WO2024036600A1

WO2024036600A1 - Autonomous parthenogenetic haploid reproduction method for maternal cells and use thereof in breeding

Info

Publication number: WO2024036600A1
Application number: PCT/CN2022/113576
Authority: WO
Inventors: 谢传晓; 祁显涛; 高惠敏; 刘昌林; 朱金洁; 黄晶; 徐孝洁; 赵延明; 毛文博; 吕仁瑶
Original assignee: 中国农业科学院作物科学研究所
Priority date: 2022-08-19
Filing date: 2022-08-19
Publication date: 2024-02-22

Abstract

Disclosed in the present invention are an autonomous parthenogenetic haploid reproduction method for maternal cells and use thereof in breeding. The present invention provides a method for obtaining a parthenogenetic haploid of corn, comprising: introducing a system vector of a CRISPRa5 gene activation system that mediates ectopic expression of the ZmBBM2 gene in corn oocytes into a receptor corn to obtain a positive transgenic corn. The realization of ectopic activation of the ZmBBM2 gene in plant oocytes results in the direct development of the oocytes into haploid embryos. The present invention provides an effective way to obtain crop haploids. Meanwhile, the present invention provides a new gene resource for corn parthenogenesis and provides new insights into apomixis synthesis of other crops.

Description

A maternal cell-autonomous parthenogenetic haploid reproduction method and its breeding application

Technical field

The invention relates to the field of biotechnology, and in particular to a maternal cell-autonomous parthenogenetic haploid reproduction method and its breeding application.

Background technique

The process of plant apomixis forms seeds without fertilization of sperm and egg cells. This reproductive method can produce seeds whose genotype is exactly the same as that of the female parent. Therefore, it has great potential in fixing hybrid vigor, improving breeding efficiency, and reducing seed production costs. Potential, known as the "apomixis revolution" in the hybrid breeding community to achieve a new green revolution (Spillane, C., Steimer, A., and Grossniklaus, U. (2001) Apomixis in agriculture: the quest for clonal seeds.Sex .Plant Reprod.,14,179–187.). However, the lack of apomictic germplasm resources in major food crops such as corn, rice and wheat limits the promotion and application of this technology in important economic food crops. In 2019, researcher Wang Kejian's team and Professor Sundaresan's team independently and independently used gene editing technology to create a clonal reproduction technology that combines mitotic meiosis (MiMe) with parthenogenesis, and for the first time conceptually verified the feasibility of rice apomixis technology. sex. However, the low parthenogenetic haploid seed setting rate is still a bottleneck that limits the application of this technology (Wang, C., Liu, Q., Shen, Y., Hua, Y., Wang, J., Lin, J., et al. (2019) Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat. Biotechnol., 37, 283–286. Khanday, I., Skinner, D., Yang, B., Mercier, R., and Sundaresan, V. (2019) A male-expressed rice embryogenic trigger redirected for asexual propagation through seeds. Nature, 565, 91–95.). Therefore, exploring the pathogenesis of crop parthenogenetic haploidy and analyzing its biological mechanism have important theoretical significance and practical value.

BBM transcription factors belong to the APETALA2 (AP2) family and play an important regulatory role in regulating the development of floral meristems and promoting cell proliferation and morphogenesis (Kim S, Soltis P S, Wall K, et al. Phylogeny and domain evolution in the APETALA2-like gene family[J].Molecular Biology and Evolution, 2006,23(1):107-120.). Previous studies have shown that ectopic expression of BBM transcription factors in egg cells can significantly increase the frequency of plant parthenogenetic haploids. In 2015, Conner et al. found that ectopic expression of the Pennisetum BBM gene PsASGR-BBML in egg cells could induce the formation of 36% parthenogenetic haploids in offspring (Conner J A, Mookkan M, Huo H, et al. A parthenogenesis gene of apomict origin elicits embryo formation from unfertilized eggs in a sexual plant[J].Proceedings of the National Academy of Sciences,2015,112(36):11205-11210.). In 2017, Conner et al. used the egg cell-specific promoter pDD45 to activate the PsASGR-BBML gene, achieving ectopic expression of the PsASGR-BBML gene in rice and corn egg cells and obtaining 89% and 80% of parthenogenetic haploid offspring respectively. Studies using the endogenous PsASGR-BBML gene promoter to activate PsASGR-BBML in maize can still induce haploid formation but the frequency is only 47% (Conner J A, Podio M, Ozias A P. Haploid embryo production in rice and maize induced by PsASGR-BBML transgenes[J].Plant Reproduction,2017,30(1):41-52.). In 2018, Khanday et al. found that ectopic expression of OsBBM1 gene in rice egg cells can significantly increase the frequency of rice parthenogenetic haploid induction (Khanday, I., Skinner, D., Yang, B., Mercier, R., and Sundaresan, V .(2019)A male-expressed rice embryogenic trigger redirected for asexual propagation through seeds.Nature,565,91–95.).

In eukaryotic cells, gene expression is tightly controlled during processes such as development and differentiation. Transcription factors are key regulators of target gene transcription by binding to specific DNA sequences in the enhancer and promoter regions of target genes (Spitz, F. and Furlong, E.E.M. (2012) Transcription factors: from enhancer binding to developmental control. Nat .Rev.Genet.,13,613–626.). Based on the same principle, artificial transcription factors (ATFs) fuse sequence-specific DNA-binding domains to activation domains to regulate gene expression, such as zinc-finger ATFs (Wilson, K.A., Chateau, M.L., and Porteus) ,M.H.(2013)Design and development of artificial zinc finger transcription factors and zinc finger nucleases to the hTERT locus.Mol.Ther.Nucleic Acids,2,e87.), transcription activator-like effector ATF (Liu, W., Rudis ,M.R.,Peng,Y.,Mazarei,M.,Millwood,R.J.,Yang,J.-P.,et al.(2014)Synthetic TAL effectors for targeted enhancement of transgene expression in plants.Plant Biotechnol.J.,12,436 –446.) and CRISPR-mediated gene activation system (Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., et al. (2013) CRISPR-mediated modular RNA -guided regulation of transcription in eukaryotes. Cell,154,442–451.). Different from previous ATFs tools, CRISPR-mediated gene activation, also known as CRISPRa, has the advantages of simple, flexible design and low cost. Therefore, in recent years, gene activation systems have been used to regulate endogenous genes in plants and study target genes. Expression networks have always been a hot topic in the field of plant research. The development of gene expression regulation tools based on gene editing systems has enriched the series of plant transcription activation tools, such as several efficient CRISPRa tools that have been established in animals: VP64-P65-Rta (VPR), CRISPR-SAM, and Cas9-SunTag. In plants, a series of transcription activation tools such as dCas9-VP64, dCas9-6TAL-VP128, CRISPR-Act2.0 and CRISPR-Act3.0 have shown strong gene transcription activation levels in plants. However, no gene activation system suitable for maize egg cells or plants has been developed so far. Therefore, the establishment of a maize gene activation system will provide a powerful technical means for studying the ectopic expression of ZmBBM2 gene in maize egg cells and exploring the relationship between the BBM gene dosage effect and the frequency of parthenogenetic haploid induction.

invention disclosure

The purpose of the present invention is to provide a maternal cell-autonomous parthenogenetic haploid reproduction method and its breeding application.

In a first aspect, the present invention claims a method for obtaining maize parthenogenetic haploid.

The method for obtaining maize parthenogenetic haploids claimed by the present invention may include the following steps: introducing the system vector of the CRISPRa5 gene activation system used to mediate the ectopic expression of the ZmBBM2 gene in maize egg cells into the recipient maize to obtain positive transgenic maize. ; The egg cells in some embryo sacs of the transgenic positive corn can directly develop into haploid embryos and form haploid seeds.

The system vector can express dCas9-VP64 fusion protein, can express MS2-P65-HSF1 fusion protein, and can express one or several sgRNA targeting the -200 to -1 bp position upstream of the ZmBBM2 gene transcription start point, and the sgRNA is sgRNA2.0.

Furthermore, the system vector contains the following 2 expression cassettes:

Expression cassette 1: used to express two sgRNAs; in the expression cassette 1, it contains the coding sequences of two sgRNAs, and the coding sequences of the two sgRNAs are connected with the Arabidopsis thaliana At-tRNAGly coding sequence and are composed of the same A promoter initiates transcription;

Expression cassette 2: used to express functional proteins, which are formed by fusing the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein through the self-cleaving polypeptide T2A; in the expression cassette 2, The functional protein is transcribed by a plant egg cell-specific promoter.

In a specific embodiment of the present invention, two sgRNAs respectively target the -36 and -166 bp regions upstream of the TSS of the ZmBBM2 gene.

In some cases of the present invention, in the expression cassette 1, the promoter is the ZmU6-2 promoter.

In some cases of the present invention, in the expression cassette 2, the plant egg cell-specific promoter is the Arabidopsis thaliana DD45 promoter.

In some cases of the present invention, both the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein contain nuclear localization signals.

