CN110093354B - Seed sorting method for fixing plant heterosis - Google Patents

Abstract

A seed sorting method for fixing the heterosis of plants. The invention provides a method for regulating and selecting marker genes by using a pollen specific gene switch system so as to sort and clone seeds, thereby realizing the application of a hybrid non-fusion system. The invention transfers 3 closely linked gene expression cassettes and MiMe knockout vectors into hybrid plants at the same time, wherein the 3 gene expression cassettes comprise: 1) an embryo self-generating gene expression box E1 driven by an egg cell specific expression promoter; 2) a selectable marker gene expression cassette E2 under the control of E3; 3) pollen specifically regulates the expression cassette E3 of E2. The self-bred seed of the heterozygous transgenic plant comprises zygotic embryo seeds formed by pollination and fertilization besides asexual embryo seeds which are generated by parthenogenesis and have fixed heterosis, the two kinds of seeds are sorted by a screening marker regulated and controlled by a pollen specific gene switch, the cloned seeds have the heterosis and can be used for production, and the rest seeds can be used for commercial use.

Description

Seed sorting method for fixing plant heterosis

Technical Field

The invention belongs to the technical field of plant molecular biology and agricultural biology, and particularly relates to a method for realizing application of a hybrid fusion-free system by regulating and controlling a screening marker gene by using a pollen specific gene switch system and further sorting and cloning seeds.

Background

One whole plant contains a sporophyte generation (2n) with a specific reproductive structure (floral organs) in which the pistils and stamens undergo meiosis and genetic recombination to produce respectively megaspores (1n) and microspores (1 n); the large and small spores form female and male gametophytes after several mitosis, the female gametophyte (embryo sac) contains 7 cells (1 egg cell, 2 accessory cells, 1 central cell with 2 nuclei and 3 retropodocytes) and is deeply buried in the ovule tissue of the mother body, and the male gametophyte (pollen) contains 1 vegetative cell and 2 sperms; after pollination, the pollen tube enters the embryo sac and double fertilization occurs, where one sperm (male gamete) combines with the egg cell (female gamete) to form a zygotic embryo (2n) and the other sperm combines with the central cell to form the endosperm (3n), thereby completing a life cycle and starting a new generation of sporozoites. Apomixis is the mode of reproduction in which plants produce embryos and seeds without sperm-egg cell fusion during the production of sporozoites from gametophytes. Including haploid apomixis and diploid apomixis. Since diploid apomixis can produce progeny with the same genotype as that of the parent plant and can fix any excellent genotype, especially under the attention of breeders, we generally refer to apomixis breeding mainly referring to the type, which includes: adventitious (acquired embryo) reproduction, Apospory (Apospory) and diploid sporogenesis (Diplospory).

The research on rice apomixis in China starts from 1979, and in the period of seventy-five, the hot spot of the research on rice apomixis in China is to screen and identify the rice multi-embryo seedling material so as to determine the embryological characteristics and the breeding value of the rice multi-embryo seedling material. However, after intensive research on the embryo development of the multi-embryo rice, it was found that some of the multi-embryo rice has haploid apomixis characteristics, and the multiple embryos are derived from the fertilization of egg cells and assisted cell apomictic reproduction. The difficulty, or even impossibility, of fixing the heterosis of rice by using the existing multi-embryo rice is great. Although it has been reported that materials with adventitious embryonal reproductive properties have been found in rice and even apomictic rice has been successfully cultivated, such messages appear to lack convincing embryological evidence. Another important content in the research of rice apomixis in China is an exploratory test for screening rice apomixis germplasm by introducing genetic materials of distant species with apomixis characteristics into rice by using modern biotechnology. Several mutant individuals were obtained after introducing the total DNA of Panicum paniculatum (Panicam max imum) into indica rice by ear-stem injection. The wide-affinity japonica rice strain 02428 and the apomictic millet strain OK85 are used for asymmetric somatic hybridization to successfully obtain a regenerated plant, the regenerated plant has obvious variation on flower organ shape, structure and reproductive characteristics, and specific reproductive phenomena such as multi-anther, multi-ovule, multi-blastocyst structures and the like occur. However, the breeding value of rice apomictic germplasm is still not created by molecular breeding technology and protoplast fusion technology.

