #22 and #23). As a result, it was confirmed that all of the individuals were heterozygous mutants ( FIG. 4 ). In addition, the CRISPR/Cas9 transporter inserted in the co-hybrid (F1) (#2, #4, #7, #9, #10, #12, #13, #18, #19, #24 and #25) It was confirmed that all genotypes of the Os12BGlu38 gene were homozygous or biallelic mutations (FIG. 5).

Thus, all of the CRISPR/Cas transporter-introduced one-to-hybrid (F1) plants are either homozygous or biallelic mutants, and all mutants maintain male sterility, whereas one-to-one CRISPR/Cas transporters are not inserted. (F1) It was confirmed that all of the plants were heterozygous mutants.

In addition, when the CRISPR/Cas transporter was not inserted into a direct hybrid, all of the offspring did not show the male infertility phenotype, and in the case of the genotype, the ratio of heterozygous mutation to wild type was 1:1, resulting in a general mutation separation ratio. confirmed to follow.

실시예 2. CRISPR/Cas9 시스템을 이용한Example 2. Using the CRISPR/Cas9 system OsHXK5 유전자의 돌연변이 유도Mutation of the OsHXK5 gene

The present inventors performed the same experiment as in Example 1 to produce stable male infertility plants using the OsHXK5 gene, which is another gene inducing male infertility. First, a nucleotide sequence corresponding to sgRNA that can recognize GCGGGGCATCTCGGACGCCA (SEQ ID NO: 5) among the nucleotide sequences of the OsHXK5 gene (SEQ ID NO: 4), which is a gene inducing male infertility (SEQ ID NO: 6) and a nucleotide sequence encoding a Cas protein was inserted into a carrier (recombinant vector, FIG. 6) to transform the rice.

Thereafter, an experiment was performed to confirm the genotype through analysis of the base sequence GCGGGGCATCTCGGACGCCA of the OsHXK5 gene in 10 transformed plants. As a result, it was confirmed that all 10 plants were homozygous or biallelic mutants ( FIG. 7 ).

In addition, the present inventors performed a reciprocal cross between a plant in which the CRISPR/Cas carrier was inserted and a wild-type Dongjinbyeo among T1 plants obtained by self-fertilizing plant #2 among the 10 plants, and then a one-generation hybrid (F1) An experiment was performed to confirm the genotype through analysis of the nucleotide sequence GCGGGGCATCTCGGACGCCA of the OsHXK5 gene in plants. As a result, it was confirmed that all of the CRISPR/Cas9 transporter inserted individuals among the one-to-one hybrid (F1) plants using the wild type as a model were homozygous or biallelic mutations ( FIG. 8A ), and the one-to-one hybrids using the wild type as a parent ( FIG. 8A ). F1) All of the CRISPR/Cas9 transporters in plants were confirmed to be homozygous or biallelic mutations (FIG. 8B), so all of the plants in which CRISPR/Cas transporters were inserted were homozygous or biallelic mutations. was confirmed to be.

실시예 3. CRISPR/Cas9 시스템을 이용한Example 3. Using the CRISPR/Cas9 system OsPLGG1 유전자의 돌연변이 유도Induction of mutations in the OsPLGG1 gene

The present inventors performed the same experiment as in Example 1 using the OsPLGG1 gene in order to check whether the same results are shown in general genes other than male infertility genes. OsPLGG1 loss-of-function In rice, photorespiration is restricted and the chlorophyll content of leaves is reduced, paying attention to the phenotype of the OsPLGG1 gene (SEQ ID NO: 7). A nucleotide sequence corresponding to sgRNA that can recognize CCTCTTCTACGTCCCTTCCC (SEQ ID NO: 8) (SEQ ID NO: 9) and a nucleotide sequence encoding a Cas protein were inserted into a carrier (recombinant vector, FIG. 9) to transform rice.