In a specific embodiment of the invention, the expression cassette 1 consists of the ZmU6-2 promoter and the sgRNA spacer sequence targeting the -36 bp region upstream of the ZmBBM2 gene transcription start point (TSS) from the 5' end to the 3' end. The coding nucleic acid, the sgRNA2.0 scaffold coding sequence, the Arabidopsis thaliana At-tRNAGly coding sequence, the coding nucleic acid of the sgRNA spacer sequence targeting the -166bp region upstream of the ZmBBM2 gene transcription start site (TSS), the sgRNA2.0 scaffold Composed of coding sequences.

In a specific embodiment of the present invention, the expression cassette 2 consists of the Arabidopsis DD45 promoter, 3×Flag tag encoding nucleic acid, SV40 nuclear localization signal encoding sequence, and dCas9 encoding gene in sequence from the 5' end to the 3' end. , NLS nuclear localization signal coding sequence, VP64 coding gene, the coding gene of the self-cleaving polypeptide T2A, the MS2 coding gene, the SV40 nuclear localization signal coding sequence, the P65 coding gene, the HSF1 coding gene and the transcription terminator NOS.

In the expression cassette 1, the ZmU6-2 promoter is as shown in positions 1-397 of SEQ ID No. 16; the sgRNA spacer sequence targeting the -36bp region upstream of the ZmBBM2 gene transcription start point (TSS) The coding nucleic acid is shown in positions 398-417 of SEQ ID No. 16; the sgRNA2.0 scaffold coding sequence is shown in positions 418-553 or 651-793 of SEQ ID No. 16; the proposed The Arabidopsis At-tRNAGly coding sequence is shown in positions 554-630 of SEQ ID No. 16; the coding nucleic acid of the sgRNA spacer sequence targeting the -166 bp region upstream of the ZmBBM2 gene transcription start point (TSS) is shown in SEQ ID No. Positions 631-650 of 16 are shown.

In the expression cassette 2, the Arabidopsis DD45 promoter is as shown in positions 1008-2017 of SEQ ID No. 16; the 3×Flag tag encoding nucleic acid is as shown in positions 2018-2086 of SEQ ID No. 16 As shown; the SV40 nuclear localization signal coding sequence is as shown in positions 2093-2113 or 6992-7012 of SEQ ID No. 16; the dCas9 encoding gene is as shown in positions 2114-6238 of SEQ ID No. 16 shown; the NLS nuclear localization signal coding sequence is shown in positions 6239-6286 of SEQ ID No. 16; the VP64 encoding gene is shown in positions 6305-6454 of SEQ ID No. 16; the self-cleaving polypeptide The coding gene of T2A is shown in positions 6482-6535 of SEQ ID No. 16; the MS2 coding gene is shown in positions 6551-6937 of SEQ ID No. 16; the P65 coding gene is shown in SEQ ID No. 16 The HSF1 coding gene is shown in positions 7595-7966 of SEQ ID No. 16; the transcription terminator NOS is shown in positions 7967-8238 of SEQ ID No. 16.

The nucleotide sequence of the expression cassette 1 is shown in positions 1-1007 of SEQ ID No. 16.

The nucleotide sequence of the expression cassette 2 is shown in positions 1008-8238 of SEQ ID No. 16.

The system vector of the CRISPRa5 gene activation system is a plasmid containing the DNA fragment shown in SEQ ID No. 16. In the specific embodiment of the present invention, specifically, the DNA fragment shown in SEQ ID No. 16 is replaced with the CPB vector (saved by this laboratory, article Li C, Liu C, Qi X, et al. RNA-guided Cas9 as an in The recombinant vector obtained by digesting the small fragment between the HindIII and EcoRI enzyme sites of vivo desired-target mutator in maize[J].Plant biotechnology journal, 2017,15(12):1566-1576.).

The method may also include the following steps: using the maize haploid auxiliary screening line as a pollen donor to pollinate the positive transgenic maize, thereby screening out maize parthenogenetic haploids.

In a specific embodiment of the present invention, the recipient corn is the corn inbred line KN5585. The corn haploid-assisted screening system is DFP haploid-assisted screening of corn transgenic lines (recorded in the document "Dong L, Li L, Liu C, et al. Genome editing and double-fluorescence proteins enable robust maternal haploid induction and identification in maize[J].Molecular plant, 2018,11(9):1214-1217."As shown in Supplemental Figure 1, the eGFP gene was found to be expressed in embryos(green)and DsRED was expressed in endosperms(red).The DFP cassette was then stably transformed into the maize variety ZC01, the same inbred line as the created haploid inducer line (Figure 1C)", that is, the DFP cassette shown in Figure 1C was stably transformed into corn in this document The transgenic strain obtained after the selection of variety ZC01 can be obtained by the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes). This transgenic line contains two fluorescent reporter expression cassettes, one of which marks the aleurone layer and uses the aleurone layer-specific promoter LTP2 to activate the DsRed2 gene. This expression cassette can mark the aleurone layer of corn kernels with red fluorescence. The other expression cassette marks embryos and uses an embryo-specific promoter to drive the eGFP gene. Therefore, DFP haploid-assisted screening of corn transgenic lines is used as a pollen donor to pollinate the recipient corn. When the material is not induced to become haploid, the two sperm cells provided by the DFP line can achieve double fertilization and obtain embryonic hair. A kernel that glows green and the aleurone layer of the endosperm glows red. When the egg cell develops into a haploid, one of the two sperm cells provided by DFP combines with the central cell to form an aleurone layer of the endosperm that glows red, but the embryo does not receive DFP. Sperm therefore do not fluoresce.

In a second aspect, the present invention claims to protect the system vector of the CRISPRa5 gene activation system for mediating the ectopic expression of ZmBBM2 gene in maize egg cells as described in the first aspect.

In a third aspect, the present invention claims the use of the system vector described in the second aspect in inducing parthenogenetic haploidy in maize.

In a fourth aspect, the present invention claims a CRISPR-based gene activation system.

The system vector of the CRISPR-based gene activation system claimed by the present invention can express dCas9-VP64 fusion protein, can express MS2-P65-HSF1 fusion protein, and can express one or several sgRNA targeting the target region of the target gene, so The sgRNA is sgRNA2.0.

Furthermore, the system vector contains the following 2 expression cassettes:

Expression cassette 1': used to express the sgRNA;

Expression cassette 2': used to express functional proteins, which are formed by fusing the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein through the self-cleaving polypeptide T2A.

Furthermore, in the expression cassette 1', the promoter used to initiate the transcription of the sgRNA is the U6 promoter. In the expression cassette 2', the promoter used to initiate the transcription of the functional protein is the UBI promoter. Both the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein contain nuclear localization signals.

In a specific embodiment of the present invention, the expression cassette 1' consists of the U6 promoter, the coding nucleic acid of the sgRNA spacer sequence targeting the target gene target region, and sgRNA2.0 in sequence from the 5' end to the 3' end. Scaffold coding sequence composition.

In a specific embodiment of the invention, the 2' expression cassette consists of the UBI promoter, the NLS nuclear localization signal coding sequence, the dCas9 coding gene, the VP64 coding gene, and the self-cleavage sequence from the 5' end to the 3' end. It consists of the coding gene for polypeptide T2A, the MS2 coding gene, the NLS nuclear localization signal coding sequence, the P65 coding gene, the HSF1 coding gene and the NOS transcription terminator.

In the expression cassette 1', the nucleotide sequence of the U6 promoter is as shown in positions 1-397 of SEQ ID No.7-15; the sgRNA2.0 scaffold coding sequence is as SEQ ID No.8 -15 is shown in bits 418-560.

In the expression cassette 2', the nucleotide sequence of the UBI promoter is as shown in positions 18-2013 of SEQ ID No. 5; the NLS nuclear localization signal coding sequence is as shown in position 18 of SEQ ID No. 5. The dCas9 encoding gene is shown in positions 2107-2127 or 7006-7026; the dCas9 encoding gene is shown in positions 2152-6252 of SEQ ID No. 5; the VP64 encoding gene is shown in positions 6319-6495 of SEQ ID No. 5 As shown; the coding gene of the self-cleaving polypeptide T2A is shown in positions 6496-6549 of SEQ ID No. 5; the MS2 coding gene is shown in positions 6565-6951 of SEQ ID No. 5; the P65 The coding gene is as shown in positions 7042-7584 of SEQ ID No.5; the HSF1 encoding gene is as shown in positions 7609-7983 of SEQ ID No.5; the NOS transcription terminator is as shown in SEQ ID No.5 Shown at bits 8018-8270. The sequence of 2' of the expression cassette is shown in SEQ ID No. 5.

In the fifth aspect, the present invention claims the application of the CRISPR-based gene activation system described in the fourth aspect in gene activation of target genes.