In recent years, plant biotechnology is rapidly developed, and the research and improvement of crops through means of molecular biology and genetic engineering have good application prospects in agricultural production. Recent progress has been made in the field of apomixis research by means of molecular biology and genetic engineering. The rice apomictic system published by professor group of venkatesan sundaresan, university of california, 2018; by editingPAIR1、REC8、OSD1(MiMe) three genes, coupled with ectopic expression in egg cellsBBM1(Synthetic-Apomictic) realizes apomixis of rice. However, the ratio of cloned seeds in the apomictic system is not one hundred percent, and cloned seeds and seeds fertilized by normal pollination cannot be sorted. So that the application of the hybrid apomictic system has not been realized.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a method for regulating and screening marker genes by using a pollen specific gene switch system so as to sort and clone seeds, thereby realizing the application of a hybrid fusion-free system. In addition, the invention also provides nucleic acid for coding the autonomous embryogenesis, screening marker expression and pollen specificity regulation and control screening gene expression and a gene engineering intermediate, and an identification method for judging whether plants adopt the method.

In order to solve the technical problems, the technical scheme of the invention is as follows:

a seed sorting method for fixing the heterosis of plants comprises the following steps:

A. constructing an embryo autonomous generation gene expression box E1 driven by an egg cell specific expression promoter;

B. constructing a screening marker gene expression cassette E2 regulated and controlled by E3;

C. constructing an expression cassette E3 of pollen specificity regulation E2;

D. creating a MiMe mutant;

E. a transgene is created, and the transgene is transferred into the E1, E2 and E33 linked expression cassettes and carries MiMe mutation sites.

The self-bred seed of the transgenic plant comprises asexual embryo seeds which are generated through parthenogenesis and have fixed heterosis, and zygotic embryo seeds formed through pollination and fertilization, and the two kinds of seeds are separated through E2 regulated and controlled by E3.

The E1 represents an embryogenic autonomous expression cassette driven by an egg cell specific expression promoter, E2 represents a selection marker gene expression cassette, and E3 represents an expression cassette driven by a pollen specific expression promoter.

According to the invention, the embryo self-generation expression box E1 driven by the egg cell specific expression promoter can enable the egg cell to parthenogenetic to form an embryo, and the screening marker gene expression box E2 and the expression box E3 driven by the pollen specific expression promoter form a conditional gene knockout system, so that the specific expression of the screening marker gene can be controlled. The 3 expression cassettes and the MiMe mutation sites are transferred into receptor materials, and the transgenic offspring also comprises zygotic embryo seeds generated by normal pollination and fertilization besides the clone seeds generated by parthenogenesis of egg cells. Through a conditional gene knockout system, zygotic embryos generated through pollination and fertilization contain red fluorescence, clone seeds without red fluorescence can be efficiently sorted through photoelectric sorting and used for propagation, and zygotic embryo seeds containing red fluorescence can be used for commercial use.

Preferably, the MiMe mutant in step D has 3 key meiotic genesREC8,PAIR1、OSD1And also can promoteMitosis is substituted for meiosis.

Preferably, the egg cell specific expression promoter of E1 includes but is not limited toAtDD45、Os03g0296600pro、ECA1-like1pro、DCL2、AT1G74480.1、ZmEAlpromoter, said embryogenic gene of E1 includes but is not limited toBBM1、WUS、LEC、CLAVATA、MYB115。

Preferably, the screening marker gene of E2 includes but is not limited to a fluorescent gene.