Thereafter, an experiment was performed to confirm the genotype through analysis of the nucleotide sequence CCTCTTCTACGTCCCTTCCC of the OsPLGG1 gene in the four transformed plants, and it was confirmed that all of them were biallelic mutants. In addition, after performing a reciprocal cross between a plant having the nucleotide sequence of CCTCTTCTACGTCCCTTCCC and a wild-type Dongjinbyeo in which T was inserted among the self-fertilized T1 plants, an experiment was performed to confirm the genotype in a one-to-one hybrid (F1) plant. As a result, it was confirmed that all 41 individuals into which the CRISPR/Cas9 transporter was inserted among cohort hybrid (F1) plants using the wild type as a model were homozygous or biallelic mutations (FIG. 10A), and the cohort using the wild type as a copy. Among hybrid (F1) plants, all 9 individuals into which the CRISPR/Cas9 transporter was inserted were also confirmed to be homozygous or biallelic mutations (FIG. 10B), so that all plants in which the CRISPR/Cas transporter was inserted were homozygous or biallelic. It was confirmed that it was a factor mutation. In addition, it was confirmed that all 50 one-to-one hybrid (F1) plants exhibited a phenotype in which the chlorophyll content was decreased.

실시예 4. CRISPR/Cas9 시스템을 이용한 유지친 및 Non-GM(Non-Genetically Modified Organism) 식물체의 제조Example 4. Preparation of oleaginous and Non-Genetically Modified Organism (GM) plants using the CRISPR/Cas9 system

The present inventors inserted the sgRNA for the male infertility gene into the CRISPR/Cas9 carrier to induce gene mutation and at the same time insert the fluorescent marker gene together to create a carrier (recombinant vector) so that the transformed seed can be easily separated by fluorescence (Fig. 11A).

In addition, when male infertility gene mutation is induced after fertilization, one male infertility gene is added to the CRISPR/Cas9 carrier in case three or a multiple of 3 genes are accidentally inserted/deleted to maintain the activity of the wild-type male infertility protein. Inducing two different mutations or deletion of long nucleotide sequences in one individual by inserting two different sgRNAs for A carrier (recombinant vector) was constructed so that the

In addition, when the male infertility gene mutation is induced after fertilization, two different types of CRISPR/Cas9 transporters are added to the CRISPR/Cas9 transporter in case three or a multiple of three genes are accidentally inserted/deleted to maintain the activity of the wild-type male infertility protein. By inserting two different sgRNAs for the male infertility gene, two different mutations are induced in one individual, and at the same time, a fluorescent marker gene is inserted into the CRISPR/Cas carrier so that the transformed seeds can be easily separated by fluorescence. A vehicle (recombinant vector) was constructed ( FIG. 11C ).

As the fluorescent marker gene, mCherry cDNA (SEQ ID NO: 14), which is mRFP (monomeric red fluorescent protein), was used to transform a plant transformed with the carrier into a red color, so that it could be selected by fluorescence spectroscopy.

Among the plants transformed with the carrier (recombinant vector), the homozygous mutant or the biallelic mutant is backcrossed with the wild type, and then the plant into which the CRISPR / Cas9 carrier is inserted is selected using the expression of the fluorescent marker protein. genotype can be identified. In this case, if all plants expressing the fluorescent marker protein are confirmed to be male infertile, it means that CRISPR/Cas9-derived mutations were induced even in the chromosomes received from the wild-type during fertilization. ) can be used as In addition, a plant that does not express the fluorescent marker protein is a heterozygous mutation for the male infertility gene and at the same time is a Non-GMO (Non-Genetically Modified Organism) because a foreign gene is not inserted. can

실시예 5. CRISPR/Cas9 시스템을 이용한Example 5. Using the CRISPR/Cas9 system Os12BGlu38 유전자의 돌연변이 식물체의 비교Comparison of Os12BGlu38 gene mutant plants

The present inventors constructed sgRNA sequences targeting various regions of the Os12BGlu38 gene in order to confirm the production efficiency of transgenic plants using the CRISPR/Cas9 system, and prepared various mutated plant preparations using the sgRNA sequences.

Specifically, the sgRNA nucleotide sequence (SEQ ID NO: 3) capable of recognizing TCCATGATCAATACAAGGGA (SEQ ID NO: 2) among the nucleotide sequences of the Os12BGlu38 gene (SEQ ID NO: 1) described in Example 1, and GACACCTTCCTGATGCAACC (SEQ ID NO: 10) capable of recognizing One of the gRNA sequences (SEQ ID NO: 13) capable of recognizing the sgRNA sequence (SEQ ID NO: 11) and GGTCTCGCATTTTCCCCAGT (SEQ ID NO: 12), and a carrier (recombinant vector) encoding the Cas9 protein was prepared. The prepared vehicle was transformed into rice.