Description of the drawings

Figure 1 shows the evaluation of the transcriptional activation ability of CRISPRa(1-6) tools in corn mesophyll protoplasts. a: CRISPRa vector. dCas9, Streptococcus pyogenes Cas9 lacks endonuclease activity (mutations D10A, H840A); ERF2m, Arabidopsis ethylene response modified transcriptional activator 2 (ERF2); HSF1, human heat shock factor 1; MS2, phage coat protein; NLS , nuclear localization signal; P65, NF-kB transactivating subunit P65; pU6, ZmU6-2 promoter; pUBI, maize ubiquitin promoter; sgRNA1.0, Cas9 conventional sgRNA; sgRNA2.0, contains two MS2 stems Circular sgRNA backbone; T, terminator; T2A, self-cleaving polypeptide; VP64, 4 copies of the transcriptional activator VP16. b: Schematic diagram of the three components of the a4-a6 system. cd: RT-qPCR detection of ZmDPS1 expression. c: Schematic diagram of ZmDPS1 site. The first transcription start site (TSS) is named +1. d: CRISPRa(1-6) mediates the activated expression of ZmDPS1. The maize ubiquitin gene (NCBIGenBank: U29159.1) was used as a reference. Relative expression levels were calculated using the 2 ^-ΔΔCt method. e: Using the ZmDPS1 gene as the sgRNA target to evaluate the window activity of the CRISPRa5 tool. fh: Validation of the CRISPRa5 system using ZmTrxh(f), ZmES2(g) and ZmRCP1(h) genes as targets. All values are ±s.e.m. from n=3 biological replicates.

Figure 2 shows the isolation of maize female gametocytes and validation of the CRISPRa5 system in egg cell (EC) protoplasts. a–h: Single-cell level micromanipulation and isolation of maize female gametocytes. a: Schematic diagram of corn ovary structure. AC antipodal cells, CC central cells, EC egg cells, SC synergid cells. b: Isolated maize ovary and embryo sac ES (red arrow). c: The embryo sac is separated by manual micromanipulation under a stereomicroscope. d: Single cells obtained from ES by partial enzymatic dissociation. e-h: separated AC(e), SC(f), CC(g) and EC(h). i and j: Egg cell-specific CRISPRa5 egg cell targeting activates the LTP2pro-DsRed2 expression cassette of the stably transformed DFP line. i: Schematic diagram of CRISPRa5 vector targeting LTP2pro. j: RsRed2 fluorescence shows that in an isolated EC, DsRed2 protein is ectopically expressed in egg cells. BAR=50μm.

Figure 3 shows the targeted activation of the maize endogenous ZmBBM2 gene based on egg cell-specific CRISPRa5 ^BBM . a: Schematic diagram of CRISPRa5 ^BBM vector. 3×FLAG, 3 tandem FLAG epitope tags; Bar, BlpR gene. Other components are shown in the CRISPRa5 vector shown in Figure 1, a. b: Identification of transformed copy number based on ddPCR technology. The nine independent transformants of the T3 generation were EA13, EA14, EA15, EA19, EA21, EA22, EA28, EA34 and EA36. The a5 ^BBM probe was labeled with FAM, while the ZmADH1 internal reference probe was labeled with HEX. The upper left panel shows the 1D reference data of target genes and internal reference genes; the upper right panel shows the calculated a5 ^BBM copy number; the lower panel shows the 2D reference data of a typical EA19 line. cf: Quantitative analysis of gene expression levels in unpollinated female gametophytes. c: RT-ddPCR identifies a5 ^BBM expression level in embryo sac. d: RT-ddPCR identification of ZmBBM2 gene expression levels in embryo sac shown in c. Quantitative results were converted into target gene expression copy number per 1 μg of total RNA. e: Single-cell RT-ddPCR technology identifies the expression levels of ECs, ANs, SCs and CCs isolated from EA19 and ZC01. f: Use anti-FLAG antibody and BBM2 mRNA probe to determine the dCas9 protein expression site and ZmBBM2 gene expression pattern, and use Feulgen staining to observe the development of the embryo sac. g and h: Transcription levels of EA19 and ZC01 embryo sacs or ZmBBM2 and a5 ^BBM genes in young embryos before and after 0-9DAP pollination.

Figure 4 shows the apomictic phenotype caused by egg cell-specific CRISPRa5 ectopic activation of endogenous ZmBBM2 gene expression in maize. a: The incidence of double embryonic sacs in EA19 ovaries is 3.9%. Bar=50μm. be: CRISPRa5 ^BBM maternal haploid. b: Fluorescence photos of haploid and diploid grain sections. c: Plant type and ear phenotype of diploid and haploid plants in ZC01 and EA19. d: DNA content of generated haploid plants (right) and control diploid plants (left) verified by flow cytometry. e: Haploid generation efficiency of 9 CRISPRa5 ^BBM lines.

Best way to implement your invention

The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples were all purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative experiments in the following examples were repeated three times, and the results were averaged.

Example 1. Maternal cell-autonomous parthenogenetic haploid reproduction method and its breeding application

1. Experimental materials and methods

(1) Experimental materials

B73 corn inbred line (provided by Weimi Biotechnology (Jiangsu) Co., Ltd.), KN5585 corn inbred line (provided by Weimi Biotechnology (Jiangsu) Co., Ltd.), pUC19 vector (Beijing Quanshijin Biotechnology Co., Ltd.), CPB Vector (preserved in this laboratory, recorded in the document "Li C, Liu C, Qi :1566-1576.", which can be obtained by the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes), DFP haploid-assisted screening of corn transgenic lines (preserved by this laboratory and recorded in the literature " Dong L, Li L, Liu C, et al.Genome editing and double-fluorescence proteins enable robust maternal haploid induction and identification in maize[J].Molecular plant, 2018,11(9):1214-1217." As shown in Supplemental Figure 1, the eGFP gene was found to be expressed in embryos(green)and DsRED was expressed in endosperms(red).The DFP cassette was then stably transformed into the maize variety ZC01, the same inbred line as the created haploid inducer line (Figure 1C)", that is, the transgenic line obtained by stably transforming the DFP cassette shown in Figure 1C into the corn variety ZC01 in this document. The public can obtain it from the applicant and can only be used to repeat the experiment of the present invention. used, no other use), Agrobacterium competent (EHA105) cells (Beijing Zhuangmeng International Biogene Technology Co., Ltd.).

(2) Experimental methods

1. Construction of CRISPRa vector

For the CRISPRa(a1-a6) construct, the sequences of the ZmUbi promoter, nuclear localization signal (NLS), dCas9 (D10A, H830A), transcriptional activation domain, and NOS terminator were amplified and cloned into the pUC19 vector backbone.

The egg cell-specific expression CRISPRa5 vector was designed to replace the ZmUbi promoter with the Arabidopsis egg cell-specific promoter DD45, and the vector was constructed in the pUC19 vector skeleton. The maize ZmU6-2 promoter is used for the expression of all sgRNAs.

For target design, the present invention selects the ZmDPS1 gene as the main target gene for evaluating the CRISPRa (a1-a6) tool. The selected target points are the target points within -1 to -100bp upstream of TSS. At the same time, -100 to -200bp, Design corresponding targets in the -200 to -300bp and 5'UTR regions to determine the optimal activation window of the CRISPRa5 tool. In order to further verify that the CRISPRa5 tool has high and stable gene activation ability in maize, the present invention also selected -1 to -100bp of the ZmTrxh, ZmES2 and ZmRCP1 genes to design target sites and construct a CRISPRa5 activation vector. Relevant gene targets and detailed information are shown in Table 1.

Table 1. CRISPRa gene activation system and its target gene sequence and other information

2. In vitro evaluation of CRISPRa(a1-a6) in corn mesophyll protoplasts

Approximately 5 × ¹⁰ protoplasts were collected for RNA analysis. Total RNA was extracted using the FastPure Plant Total RNA Isolation Kit, and total RNA was quantified spectrophotometrically using an IMPLENP330 UV spectrophotometer according to the manufacturer's instructions (Norwegian Biotechnology, China) and samples with A260/A280 <1.8 were discarded. . In order to check the integrity of the RNA, take 500ng of total RNA and evaluate the RNA quality using 1% (w/v) agarose gel. The RNA bands are three clear, complete and undegraded samples for subsequent experiments. RNA samples were cleaned of residual genomic DNA contamination in the RNA using a gDNA wiper mix kit (Novizan Biotechnology, China). 1 μg of total RNA was synthesized using HiScript III 1st Strand cDNA Synthesis Kit and oligo (dT) primers according to the manufacturer's instructions (Novozan Biotechnology, China). The experiment was performed on the BIO-RAD CFX96 real-time fluorescence quantification system (BIO-RAD, USA). Use 10 μL Taq Pro Universal SYBR qPCR Master Mix (Norwegian Biotechnology, China), 0.5 μL of each primer (final concentration 200 nM), 2 μL of cDNA, and a final volume of 20 μL. All samples were set up in triplicate biological replicates. The maize ubiquitin gene (NCBIGenBank: U29159.1) was used as the internal reference. An automatic threshold was used for determination of cycle quantitation (Cq). Expression levels were calculated using the 2 ^-ΔΔCt method. The primers used in the experiment and the PCR amplification efficiency are listed in Table 2.