Preferably, the promoter of E2 is linked to a terminator to prevent the expression of the selection marker gene, and the promoter of E2 is an embryo-specific expression promoter, including but not limited toLec1、OsESP1、EL5、pBnaA09g21960D。

Preferably, the pollen-specific gene switch expression of E3 is achieved by excising the terminator linked to the promoter in E2, allowing expression of the selectable marker gene, the regulatory system of E3 includes, but is not limited to, a double strand break-inducing enzyme system, a genome editing system, a recombinase system, a transposon system, and the pollen-specific expression promoter in E3 includes, but is not limited toPG47。

The present invention provides an expression cassette comprising a polynucleotide as described above operably linked to a heterologous polynucleotide of interest.

One embodiment of the invention also provides a vector that knocks down MiMe and inserts 3 linked expression cassettes: embryogenic autonomous geneBBM1Expression cassette, fluorescent screening marker geneRPExpression cassette andCrea recombinase switch regulates the expression cassette; the embryogenic autonomous geneBBM1In an expression cassetteBBM1The nucleotide sequence of (A) is shown in SEQ ID NO. 2; the fluorescent screening marker geneRPIn an expression cassetteRPThe nucleotide sequence of (A) is shown in SEQ ID NO. 4; the above-mentionedCreIn recombinase switch regulation expression cassetteCreThe nucleotide sequence of the recombinase is shown in SEQ ID NO. 7.

In a second aspect, the invention provides nucleic acids, which may be DNA or RNA, preferably DNA.

In a third aspect, the present invention provides a vector comprising the above-described expression cassette. The nucleic acid of the second aspect of the invention may be constructed such that the expression cassette is inserted into any vector which is transformed into a cell. Primer pairs for amplifying the full length or any of the above-mentioned nucleic acid fragments are also within the scope of the present invention. Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria comprising the nucleic acid fragments of the second aspect are also within the scope of the invention. Preferred cells are plant cells, preferably rice cells, more preferably hybrid rice cells, comprising a nucleic acid of the second aspect of the invention introduced into a plant cell by transgenic techniques (e.g., as described in embodiments herein), including introduction into the nucleus, chloroplast, mitochondria and/or plastid of a plant cell, or by other techniques such that the nucleic acid of the second aspect of the invention is present in the plant cell.

In a fourth aspect, the invention provides a plant, the cells of which comprise an expression cassette as described above, which expression cassette is stably integrated into the genome of the plant cells. The invention provides a plant comprising a nucleic acid according to the second aspect of the invention. By virtue of the introduction of the nucleic acid of the second aspect of the invention, the plant of the fourth aspect of the invention is capable of parthenogenesis yielding asexual embryo seeds with fixed heterosis and zygotic embryo seeds formed by fertilization. In this context, a plant refers to an individual plant, a group of plants or propagation material thereof, including a plant, a plant variety, a plant event, a plant progeny, a plant seed or a reproductive part of another plant, which is capable of synthesizing carbohydrates, proteins to survive by photosynthesis, with inorganic substances such as water, carbon dioxide and inorganic salts. Wherein, the plant progeny is a plant, and comprises plant progeny generated by transgenic technology, plant progeny generated by crossing with other plant varieties, and plant progeny generated by backcrossing or selfing.

Methods for integrating the expression cassette into recipient materials, which are monocotyledonous or dicotyledonous plants, such as rice, corn, rape, millet, wheat, pepper, include, but are not limited to, transgenic techniques and hybridization.

In one embodiment of the present invention, the preferred plant is rice, more preferably hybrid rice.

A specific embodiment of the present invention also provides a plant, the cells of which comprise the nucleotide sequences SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO. 7.

In a fifth aspect, the present invention provides the use of each of the aforementioned expression cassettes for fixing heterosis in a plant. The embryo self-generating gene expression box E1 driven by the egg cell specific expression promoter can lead parthenogenesis containing egg cells to generate asexual embryos with fixed heterosis; the selection marker gene expression box E2 regulated and controlled by E3 and the expression box E3 of pollen specificity regulation and control E2 can separate asexual embryo seeds generated by parthenogenesis and zygotic embryo seeds formed by pollination and insemination. The cloned seeds retain heterosis for production, and the remaining seeds are commercially available.