Then, the present inventors performed mutation efficiency evaluation by confirming the genotype through sequencing of the Os12BGlu38 gene using the method disclosed in Example 1 in three plants using each sgRNA. As a result, the recombinant vector encoding the sgRNA of SEQ ID NO: 3 had a higher mutation probability than the sgRNAs of SEQ ID NO: 11 and SEQ ID NO: 13 targeting other sites of Os12BGlu38.

According to the above results, the mutation probability of the sgRNA target sequence was different, and the sgRNA of SEQ ID NO: 11 and SEQ ID NO: 13 was found to have low efficiency as an off-target, whereby the sgRNA nucleotide sequence of SEQ ID NO: 3 was high. It was confirmed that Os12BGlu38 male sterile plants could be produced with probability.

Claims

(a) Transforming with a recombinant vector into which a polynucleotide encoding a sgRNA (single guide RNA) capable of recognizing a target gene and a polynucleotide encoding a Cas (CRISPR-associated nuclease) protein are inserted to prepare a transgenic plant step; and

(B) a method for producing a homozygous mutant or biallelic mutant for a target gene in a one-to-one hybrid (F1) comprising the step of crossing the transgenic plant and the wild-type plant.
The method of claim 1,

The method, characterized in that the polynucleotide encoding the sgRNA is at least one selected from the group consisting of the base sequence of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13.
The method of claim 1,

The method, characterized in that the target gene is a gene related to male infertility.
The method of claim 1,

The target gene is any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene.
5. The method of claim 4,

The Os12BGlu38 gene consists of the nucleotide sequence of SEQ ID NO: 1, the OsHXK5 gene consists of the nucleotide sequence of SEQ ID NO: 4, and the OsPLGG1 gene consists of the nucleotide sequence of SEQ ID NO: 7. Method, characterized in that.
The method of claim 1,

The transgenic plant of step (a) is a method characterized in that it is a homozygous mutant or a biallelic mutant.
(a) preparing a transgenic plant by transforming it with a recombinant vector into which a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted;

(b) crossing the transgenic plant and the wild-type plant; and

(c) a method for producing a male sterile maintainer comprising the step of selecting a plant expressing the fluorescent marker protein.
8. The method of claim 7,

The method, characterized in that the plant expressing the fluorescent marker protein is a homozygous mutant or a biallelic mutant.
(a) preparing a transgenic plant by transforming it with a recombinant vector into which a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent marker protein are inserted;

(b) crossing the transgenic plant and the wild-type plant; and

(c) A method for producing a Non-Genetically Modified Organism (Non-GMO) plant comprising the step of selecting a plant that does not express the fluorescent marker protein.
10. The method of claim 9,

The method, characterized in that the plant that does not express the fluorescent marker protein is a heterozygous mutant.
10. The method of claim 9,

The method, characterized in that the polynucleotide encoding the fluorescent labeling protein consists of the nucleotide sequence of SEQ ID NO: 14.
A recombinant vector comprising a polynucleotide encoding an sgRNA capable of recognizing a target gene, a polynucleotide encoding a Cas protein, and a polynucleotide encoding a fluorescent label protein,

The polynucleotide encoding the sgRNA is a recombinant vector, characterized in that at least one selected from the group consisting of the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 13.
13. The method of claim 12,

The polynucleotide encoding the sgRNA is a recombinant vector, characterized in that at least one selected from the group consisting of nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 11 and SEQ ID NO: 13.
13. The method of claim 12,

The target gene is a recombinant vector, characterized in that any one or more genes selected from the group consisting of Os12BGlu38 gene, OsHXK5 gene and OsPLGG1 gene.
13. The method of claim 12,

The fluorescent label protein is a recombinant vector, characterized in that selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP) and cyan fluorescent protein (CFP).
13. The method of claim 12,

The polynucleotide encoding the fluorescent label protein is a recombinant vector, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 14.
A transgenic plant transformed with the recombinant vector of claim 12 .
18. The method of claim 17,

The plant is a transgenic plant, characterized in that it is a homozygous mutant or a biallelic mutant for the target gene.
The seed of the transgenic plant of claim 17 .