Table 2. Details of primers used in Real-time RT-PCR

3. Establishment of corn egg cell isolation technology

The DFP haploid-assisted screening of corn transgenic lines created in the laboratory was used as experimental material. Before the material is spun, the ears are bagged. When the filament is 5-15cm long, the ears are removed. The surface of the ear shell is sterilized with 70% (v/v) ethanol, and the corn ovary structure is removed through micromanipulation. Use a scalpel to make incisions along both sides of the filaments of the ovule to remove the ovary wall structures on both sides of the ovary. Take 20 processed ovary slices containing embryo sac structures and collect them in a 3.5cm diameter sterile cell culture dish. Add 1.5mL enzymatic solution (1.5mL enzymatic solution contains 150mg mannitol, 19.65U Pectinase, 22U hemicellulase, 120U cellulase RS, use KOH to adjust pH to 5.0. Among them, 1U is defined as: under optimal conditions, it is required to catalyze the conversion of 1 micromole of substrate into product per minute. The amount of enzyme is determined as one unit of activity). The mixture was shaken on a shaking shaker at a speed of 140 rpm, incubated at 24°C for 60 min, and then manually separated embryonic sacs (ESs), synergid cells (SCs), antipodal cells (ANs), and central cells using a glass needle under a stereomicroscope. (CCs) and egg cells (ECs). Transfer the isolated EC protoplasts to 100 μL electroporation buffer (recipe: 0.5M mannitol, 4mM potassium chloride, 4mM MES, pH 5.0), and add 10 μg of CRISPRa5 ^{pLTP2::DsRed2} vector plasmid DNA (structural description: The recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site at the same time. The expression cassette 1 is an expression cassette for expressing sgRNA, and the full sequence is as follows As shown in SEQ ID No. 15. The complete sequence of the expression cassette 2 is as shown in SEQ ID No. 5). Using Bio-Rad gene pulser, the electroporation conditions were 5ms, 400V and 200μF respectively. Electroporated samples were kept on ice for 10 min, transferred to a 6-well plate, and incubated in the dark at 28°C for 24 h. The DsRed2 fluorescence signal was detected using the DM1000LED system (LEICA, Germany), with an excitation wavelength of 554 nm and an amplification of 10 × 10 times.

4. CRISPRa5 ^BBM vector construction

In order to obtain the egg cell-specific CRISPRa5 ^BBM vector, we extracted the Arabidopsis genome and cloned the Arabidopsis DD45 promoter. We amplified and assembled the DD45 promoter and CRISPRa5 elements into the CPB vector through seamless cloning biotechnology. Two target sgRNA2.0s targeting the ZmBBM2 gene promoter were designed: pBBM2TG1sgRNA2.0 and pBBM2TG2sgRNA2.0. The designed targets were located in the -36 and -166bp regions of the TSS upstream region of the ZmBBM2 gene. The two sgRNA2.0 targets were transcribed using the same ZmU6-2 promoter and linked to the pBBM2TG1sgRNA2 and pBBMTG2sgRNA sequences with Arabidopsis At-tRNAGly. All primers used in the present invention are listed in Table 3.

Table 3. Primer and probe sequences for CRISPRa5 ^BBM vector construction and expression analysis

5. Agrobacterium-mediated stable transformation of corn

Transform the CRISPRa5 ^BBM plasmid into Agrobacterium competent cells (EHA105), take positive single clones and culture them. When the OD value 600 of the medium is 0.3, in the KN5585 corn inbred line (provided by Weimi Biotechnology (Jiangsu) Co., Ltd.) Agrobacterium-mediated transformation of immature embryos was performed.

6. Determination of copy number of transgenic elements in CRISPRa5 ^BBM lines

Genomic DNA was isolated and purified from transgenic lines using the FastPure Plant DNA Isolation Mini Kit (Novozan Biotechnology, China). ZC01, EA13, EA14, EA15, EA19, EA21, EA22, EA28, EA34 and EA36 CRISPRa5 ^BBM genomic DNA were obtained respectively. The multiplex quantitative droplet digital PCR (ddPCR) method was used to determine transgene copy number. Primer3 Plus (http://primer3plus.com/; Rozen and Skaletsky, 2000) was used to design candidate primers and probes for the CRISPRa5 ^BBM element and endogenous reference gene. The single-copy gene ZmADH1 was used as an internal quantitative control of diploid genes. Transgene copy number was measured using Bio-Rad QuantaSoft ^TM software (v1.6.6.0320), with the default setting being a threshold determination to distinguish positive and negative droplets. All primers and probes used in this study are listed in Table 3.

7. Expression identification of CRISPRa5 ^BBM and ZmBBM2 in embryo sac

Wall-free ovaries were obtained by stripping the ovary walls under RNase-free conditions, and 3 biological replicates of 20 ovaries per group were collected. The isolation, quality control, and cDNA synthesis of total ovary RNA were performed according to the previously mentioned protocol. Identification of gene expression levels in ovary tissue was measured using RT-ddPCR technology, and candidate primers and probes for amplifying dCas9, ZmBBM2 and ZmeIF4α genes were designed using Primer3Plus. All primers and probes are listed in Table 3. Each ddPCR sample contained 11 μL of 2×ddPCR Supermix for Probes (No dUTP) (Bio-Rad, USA), with a primer concentration of 900 nM and a probe concentration of 227 nM. At the same time, 2 μL cDNA was added; the final volume was adjusted to 22 μL with sterile ddH ₂ O. Droplet counts were analyzed and absolute gene expression measurements were performed using Bio-Rad QuantaSoft ^™ software (v1.6.6.0320), with default settings for threshold determination to differentiate between positive and negative droplets.

8. Expression of CRISPRa5 ^BBM and ZmBBM2 at the single cell level

The synergid cells, antipodal cells, central cells, and egg cells were isolated under a microscope. Take 10 cells of the same type for lysis, and take 1/10 of the original solution in the cell pool as RNA template. Single-cell reverse transcription droplet digital PCR technology was used to measure gene expression levels in cells, and the kit used One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad, USA). Primer3Plus was used to design candidate gene primers and amplification probes for dCas9 and ZmBBM2 genes. Each ddPCR sample contains 5 μL Supermix, 2 μL reverse transcriptase, 1 μL DDT, primer concentration 900 nM, probe concentration 250 nM, add 1 μL RNA lysis buffer; adjust the final volume to 20 μL with sterile ddH ₂ O. Reactions were run on a QX200AutoDG ddPCR system. Analyze droplet counts and perform absolute gene expression measurements using Bio-Rad QuantaSoft ^™ software (v1.6.6.0320), with default settings for threshold determination to distinguish positive and negative droplets.

9. Feulgen staining method

The ovary tissue was isolated and obtained, fixed with FAA solution (recipe: 10% formaldehyde, 5% acetic acid, 50% ethanol), and preserved in 70% (v/v) ethanol. Before sample preparation, it is necessary to rehydrate with different gradient concentrations of ethanol, then treat the DNA with 6M hydrochloric acid for hydrolysis, treat with 0.5% (w/v) periodic acid solution for 20 minutes, and incubate in 1% (w/v) acriflavine for 20 minutes. The samples were then dehydrated using an ethanol series, and the tissues were cleared with methyl salicylate-ethanol and pure methyl salicylate solutions. Finally, the samples were mounted on methyl salicylate slides and observed under a microscope.

10. Immunohistochemistry

Immunohistochemistry was used to locate the dCas9 protein in embryo sac sections. The collected corn kernels were fixed in FAA solution, and the samples were tissue embedded and sectioned using paraffin sectioning technique. Immunohistochemistry was performed using standard protocols. Immunohistochemistry was performed using rabbit anti-FLAG antibody ab205606 (Abcam Inc., USA) as the primary antibody and anti-goat anti-rabbit alkaline phosphatase conjugate A9919 (Sigma, USA) as the secondary antibody.

11. mRNA in situ hybridization

ZmBBM2 mRNA in situ hybridization was performed in embryo sac tissue using a digoxigenin-labeled antisense RNA probe to detect the accumulation of ZmBBM2 transcripts. ZmBBM2 cDNA was cloned into a pUC19 vector containing a T7 promoter. NcoI restriction endonuclease ends are used to linearize the template and create a 5 "overhang" structure prior to transcription. The probe was synthesized using in vitro transcription with T7 RNA polymerase kit combined with digoxigenin-11-UTP (Sigma, USA) for in vitro transcription, and the labeled ssRNA probe was synthesized. Degradation of mRNA must be avoided before and after embryo sac tissue fixation to avoid changes in the position of the mRNA.

12. Evaluation of parthenogenetic haploid seed generation efficiency

For parthenogenetic haploid screening, the double fluorescent protein DFP method is used. DFP haploid-assisted screening of maize transgenic lines is maintained in our laboratory (document "Dong L, Li L, Liu C, et al. Genome editing and double-fluorescence proteins "As shown in Supplemental Figure 1, the eGFP gene was found to be expressed in embryos(green )and DsRED was expressed in endosperms(red).The DFP cassette was then stably transformed into the maize variety ZC01.The DFP cassette was then stably transformed into the maize variety ZC01, the same inbred line as the created haploid inducer line(Figure 1C )", that is, the transgenic line obtained by stably transforming the DFP cassette shown in Figure 1C into the corn variety ZC01 in this document). This transgenic line contains two fluorescent reporter expression cassettes, one of which uses paste to mark the aleurone layer. The flour layer-specific promoter LTP2 drives the DsRed2 gene, and this expression cassette can mark the aleurone layer of corn kernels with red fluorescence. The other expression cassette marks embryos and uses an embryo-specific promoter to drive the eGFP gene. Therefore, DFP haploid-assisted screening of corn transgenic lines was used as a pollen donor to pollinate the KN5585 corn inbred line and 9 CRISPRa5 ^BBM lines. When the material is not induced to become haploid, the two sperm cells provided by the DFP line can Double fertilization is achieved to obtain a seed with a green embryo and a red endosperm aleurone layer. When the material egg cell develops into a haploid, one of the two sperm cells provided by DFP combines with the central cell to form a red endosperm aleurone layer. light, while the embryo has not received DFP sperm and therefore does not fluoresce. During the material planting process, the wild-type inbred line ZC01, 9 CRISPRa5BBM lines and DFP plants were grown in the greenhouse respectively. During flowering, DFP plants were selected as pollen donors for pollination of all other genotypes. Haploid corn kernels were identified using a LUYOR-3415RG light source (LUYOR, California, USA) after maturity. Haploid frequency was calculated using the number of haploid grains for each line.