In a sixth aspect, the present invention provides a method of identifying a plant of the fourth aspect of the invention, i.e. determining whether said plant contains a nucleic acid as described in the second aspect. By this method, it is possible to judge whether or not a plant belongs to the plant of the present invention, that is, whether or not it belongs to the plant of the fourth aspect of the present invention. The steps of the assay may be performed by conventional nucleic acid detection and sequencing, exemplary methods include nucleic acid sequencing, Polymerase Chain Reaction (PCR) detection, observation of screening labels, fluorescent quantitative sorting, probe hybridization detection, sequencing, flow cytometry, and the like.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention can efficiently sort out clone seeds without red fluorescence for propagation, and zygotic embryo seeds containing red fluorescence can be used for commercial use.

2. The invention can produce and sort out the clone seeds with fixed heterosis on the premise of not influencing the seed yield, eliminates the complex seed production procedure of the hybrid seeds, lightens the labor intensity, reduces the production cost of the hybrid seeds, meets the industrialization requirement of the heterosis utilization one-line method, and integrally improves the benefit of the hybrid industry. The invention has wide application and market prospect in the agricultural field.

Drawings

Fig. 1 is a schematic structural view of the apomictic vector p24DB of the present invention.

Detailed Description

The present invention will be described in detail with reference to examples. It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict.

Example 1

The construction of the rice expression vector carrying the autonomous embryogenesis gene E1, the fluorescence screening marker gene E2 and the expression cassette of the regulation and control screening marker gene E33 linked gene:

1. selection of specific promoters and target genes

Determination of 1 egg cell specific expression promoter by reference to literature and web searchAtDD45ProThe nucleotide sequence is shown in SEQ ID NO. 1; determination of 1 embryogenesis GeneBBM1The nucleotide sequence is shown in SEQ ID NO. 2; determination of 1 embryo-specific expression promoterOsESP1The nucleotide sequence is shown in SEQ ID NO. 3; determining red fluorescence gene RP as screening marker gene, and the nucleotide sequence is shown in SEQ ID NO. 4; determining 1 pollen specific expression promoter, and the nucleotide sequence is shown in SEQ ID NO. 5.

2. Construction of the apomictic vector p24DB

Are respectively atPAIR1、REC8、OSD1The design of 1 target is carried out,

5′-GCGCTCGCCGACCCCTCGGG-3′；

5′-GGTGAG GAGGTTGTCGTCGA-3′；

5′-GTGTGGCGATCGTGTACGAG-3′。

construct the MiMe knockout vector. Insert 3 linked expression cassettes on the knock-out vector: embryogenic autonomous geneBBM1Expression cassette, fluorescent screening marker geneRPExpression cassette andCrethe enzyme switch regulates the expression cassette. Embryogenic autonomous geneBBM1Carrying egg cell specific expression promoterAtDD45AndNosa terminator, the nucleotide sequence of which is shown in SEQ ID NO. 6; carrierpLJ02OnRPThe coding sequence carries embryo specific expression promoterOsESP1、loxP-Nos-loxPAndNosa terminator; pollen specific expression promoterPG47Carry aboutCreA recombinant enzyme, wherein the recombinant enzyme is selected from the group consisting of,Crethe nucleotide sequence of the recombinase is shown in SEQ ID NO.7 andNosand a terminator. The complete vector construction map is shown in figure 1.

3. Transformation of recombinant plasmids

(1) Mixing a tube of 200. mu.L of Escherichia coli competent cell DH5a with 5. mu.L of the ligation product, and carrying out ice bath for 30 min;

(2) quickly placing in a constant temperature water bath kettle at 42 deg.C, thermally shocking for 90 s, and ice-cooling for 2 min;

(3) adding 500 μ L LB liquid culture medium, mixing;

(4) culturing at 37 deg.C and 200 rpm for 45 min to restore normal growth state of cells;

(5) uniformly coating the bacterial liquid on an LB solid culture medium flat plate;

(6) after 30 min, the cells were incubated overnight in a 37 ℃ incubator.