13. Ploidy identification

Flow cytometry was used to detect the ploidy level of cells. The haploid seeds screened through DFP technology and the diploid control seeds were germinated together. When the seedlings grew to the three-leaf stage, about 1 g of young leaves were collected and cut into shreds with a razor blade, and filtered through an 80 μm nylon mesh. Centrifuge at 1000r/min for 5 minutes, and precipitate with 1mL OTTOI buffer (formula: 100mmol citric acid, 0.5% (V/V) Tween 20, pH=2.0) and 2mL OTTOII buffer (formula: 400mmol disodium hydrogen phosphate, pH=8) Stain with 50 μL 1.5 mg/L propidium iodide for 20 min in the dark. Ploidy levels were analyzed on the FACSCalibur system (BD, USA), data were extracted by CellQuest software (BD, USA), and analyzed using ModFit software (Yerity, USA).

2. Results and analysis

1. Establishment of maize CRISPRa series vectors based on CRISPR-dCas9-mediated

The present invention uses CRISPR-dCas9, which lacks endonuclease activity, as a DNA guidance tool and fuses different transcription activation response elements to construct six groups of CRISPRa vectors (a in Figure 1). Vector design is divided into two strategies: In the first strategy, the dCas9 protein is fused to transcriptional activation response elements including ethylene response FACTOR2 (ERF2m, CRISPRa1), VP64 (4×VP16, CRISPRa2) and NF-kB transgene from Arabidopsis thaliana. CRISPRa vector formula activating subunit p65 (p65, CRISPRa3). In this strategy, after dCas9 is fused with a transcriptional activation effector element, sgRNA1.0 guides dCas9 to the target DNA, and the transcriptional activation effector element recruits RNA polymerase for transcription and translation to achieve gene activation; in the second strategy , we adopted a modified sgRNA scaffold sgRNA2.0, which contains the basic skeleton of sgRNA1.0 and introduces two MS2-binding RNA aptamers at the 2nd and 4th stem-loop structures to recruit VP64 in addition to Additional transcriptional activators such as: ERF2m-HSF1 (CRISPRa4), p65-HSF1 (CRISPRa5) and VP64-HSF1 (CRISPRa6). At the same time, we fused and expressed additional transcriptional activators with the activation domain of human heat shock factor 1 (HSF1) to achieve synergistic activation of the domains. In the second strategy, dCas9-VP64 and other additional transcriptional activators are designed into a reading frame. When the protein is expressed, the fusion protein releases NLS-dCas9-VP64 through the T2A peptide, which binds to sgRNA2.0. The MS2-bound RNA aptamer recruits the NLS-MS2-affetor-HSF1 structure, thereby forming an enhanced gene activation tool (a and b in Figure 1).

The six CRISPRa vector structures finally obtained are described as follows:

CRISPRa1 vector structure description: A recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA; from the 5' end to the 3' end, the expression cassette 1 consists of the U6 promoter (positions 1-397 of SEQ ID No. 7), the target It consists of the sgRNA spacer sequence insertion site (gtaacgtcaccgtagggcct) in the gene target region and the sgRNA1.0 scaffold coding sequence (shown at positions 418-500 of SEQ ID No. 7). The expression cassette 2 consists of the UBI promoter (No. 18-2013 of SEQ ID No. 1) and the NLS nuclear localization signal coding sequence (No. 2107-2127 of SEQ ID No. 1) from the 5' end to the 3' end. , dCas9 encoding gene (No. 2152-6252 of SEQ ID No. 1), ERF2m encoding gene (No. 6319-7047 of SEQ ID No. 1) and NOS transcription terminator (No. 7082-7334 of SEQ ID No. 1) bits). The complete sequence of the expression cassette 2 is shown in SEQ ID No. 1.

CRISPRa2 vector structure description: A recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA; from the 5' end to the 3' end, the expression cassette 1 consists of the U6 promoter (positions 1-397 of SEQ ID No. 7), the target It consists of the sgRNA spacer sequence insertion site (gtaacgtcaccgtagggcct) in the gene target region and the sgRNA1.0 scaffold coding sequence (shown at positions 418-500 of SEQ ID No. 7). The expression cassette 2 consists of the UBI promoter (No. 18-2013 of SEQ ID No. 2) and the NLS nuclear localization signal coding sequence (No. 2107-2127 of SEQ ID No. 2) from the 5' end to the 3' end. , dCas9 encoding gene (No. 2152-6252 of SEQ ID No. 2), VP64 encoding gene (No. 6319-6468 of SEQ ID No. 2) and NOS transcription terminator (No. 6503-6755 of SEQ ID No. 2) bits). The complete sequence of the expression cassette 2 is shown in SEQ ID No. 2.

CRISPRa3 vector structure description: A recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA; from the 5' end to the 3' end, the expression cassette 1 consists of the U6 promoter (positions 1-397 of SEQ ID No. 7), the target It consists of the sgRNA spacer sequence insertion site (gtaacgtcaccgtagggcct) in the gene target region and the sgRNA1.0 scaffold coding sequence (shown at positions 418-500 of SEQ ID No. 7). The expression cassette 2 consists of the UBI promoter (No. 18-2013 of SEQ ID No. 3) and the NLS nuclear localization signal coding sequence (No. 2107-2127 of SEQ ID No. 3) from the 5' end to the 3' end. , dCas9 encoding gene (No. 2152-6252 of SEQ ID No. 3), P65 encoding gene (No. 6319-6861 of SEQ ID No. 3) and NOS transcription terminator (No. 6896-7148 of SEQ ID No. 3) bits). The complete sequence of the expression cassette 2 is shown in SEQ ID No. 3.

CRISPRa4 vector structure description: A recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA; from the 5' end to the 3' end, the expression cassette 1 consists of the U6 promoter (positions 1-397 of SEQ ID No. 8), the target It consists of the sgRNA spacer sequence insertion site (gtaacgtcaccgtagggcct) in the gene target region and the sgRNA2.0 scaffold coding sequence (shown at positions 418-560 of SEQ ID No. 8). The expression cassette 2 consists of the UBI promoter (positions 18-2013 of SEQ ID No. 4) and the NLS nuclear localization signal coding sequence (positions 2107-2127 of SEQ ID No. 4) from the 5' end to the 3' end. ), dCas9 coding gene (No. 2152-6252 of SEQ ID No. 4), VP64 coding gene (No. 6319-6495 of SEQ ID No. 4), self-cleaving polypeptide T2A coding gene (SEQ ID No. 4) No. 6496-6549), MS2 coding gene (No. 6565-6951 of SEQ ID No. 4), NLS nuclear localization signal coding sequence (No. 7006-7026 of SEQ ID No. 4), ERF2m coding gene (SEQ ID No. 4) No. 4 No. 7042-7770), HSF1 coding gene (SEQ ID No. 4 No. 7795-8169) and NOS transcription terminator (SEQ ID No. 4 No. 8204-8456). The complete sequence of the expression cassette 2 is shown in SEQ ID No. 4.

CRISPRa5 vector structure description: A recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA; from the 5' end to the 3' end, the expression cassette 1 consists of the U6 promoter (positions 1-397 of SEQ ID No. 8), the target It consists of the sgRNA spacer sequence insertion site (gtaacgtcaccgtagggcct) in the gene target region and the sgRNA2.0 scaffold coding sequence (shown at positions 418-560 of SEQ ID No. 8). The expression cassette 2 consists of the UBI promoter (positions 18-2013 of SEQ ID No. 5) and the NLS nuclear localization signal coding sequence (positions 2107-2127 of SEQ ID No. 5) from the 5' end to the 3' end. ), dCas9 coding gene (No. 2152-6252 of SEQ ID No. 5), VP64 coding gene (No. 6319-6495 of SEQ ID No. 5), self-cleaving polypeptide T2A coding gene (SEQ ID No. 5 No. 6496-6549), MS2 coding gene (No. 6565-6951 of SEQ ID No. 5), NLS nuclear localization signal coding sequence (No. 7006-7026 of SEQ ID No. 5), P65 coding gene (SEQ ID No. 5) No. 5 No. 7042-7584), HSF1 coding gene (SEQ ID No. 5 No. 7609-7983), NOS transcription terminator (SEQ ID No. 5 No. 8018-8270). The sequence of 2' of the expression cassette is shown in SEQ ID No. 5.

CRISPRa6 vector structure description: A recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA; from the 5' end to the 3' end, the expression cassette 1 consists of the U6 promoter (positions 1-397 of SEQ ID No. 8), the target It consists of the sgRNA spacer sequence insertion site (gtaacgtcaccgtagggcct) in the gene target region and the sgRNA2.0 scaffold coding sequence (shown at positions 418-560 of SEQ ID No. 8). The expression cassette 2 consists of the UBI promoter (positions 18-2013 of SEQ ID No. 6) and the NLS nuclear localization signal coding sequence (positions 2107-2127 of SEQ ID No. 6) from the 5' end to the 3' end. ), dCas9 coding gene (No. 2152-6252 of SEQ ID No. 6), VP64 coding gene (No. 6319-6495 of SEQ ID No. 6), self-cleaving polypeptide T2A coding gene (SEQ ID No. 6) No. 6496-6549), MS2 coding gene (No. 6565-6951 of SEQ ID No. 6), NLS nuclear localization signal coding sequence (No. 7006-7026 of SEQ ID No. 6), VP64 coding gene (SEQ ID No. 6) No. 6 No. 7042-7218), HSF1 coding gene (SEQ ID No. 6 No. 7243-7617), NOS transcription terminator (SEQ ID No. 6 No. 7652-7904). The sequence of 2' of the expression cassette is shown in SEQ ID No. 6.

In order to evaluate the gene activation activity of the CRISPRa(1-6) 6 gene activation system in maize cells, we selected the endogenous seed lysine biosynthesis-related gene ZmDPS1 in maize as the target of the CRISPRa system. Gene activation targets were designed for the 100 bp region upstream of the ZmDPS1 transcription start site (TSS) (b and c in Figure 1; Table 1), and gene activation vectors were constructed respectively. The resulting 6 vector structures are described as follows:

Structural description of the CRISPRa1 ^DPS1 vector targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 7. Positions 1-397 of SEQ ID No. 7 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-500 are the sgRNA1.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 1. No. 18-2013 of SEQ ID No. 1 is the UBI promoter, No. 2107-2127 is the NLS nuclear localization signal coding sequence, No. 2152-6252 is the dCas9 coding gene, No. 6319-7047 is the ERF2m coding gene, No. 7082 Position -7334 is the NOS transcription terminator.

Structural description of the CRISPRa2 ^DPS1 vector targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 7. Positions 1-397 of SEQ ID No. 7 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-500 are the sgRNA1.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 2. No. 18-2013 of SEQ ID No. 2 is the UBI promoter, No. 2107-2127 is the NLS nuclear localization signal coding sequence, No. 2152-6252 is the dCas9 coding gene, No. 6319-6468 is the VP64 coding gene, No. 6503 Position -6755 is the NOS transcription terminator.

Structural description of the CRISPRa3 ^DPS1 vector targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 7. Positions 1-397 of SEQ ID No. 7 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-500 are the sgRNA1.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 3. No. 18-2013 of SEQ ID No. 3 is the UBI promoter, No. 2107-2127 is the NLS nuclear localization signal coding sequence, No. 2152-6252 is the dCas9 coding gene, No. 6319-6861 is the P65 coding gene, No. 6896 Position -7148 is the NOS transcription terminator.

Structural description of the CRISPRa4 ^DPS1 vector targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 8. Positions 1-397 of SEQ ID No. 8 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 4. Positions 18-2013 of SEQ ID No. 4 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7770 are the genes encoding ERF2m, and positions 7795-8169 Positions 8204-8456 are the NOS transcription terminator.

Structural description of the CRISPRa5 ^DPS1 vector targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 8. Positions 1-397 of SEQ ID No. 8 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Structural description of the CRISPRa6 ^DPS1 vector targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 8. Positions 1-397 of SEQ ID No. 8 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 6. Positions 18-2013 of SEQ ID No. 6 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7218 are the genes encoding VP64, and positions 7243-7617 Positions are the HSF1 encoding gene, and positions 7652-7904 are the NOS transcription terminator.

The above-mentioned CRISPRa(1-6) ^DPS1 was transferred into the mesophyll protoplasts of the B73 corn inbred line to activate the ZmDPS1 gene respectively, and high-activity CRISPRa gene activation tools were screened. From the RT-qPCR experimental data, it can be seen that compared with the protoplast control group that was not transformed into the vector, the transcription levels of all CRISPRa systems increased the ZmDPS1 expression level by at least 1.6 times, and the CRISPRa5 system produced the most powerful transcription activation (relative to 11.25 times compared with the control group), which shows that the designed CRISPRa gene activation tool can achieve highly active transcription activation in corn mesophyll protoplast cells (d in Figure 1). The next step is to evaluate the activation window of the CRISPRa5 transcriptional activation tool. Therefore, we selected four regions of the 5'UTR of the ZmDPS1 gene, -1 to -100bp, -100 to -200bp, and -200 to -300bp upstream of the TSS to design sgRNA targets and a CRIPRa5 gene activation vector. The resulting four vector structures are described as follows:

Structural description of the CRISPRa5 ^DPS1 vector targeting the 5'UTR of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 11. Positions 1-397 of SEQ ID No. 11 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting the 5'UTR of the ZmDPS1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Structural description of the CRISPRa5 ^DPS1 vector targeting -100 to -200 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 9. Positions 1-397 of SEQ ID No. 9 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -100 to -200 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Structural description of the CRISPRa5 ^DPS1 vector targeting -200 to -300 bp upstream of the TSS of the ZmDPS1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 10. Positions 1-397 of SEQ ID No. 10 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -200 to -300 bp upstream of the TSS of the ZmDPS1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

The expression level of ZmDPS1 was measured by transforming B73 corn inbred line mesophyll protoplasts and RT-qPCR. Through experiments, we found that the sgRNA target targeting the -1 to -100bp region showed the highest fold activation of ZmDPS1 expression level (e in Figure 1). In order to further verify the gene activation ability of the CRISPRa5 system, we designed sgRNA targets for the -1 to -100bp region upstream of the TSS of the three genes ZmTrxh, ZmES2, and ZmRCP1, and constructed CRISPRa5 vectors respectively. The resulting three vector structures are described as follows:

Structural description of the CRISPRa5 ^Trxh vector targeting -1 to -100 bp upstream of the TSS of the ZmTrxh gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 12. Positions 1-397 of SEQ ID No. 12 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmTrxh gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Description of the structure of the CRISPRa5 ^ES2 vector targeting -1 to -100 bp upstream of the TSS of the ZmES2 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 13. Positions 1-397 of SEQ ID No. 13 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmES2 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Structural description of the CRISPRa5 ^RCP1 vector targeting -1 to -100 bp upstream of the TSS of the ZmRCP1 gene: a recombinant vector obtained by inserting expression cassette 1 at the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 at the BamHI restriction site. . The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 14. Positions 1-397 of SEQ ID No. 14 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the ZmRCP1 gene, and positions 418-560 are the sgRNA2.0 scaffold coding sequence. . The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Through evaluation of B73 corn inbred line mesophyll protoplasts and RT-qPCR technology, we observed that the CRISPRa5 gene activation tool increased the ZmTrxh gene expression by 375.38 times compared with the control group of protoplasts not transformed into the vector (f in Figure 1 ), the expression level of ZmES2 gene was increased by 5.33 times (g in Figure 1), and the expression level of ZmRCP1 gene was increased by 4.45 times (h in Figure 1). In summary, the results show that the CRISPRa5 gene activation tools we designed (sgRNA2.0, dCas9-VP64 and MS2-p65-HSF1 effector) show the strongest targeted transcription activation ability in corn cells.

2. Evaluate the activation activity of CRISPRa5 in egg cells based on egg cell isolation and transformation technology

In order to determine the gene activation ability of CRISPRa5 in egg cells, we established a corn egg cell isolation and transformation system through micromanipulation combined with embryo sac enzymatic hydrolysis. First, we used micromanipulation techniques to separate embryo sac tissue from the ovule tissue under a stereomicroscope (a and b in Figure 2). These embryo sac tissue samples were then treated with enzymatic hydrolysis for 1 hour (c in Figure 2), and the entire embryo sac was isolated through micromanipulation techniques (d in Figure 2). Next, we manually separated antipodal cells (ACs) (e in Figure 2 ), synergid cells (SCs) (f in Figure 2 ), central cells (CC) (g in Figure 2 ) and egg cells (EC) under a stereomicroscope. ) (h in Figure 2). The yield of SCs, CCs, and ECs we isolated from enzymatically digested embryo sacs was approximately 25%.