(7) And (3) selecting correct monoclonal inoculation, extracting plasmids and carrying out enzyme digestion verification.

4. Obtaining of recombinant bacteria

The correct plant expression vector will be constructed to transform Agrobacterium EHA105 using an electrical stimulation method. The introduction method adopts an electric shock conversion method, mainly refers to the use instruction of an electric shock instrument of bio-rad company, and comprises the following specific steps:

EHA105 competent cells stored at-80 ℃ were taken out and frozen on ice, a 1mm electric shock cup was placed on ice for precooling, and the frozen SOC was thawed at 37 ℃. Clean EP tubes, two more than the sample to be transformed, one for negative control (no DNA added) and the other for positive control (1. mu.l of 10 ng/. mu.l pUC19 added), were inserted on ice for pre-cooling. Respectively absorbing 1 mu l of DNA samples to be transformed and placing the DNA samples into a precooled EP centrifuge tube, then gently taking out 20 mu l of melted EHA105 competent cells and placing the cells into the bottom of the precooled centrifuge tube, gently mixing the cells and the precooled centrifuge tube uniformly without generating bubbles as much as possible, avoiding the bottom of the centrifuge tube from being contacted by hands, avoiding the influence of temperature change on the competence transformation efficiency, and ensuring the operation process to be as fast as possible. Transformation parameters, resistance 200 omega, capacitance 25 muF, voltage 1800V, electric cup specification 1mm, parameters generally recommended by BioRad electric laser instrument are set. Gently suck the mixture of competence and DNA, place it in the cuvette, and tap it to distribute the mixture evenly over the bottom of the cuvette. Covering with a cover, placing into an electric excitation groove, closing a safety cover, pressing an electric excitation red button, placing SOC preheated at 37 deg.C into an electric excitation cup after electric excitation is completed, spinning up the mixture, transferring the mixture into a bacteria shaking tube with a suction head, shaking at 28 deg.C and 180 rpm for 2 h. Mu.l of the bacterial liquid was applied to LB solid medium containing kanamycin (50. mu.g/mL) and rifampicin (25. mu.g/mL), and dark cultured at 28 ℃ for 2 d, and a single colony of Agrobacterium transformant was selected and inoculated to LB liquid medium to which the same antibiotic was added, and shake-cultured at 28 ℃ for 2 d. Taking a proper amount of bacterial liquid, adding equal volume of sterile glycerol with the concentration of 50 percent, mixing, and storing at the temperature of minus 80 ℃ for later use.

Example 2

Obtaining of transgenic plants:

selecting rice expression vectorp24DBInoculating single colony of Agrobacterium to LB culture medium containing 50 mg/L kanamycin, dark culturing at 26 deg.C for 2 days, washing with NB-AS liquid culture medium, and shake culturing at 28 deg.C and 180 rpm for 90-120 min. Adjusting colony concentration to OD600 of 0.8-1.0, transforming hybrid rice, sterilizing hybrid rice seeds, selecting plump seeds, soaking in 75% ethanol for 30 s, pouring off ethanol, washing with sterile water, and washing with HgCl₂Sterilizing for 8 min, washing with sterile water for 2 times, soaking for 1 min each time, and soaking with sterile water for 1 h. And inoculating the disinfected seeds on an induction culture medium, and growing for 7 d under illumination.

Sterile calli were pooled together. Soaking in Agrobacterium suspension for 5-10 min, taking out, and air drying with filter paper. Inoculating to co-culture medium, co-culturing for 2 days, washing the co-cultured callus for 6 times, air drying with filter paper, and inoculating to screening medium with hygromycin resistance for 45 days.

Transferring the resistance callus to a differentiation medium, culturing for 2 weeks until the callus turns green, and growing buds and roots after 3 weeks. And transferring the seedlings into small triangular flasks containing rooting culture media, culturing one seedling in each flask under illumination, hardening seedlings indoors when the small plants grow to be about 7-10 cm, and transplanting the seedlings into soil for growth after 3-4 days. And screening out positive plants by observing fluorescence and PCR detection.

Example 3

Molecular detection of transgenic plants:

DNA extraction: 1.0 g of leaf was taken, ground to powder with liquid nitrogen, transferred to a 2 ml EP tube, and 700. mu.l of preheated CTAB solution was added. And (3) carrying out water bath at 65 ℃ for 30-60min, gently mixing, cooling, and adding equal volume of chloroform: isoamyl alcohol (24: 1), mixing uniformly, centrifuging at 12000 rpm for 10 min, taking the supernatant to a new centrifugal tube, adding 500 mu l of isopropanol, and standing at-20 ℃ for 30-60 min. The precipitate was collected at 12000 rpm for 10 min at 4 ℃ and the supernatant was discarded. Washing the precipitate with 70% ethanol for 2 times, blowing dry the ethanol residue, 50-100 μ l ddH₂Dissolving the precipitate with O, and reserving for later use.

PCR analysis: to be provided withRPThe gene is used as a template to design a primer, and the amplified product fragment is 431 bp.

A forward primer:

F: 5' CCCAGTTCCAGTACGGCTCCAAG 3'；

reverse primer:

R: 5' CTCGTTGTGGGAGGTGATGTCCAG 3'。

and (3) PCR reaction system: DNA 30-90 ng, 10 XBuffer 2.0. mu.l, 1mM dNTP 1.8. mu.l, 25 mM MgCl₂1.5. mu.l of 10 uM primer 0.5. mu.l each, 1.5U of Tag enzyme, plus ddH₂O to a reaction volume of 20. mu.l. PCR cycling conditions were 94 ℃ for 3 min; 94 ℃, 1 min, 64 ℃, 1.5 min, 72 ℃ for 30 s, 40 cycles; extension for 5 min at 72 ℃. The detection was carried out by electrophoresis on a 1.4% agarose gel, and the results of the electrophoresis were recorded by photography.

Fluorescence quantitative analysis: RNA extraction was performed on T0 generation transgenic hybrid rice and wild type hybrid rice controls using a plant Total RNA extraction kit (Tiangen DP 432), methods referenced to kit instructions. The total RNA is used as a template to carry out reverse transcription to synthesize the corresponding cDNA. To be provided withActinUsing RT-PCR method to compare the wild plant as control and reference geneRPQuantitative PCR of genesAnd (6) detecting.

Southern blot analysis: taking the total DNA of rice to carry outEcoRI digestion, electrophoresis, transfer to nitrocellulose Membrane Hybond-N, Using random primer labeling kit (Promega Co.) & lt [ α -32P ]]dATP (Beijing Asia Hai Co., Ltd.) prepared α -32P-labeled by random primer methodRPThe gene fragment was used as a molecular probe for Southern hybridization analysis of the transformed plant according to the molecular cloning method such as Sambrook.

Example 4

Agronomic trait investigation of transgenic plants:

and (3) inspecting the fertility and seed setting conditions of the pollen of the transgenic plant subjected to molecular identification. The anther is stained with conventional I2-KI, and the ratio of sterile pollen to fertile pollen is observed. Compared with wild type control, the agronomic performances of the transgenic plant such as plant height, tillering number, sword leaf length, seed setting rate, thousand kernel weight and the like are observed.

Example 5

Reproduction of hybrid rice by apomixis:

selfing the hybrid rice carrying the apomictic vector. The selfing seeds are subjected to photoelectric sorting of red fluorescence, seeds with red fluorescence are screened out, and the obtained seeds with red fluorescence are zygote embryo seeds for commercial use; and the seeds without red fluorescence are clone seeds and are continuously used for the propagation of hybrid rice.

The foregoing examples are set forth to illustrate the present invention more clearly and are not to be construed as limiting the scope of the invention, which is defined in the appended claims to which the invention pertains, as modified in all equivalent forms, by those skilled in the art after reading the present invention.