In order to verify the activation ability of CRISPRa5 in corn egg cells, we used the DFP haploid established in the laboratory to assist in screening of corn transgenic lines (kept in our laboratory, literature: Dong L, Li L, Liu C, et al. Genome editing and double-fluorescence proteins enable robust maternal haploid induction and identification in maize[J].Molecular plant, 2018,11(9):1214-1217.) To prepare egg cells and their protoplasts as materials, the DFP transgenic line contains aleurone layer The red fluorescent protein DsRed2 gene driven by the specific promoter LTP2 promoter (Dong, L., Li, L., Liu, Changlin, Liu, Chenxu, Geng, S., Li, X., et al. (2018) Genome editing and double-fluorescence proteins enable robust maternal haploid induction and identification in maize. Mol. Plant, 11, 1214–1217.). The LTP2 promoter is specifically expressed in the aleurone layer but not in egg cells. In order to verify the activity of CRISPRa5 in egg cells, we used the Arabidopsis egg cell-specific promoter DD45 promoter to express the CRISPRa5 system, and designed a gene activation target at -1 to -100bp upstream of the TSS of the LTP2 promoter and designed to target LTP2 Promoter of the oocyte-specific CRISPRa5 ^{pLTP2::DsRed2} vector. The resulting vector structure is described as follows: the recombinant vector obtained by inserting expression cassette 1 into the HindIII restriction site of the pUC19 vector and inserting expression cassette 2 into the BamHI restriction site. The expression cassette 1 is an expression cassette for expressing sgRNA, and the complete sequence is shown in SEQ ID No. 15. Positions 1-397 of SEQ ID No. 15 are the U6 promoter, positions 398-417 are the sgRNA spacer sequence targeting -1 to -100 bp upstream of the TSS of the LTP2 promoter, and positions 418-560 are the sgRNA2.0 scaffold encoding sequence. The complete sequence of the expression cassette 2 is shown in SEQ ID No. 5. Positions 18-2013 of SEQ ID No. 5 are the UBI promoter, positions 2107-2127 are the NLS nuclear localization signal coding sequence, positions 2152-6252 are the dCas9 coding gene, and positions 6319-6495 are the VP64 coding gene. Positions 6496-6549 are the genes encoding the self-cleaving polypeptide T2A, positions 6565-6951 are the genes encoding MS2, positions 7006-7026 are the NLS nuclear localization signal encoding sequences, positions 7042-7584 are the genes encoding P65, and positions 7609-7983 Positions 8018-8270 are the NOS transcription terminator.

Through egg cell transformation technology, we transferred the vector into DFP haploid-assisted screening of corn transgenic lines (kept in this laboratory, literature: Dong L, Li L, Liu C, et al. Genome editing and double-fluorescence proteins enable robust maternal haploid induction and identification in maize[J].Molecular plant, 2018,11(9):1214-1217.) in egg cells to induce the expression of LTP2pro:DsRed2 in DFP egg cells (i in Figure 2). The transformed egg cells were cultured for 24 hours and DsRed2 fluorescence was detected. Through fluorescence microscopy, we found the expression of DsRed2 fluorescent protein, indicating that the LTP2pro:DsRed2 expression cassette was transcriptionally activated leading to the expression of DsRed2 protein in the egg cells (j in Figure 2). Taken together, the above data show that the CRISPRa5 gene activation tool can achieve highly active gene activation in corn egg cells.

3. Ectopic activation of ZmBBM2 in corn egg cells through CRISPRa

Based on the phylogenetic tree analysis of 14 BBM proteins from 8 species, it can be seen that ZmBBM2 has a close evolutionary relationship with PsASGR-BBML and OsBBM1 protein sequences. We infer that the ZmBBM2 gene has similar functions to PsASGR-BBML and OsBBM1, and its egg cells are ectopic. Activity can induce parthenogenesis. Therefore, we constructed a CRISPRa5 ^BBM gene activator vector targeting the endogenous ZmBBM2 gene promoter for egg cell-specific expression (a in Figure 3). The resulting vector structure is described as follows: the recombinant vector obtained by replacing the small fragment between the enzyme cutting sites HindIII and EcoRI of the CPB vector with the DNA fragment shown in SEQ ID No. 16. Positions 1-1007 of SEQ ID No. 16 are expression cassettes for expressing sgRNA. Positions 1-397 of SEQ ID No. 16 are the ZmU6-2 promoter, positions 398-417 are the coding nucleic acids of the sgRNA spacer sequence targeting the -36 bp region upstream of the transcription start site (TSS) of the ZmBBM2 gene, and positions 418-553 Positions 554-630 are the sgRNA2.0 scaffold coding sequence, positions 554-630 are the Arabidopsis At-tRNAGly coding sequence, and positions 631-650 are the coding for the sgRNA spacer sequence targeting the -166 bp region upstream of the ZmBBM2 gene transcription start site (TSS). Nucleic acid, positions 651-793 are the sgRNA2.0 scaffold coding sequence. Positions 1008-8238 of SEQ ID No. 16 are expression cassettes for expressing functional proteins. Positions 1008-2017 of SEQ ID No. 16 are the Arabidopsis DD45 promoter, positions 2018-2086 are the 3×Flag tag encoding nucleic acid, positions 2093-2113 are the SV40 nuclear localization signal encoding sequence, and positions 2114-6238 It is the gene encoding dCas9, positions 6239-6286 are the NLS nuclear localization signal encoding sequence, positions 6305-6454 are the VP64 encoding gene, positions 6482-6535 are the encoding genes for the self-cleaving polypeptide T2A, and positions 6551-6937 are the MS2 encoding Gene, positions 6992-7012 are the SV40 nuclear localization signal coding sequence, positions 7028-7570 are the P65 encoding gene, positions 7595-7966 are the HSF1 encoding gene, and positions 7967-8238 are the NOS transcription terminator.

We transformed the KN5585 corn inbred line with the vector obtained above through Agrobacterium tumefaciens (Agrobacterium tumefaciens), and obtained 9 independent transgenic lines EA13, EA14, EA15, EA19, EA21, EA222, EA28, EA34 and EA36 , and breed it to the T3 generation. We used droplet digital PCR (ddPCR) to detect the copy number of the transgenic elements in the above materials. The results showed that EA15, EA19, EA22, EA34 and EA36 were single copies, while EA13, EA21 and EA28 were double copies and EA14 was 4 copies ( b) in Figure 3. The total RNA of the above transgenic materials was extracted from the isolated embryo sacs. We used the ZmeIF4α gene as the internal reference and used reverse transcription ddPCR (RT-ddPCR) to analyze the transcript levels of dCas9 and ZmBBM2 in the embryo sacs of CRISPRa5 ^BBM materials. We detected high transcript levels of CRISPRa5 ^BBM (c in Figure 3) and ZmBBM2 (d in Figure 3) RNA in the embryo sacs of all nine CRISPRa5 ^BBM transgenic lines, with up to ¹⁰ copies per 1 μg of total RNA, while No trace of expression was detected in the control wild-type KN5585 maize inbred line. Since EA19 showed the highest ZmBBM2 activation level among the five single-copy transgenic lines, we next selected the transgenic line EA19 for further verification. In order to further analyze the transcript levels of CRISPRa5 ^BBM and ZmBBM2 RNA in single egg cells, we used micromanipulation technology to isolate ANs, SCs, CCs and ECs from EA19 transgenic line plants. Combining single-cell RT-ddPCR technology to detect CRISPRa5 ^BBM and ZmBBM2 transcripts in EC (e in Figure 3), the data showed that CRISPRa5 ^BBM can be expressed in egg cells, and CRISPRa5 ^BBM can activate the ectopic expression of the endogenous ZmBBM2 gene in maize. . In order to further verify the above conclusion, we performed immunohistochemical analysis and in situ hybridization analysis on the embryo sac tissue of EA19 material. The experimental results showed that the expression of dCas9 protein was detected in the nucleus of EA19 egg cells. At the same time, using the ZmBBM2 mRNA probe we It was found that ZmBBM2RNA showed a strong signal in egg cells. The above results confirmed that CRISPRa5 ^BBM was expressed in unpollinated EC and successfully activated the targeted activation of ZmBBM2 gene in egg cells (f in Figure 3). At the same time, through RT-ddPCR technology, we also analyzed the expression levels of CRISPRa5 ^BBM and ZmBBM2 in the embryo sac/young embryos of EA19 materials before pollination and at different pollination times. Experimental data showed that no expression of CRISPRa5 ^BBM and ZmBBM2 was found in the unpollinated embryo sac of ZC01 wild type. With the passage of pollination time, the expression of ZmBBM2 increased rapidly but no expression of CRISPRa5 ^BBM was found. Expression of CRISPRa5 ^BBM and ZmBBM2 was found in unpollinated embryo sacs in EA19 material, and the expression of CRISPRa5 ^BBM and ZmBBM2 increased rapidly as pollination time went by (g and h in Figure 3).

4. CRISPRa5 ^BBM2- mediated ectopic activity of ZmBBM2 gene egg cells induces parthenogenetic haploidy in maize

In order to determine the possibility that CRISPRa5 ^BBM- mediated ectopic activation of the ZmBBM2 gene in egg cells can induce parthenogenesis phenotypes, we first observed the embryo sac before fertilization (a in Figure 4). The experiment found that 3.9% of EA19 seeds A double embryo sac develops in the ovule. In addition, we used DFP haploid-assisted screening of corn transgenic lines to evaluate the haploid incidence of CRISPRa5 ^BBM . We used DFP haploid-assisted screening of corn transgenic lines as pollen donors to pollinate EA19 materials. When parthenogenesis occurs When the embryo is ploidy, the embryo does not emit light and the aleurone layer emits red light. However, in normal diploid, the embryo emits green light and the aleurone layer emits red light (b in Figure 4). We observed cross-section samples of mature seeds with laser confocal observation and discovered the occurrence of parthenogenetic haploidy in EA19 material. At the same time, we sow and grow the selected haploid seeds (c in Figure 4). Phenotypic results showed that compared with diploid and wild-type plants, haploid plants were thinner and shorter, and the female flowers were sterile. We further determined the ploidy level using flow cytometry of nuclei isolated from mesophyll protoplasts and obtained signal intensity values for haploids, which were approximately half those of diploids (d in Figure 4). We calculated the haploid grain production rates of all nine CRISPRa5 ^BBM lines. The statistical results showed that CRISPRa5 ^BBM -mediated ectopic activation of the ZmBBM2 gene in egg cells can induce parthenogenesis phenotypes, with rates ranging from 0.44% to 3.55. % varied, with most strains producing haploid grains ranging from 1.5% to 2% (e in Figure 4).