SEQUENCE LISTING

<110> research center for hybrid rice in Hunan province

<120> seed sorting method for fixing plant heterosis

<130>1

<160>7

<170>PatentIn version 3.5

<210>1

<211>1002

<212>DNA

<213> Artificial Synthesis

<400>1

aaatgttcct cgctgacgta agaagacatt agtaatggtt ataatatata gctttctatg 60

aatgtatggt gagaaaatgt ctgttcactg attttgagtt tggaataaaa gcatttgcgt 120

ttggtttatc attgcgttta tacaaggaca gagatccact gagctggaat agcttaaaac 180

cattatcaga acaaaataaa ccattttttg ttaagaatca gagcatagta aacaacagaa 240

acaacctaag agaggtaact tgtccaagaa gatagctaat tatatctatt ttataaaagt 300

tatcatagtt tgtaagtcac aaaagatgca aataacagag aaactaggag acttgagaat 360

atacattctt gtatatttgt attcgagatt gtgaaaattt gaccataagt ttaaattctt 420

aaaaagatat atctgatcta gatgatggtt atagactgta attttaccac atgtttaatg 480

atggatagtg acacacatga cacatcgaca acactatagc atcttattta gattacaaca 540

tgaaattttt ctgtaataca tgtctttgta cataatttaa aagtaattcc taagaaatat 600

atttatacaa ggagtttaaa gaaaacatag cataaagttc aatgagtagt aaaaaccata 660

tacagtatat agcataaagt tcaatgagtt tattacaaaa gcattggttc actttctgta 720

acacgacgtt aaaccttcgt ctccaatagg agcgctactg attcaacatg ccaatatata 780

ctaaatacgt ttctacagtc aaatgcttta acgtttcatg attaagtgac tatttaccgt 840

caatcctttc ccattcctcc cactaatcca actttttaat tactcttaaa tcaccactaa 900

gcttcgaatc catccaaaac cacaatataa aaacagaact ctcgtaactc aatcatcgca 960

aaacaaaaca aaacaaaaca aaaaccccaa aaagaaagaa ta 1002

<210>2

<211>1680

<212>DNA

<213> Artificial Synthesis

<400>2

atggcctcca tcaccaactg gctcggcttc tcctcctcct ccttctccgg cgccggcgcc 60

gaccccgtcc tgccccaccc gccgctgcaa gagtggggga gcgcttatga gggcggcggc 120

acggtggcgg ccgccggcgg ggaggagacg gcggcgccga agctggagga cttcctcggc 180

atgcaggtgc agcaggagac ggccgccgcg gcggcggggc acggccgtgg aggcagctcg 240

tcggtcgttg ggctgtccat gatcaagaac tggctacgca gccagccgcc gcccgcggtg 300

gttgggggag aagacgctat gatggcgctc gcggtgtcga cgtcggcgtc gccgccggtg 360

gacgcgacgg tgccggcctg catttcgccg gatgggatgg ggtcgaaggc ggccgacggc 420

ggcggcgcgg ccgaggcggc ggcggcggcg gcggcgcaga ggatgaaggc ggccatggac 480

acgttcgggc agcggacgtc catctaccgg ggtgtcacca agcacaggtg gacaggaagg 540

tatgaagccc atctttggga taacagctgc agaagagaag gtcagactcg caaaggcaga 600

caagtcaatg caggaggata tgataaggaa gaaaaagctg ctagggctta tgatttggct 660

gcccttaaat actggggcac tacaacgacg acgaattttc cggtaagcaa ctacgaaaaa 720

gagttggatg aaatgaagca catgaatagg caggaatttg ttgcatccct tagaagaaaa 780

agcagtggat tttcacgtgg tgcttccata tatcgtggtg ttacaagaca ccatcagcat 840

ggaaggtggc aagcaaggat aggacgggtg gcaggaaaca aggatctgta tttgggcaca 900

tttggcaccc aagaggaagc tgcagaggca tatgatatcg ctgcaatcaa attccgtggt 960