In the above, the sequences involved are as follows:

SEQ ID No.1:

SEQ ID No.2:

SEQ ID No.3:

SEQ ID No.4:

SEQ ID No.5:

SEQ ID No.6:

SEQ ID No.7：

SEQ ID No.8：

SEQ ID No.9：

SEQ ID No.10:

SEQ ID No.11：

SEQ ID No.12：

SEQ ID No.13：

SEQ ID No.14：

SEQ ID No.15：

SEQ ID No.16：

Industrial applications

The present invention used the corn mesophyll protoplast transient expression system to screen and identify 6 sets of CRISPR-based gene activation systems. The results showed that the CRISPRa5 system composed of dCas9-VP64 and p65-HSF1 activation domains showed the strongest performance in corn mesophyll protoplasts. The transcriptional activation activity of The transcriptional activation activity of the maize endogenous gene ZmBBM2 was then used as a target to design a CRISPRa5 egg cell ectopic activation endogenous ZmBBM2 gene vector, combined with Agrobacterium-mediated transformation of maize immature embryos, to obtain 9 transgenic events (EA13, EA15 , EA19, EA21, EA22, EA28, EA34, EA36), using in situ hybridization technology, immunohistochemistry, single-cell RT-ddPCR technology and other biochemical and molecular biology methods to detect transformation events, it was determined that CRISPRa5 is present in egg cells Expresses and can ectopically activate the endogenous ZmBBM2 gene to achieve high-level gene activation; finally, by combining flow cytometry, DFP haploid screening system and phenotypic observation, the present invention found that the CRISPRa5 gene activation system was used to ectopically activate maize eggs. Activating the ZmBBM2 gene can induce the occurrence of parthenogenetic haploidy in maize, and the highest haploid induction efficiency is as high as 3.55%. In summary, the present invention uses the CRISPRa5 gene activation system to mediate the ectopic expression of ZmBBM2 gene in maize egg cells, thereby inducing the occurrence of maize parthenogenetic haploidy. This technology provides a method for the creation of engineered maize parthenogenetic haploid reproduction. new ways and methods. The present invention provides an effective way to obtain crop haploid. At the same time, it provides new genetic resources for maize parthenogenesis and provides new ideas for the synthesis of apomixis in other crops.

Claims

A method for obtaining maize parthenogenetic haploids, including the following steps: introducing a system vector of the CRISPRa5 gene activation system used to mediate the ectopic expression of ZmBBM2 gene in maize egg cells into recipient maize to obtain positive transgenic maize; the transgene is positive The egg cells in some embryo sacs of corn can directly develop into haploid embryos and form haploid seeds;

The system vector can express dCas9-VP64 fusion protein, can express MS2-P65-HSF1 fusion protein, and can express one or several sgRNA targeting the -200 to -1 bp position upstream of the ZmBBM2 gene transcription start point, and the sgRNA is sgRNA2.0.
The method according to claim 1, characterized in that: the system vector contains the following two expression cassettes:

Expression cassette 1: used to express two sgRNAs; in the expression cassette 1, it contains the coding sequences of two sgRNAs, and the coding sequences of the two sgRNAs are connected with the Arabidopsis thaliana At-tRNAGly coding sequence and are composed of the same A promoter initiates transcription;

Expression cassette 2: used to express functional proteins, which are formed by fusing the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein through the self-cleaving polypeptide T2A; in the expression cassette 2, The functional protein is transcribed by a plant egg cell-specific promoter.
The method according to claim 2, characterized in that: in the expression cassette 1, the promoter is a ZmU6-2 promoter.
The method according to claim 2, characterized in that: in the expression cassette 2, the plant egg cell-specific promoter is the Arabidopsis thaliana DD45 promoter.
The method according to claim 2, characterized in that: both the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein contain nuclear localization signals.
The method according to any one of claims 3-5, characterized in that: the expression cassette 1 is sequentially composed of the ZmU6-2 promoter and the upstream of the ZmBBM2 gene transcription starting point from the 5' end to the 3' end - The coding nucleic acid of the sgRNA spacer sequence in the 36 bp region, the sgRNA2.0 scaffold coding sequence, the Arabidopsis thaliana At-tRNAGly coding sequence, the coding nucleic acid of the sgRNA spacer sequence targeting the 166 bp region upstream of the ZmBBM2 gene transcription start point, the sgRNA2 .0 scaffold coding sequence composition.
The method according to any one of claims 3 to 5, characterized in that: the expression cassette 2 consists of the Arabidopsis DD45 promoter, 3×Flag tag encoding nucleic acid, and SV40 from the 5' end to the 3' end. Nuclear localization signal coding sequence, dCas9 coding gene, NLS nuclear localization signal coding sequence, VP64 coding gene, the coding gene of the self-cleaving polypeptide T2A, MS2 coding gene, the SV40 nuclear localization signal coding sequence, P65 coding gene, HSF1 coding Gene and transcription terminator NOS.
The method according to any one of claims 3-7, characterized in that: the ZmU6-2 promoter is shown in positions 1-397 of SEQ ID No. 16; and/or

The coding nucleic acid of the sgRNA spacer sequence targeting the -36 bp region upstream of the ZmBBM2 gene transcription start point is shown in positions 398-417 of SEQ ID No. 16; and/or

The sgRNA2.0 scaffold coding sequence is shown in positions 418-553 or 651-793 of SEQ ID No. 16; and/or

The Arabidopsis thaliana At-tRNAGly coding sequence is shown in positions 554-630 of SEQ ID No. 16; and/or

The coding nucleic acid of the sgRNA spacer sequence targeting the -166bp region upstream of the ZmBBM2 gene transcription start point is shown in positions 631-650 of SEQ ID No. 16;

and / or

The Arabidopsis thaliana DD45 promoter is shown in positions 1008-2017 of SEQ ID No. 16; and/or

The 3×Flag tag encoding nucleic acid is shown in bits 2018-2086 of SEQ ID No. 16; and/or

The SV40 nuclear localization signal coding sequence is shown in bits 2093-2113 or 6992-7012 of SEQ ID No. 16; and/or

The dCas9 encoding gene is shown in positions 2114-6238 of SEQ ID No. 16; and/or

The NLS nuclear localization signal coding sequence is shown in bits 6239-6286 of SEQ ID No. 16; and/or

The VP64 encoding gene is shown in positions 6305-6454 of SEQ ID No. 16; and/or

The coding gene of the self-cleaving polypeptide T2A is shown in positions 6482-6535 of SEQ ID No. 16; and/or

The MS2 encoding gene is shown in positions 6551-6937 of SEQ ID No. 16; and/or

The P65 encoding gene is shown in positions 7028-7570 of SEQ ID No. 16; and/or

The HSF1 encoding gene is shown in positions 7595-7966 of SEQ ID No. 16; and/or

The transcription terminator NOS is shown in positions 7967-8238 of SEQ ID No. 16.
The method according to claim 8, characterized in that: the nucleotide sequence of the expression cassette 1 is shown in positions 1-1007 of SEQ ID No. 16; and/or

The nucleotide sequence of the expression cassette 2 is shown in positions 1008-8238 of SEQ ID No. 16.
The method according to claim 9, characterized in that: the system vector of the CRISPRa5 gene activation system is a plasmid containing the DNA fragment shown in SEQ ID No. 16.
The system vector of the CRISPRa5 gene activation system used to mediate the ectopic expression of ZmBBM2 gene in maize egg cells according to any one of claims 1 to 10.
The application of the system vector described in claim 11 in inducing the occurrence of parthenogenetic haploidy in maize.
A CRISPR-based gene activation system, characterized in that: the system vector of the CRISPR-based gene activation system can express dCas9-VP64 fusion protein, can express MS2-P65-HSF1 fusion protein, and can express targeted gene targets One or several sgRNAs in the region, and the sgRNA is sgRNA2.0.
The CRISPR-based gene activation system according to claim 13, characterized in that: the system vector contains the following two expression cassettes:

Expression cassette 1': used to express the sgRNA;

Expression cassette 2': used to express functional proteins, which are formed by fusing the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein through the self-cleaving polypeptide T2A.
The CRISPR-based gene activation system according to claim 14, characterized in that: in the expression cassette 1', the promoter used to initiate the transcription of the sgRNA is a U6 promoter; and/or

In the expression cassette 2', the promoter used to initiate the transcription of the functional protein is the UBI promoter.
The CRISPR-based gene activation system according to claim 14, wherein both the dCas9-VP64 fusion protein and the MS2-P65-HSF1 fusion protein contain nuclear localization signals.
Application of the CRISPR-based gene activation system in any one of claims 13-16 for gene activation of target genes.