ctcaatgctg tgacaaactt tgacatgagc cggtacgatg tcaagagcat cattgaaagc 1020

agcaatctcc caattggtac tggaaccacc cggcgattga aggactcctc tgatcacact 1080

gataatgtca tggacatcaa tgtcaatacc gaacccaata atgtggtatc atcccacttc 1140

accaatgggg ttggcaacta tggttcgcag cattatggtt acaatggatg gtcgccaatt 1200

agcatgcagc cgatcccctc gcagtacgcc aacggccagc ccagggcatg gttgaaacaa 1260

gagcaggaca gctctgtggt tacagcggcg cagaacctgc acaatctaca tcattttagt 1320

tccttgggct acacccacaa cttcttccag caatctgatg ttccagacgt cacaggtttc 1380

gttgatgcgc cttcgaggtc cagtgactca tactccttca ggtacaatgg aacaaatggc 1440

tttcatggtc tcccgggtgg aatcagctat gctatgccgg ttgcgacagc ggtggaccaa 1500

ggtcagggca tccatggcta tggagaagat ggtgtggcag gcattgacac cacacatgac 1560

ctgtatggca gccgtaatgt gtactacctt tccgagggtt cgcttcttgc cgatgtcgaa 1620

aaagaaggcg actatggcca atctgtgggg ggcaacagct gggttttgcc gacaccgtag 1680

<210>3

<211>1439

<212>DNA

<213> Artificial Synthesis

<400>3

agagggcaga gaaagaatgc ttgtggttca tttcttatct tcaagcacta tccctgaaga 60

aaagacagat atacataagg aaatgattaa tatgagcata gaatgcttgc agttcaattt 120

cttatcttca agcactgccc cagaagaata gacaggtgaa cataaggaaa tgattaatat 180

gaacatactg aacaaacaaa atcgcaataa ggatggatac cttgagtaaa gattgaagaa 240

tatccatggt gctctggttt ccatcgtaac ctttccgctt ttgcagtttt cactgtggta 300

attagatttg tttagaaaca ggaagaataa tgtgtttgcc agtgagatct ttcaatttat 360

tgcaccaaaa ctgatgagga cagtcaacta cctagcagtc atgtactgtt ggtatgacac 420

caaactggcc aaacatcttt atctcaatag cgctatatat agctaaaact gatgactttt 480

tcatcttttc tcctcatcaa ttatactatc actttccaag ttagggaaat gacaccattc 540

ggctggaaag ctattgtttt gatcaacgtg gacttgctat gaccagtgat ttactttcat 600

ccctggcatg ctgataatgt catgaataaa acgacaaaaa gtacatgcat actgaaataa 660

ggagggattt cctctggaat aggaaaaccg caaagaggaa caatatatgg tgttaacaag 720

ggatttgtca ctattgggaa gaataattgg ccaattttag catcttaggc atttcattcc 780

aatcactata aggcaggaaa aggcacaagc ggaccatttt tttactggat aggcagatca 840

attctttctt tctttctgag acatttgcat ccaaaaagcc caacatggca tgtaccattg 900

acttgatata gtgagaaact ggcctaacaa ttttacctgg tcagaatttt agttcatggc 960

ccaacattag cagcttttat taaaatggag catatcatga atgaataaca catgatggta 1020

aattactagc acgagaaagc attgggaaaa aaatcacacc aaagcaacca atctatgcat 1080

ctaatgcaaa tttccacaat cttcagagat gcaaaacatg cattatcgaa ttatatgcta 1140

tgttccatcc cactcgaatg cgaagttttc catgctaaaa ttgaaagaaa tgcgttaaaa 1200

caagagaaac gacaattgct gacttggtgg caattgtggc atactcgtag aaaaaaatgt 1260

tttatctgat ataaataaaa gaacatggga aatctggtgt ttgatagtag ttttggtaaa 1320

tacacactaa gctgttaggc ctggtaattt tgatagtgca gcatcaccta aatctgaact 1380

gatctttaag cataaactag ggtgtgcatt ctttgctcag ctgtccttgt aattccata 1439

<210>4

<211>678

<212>DNA

<213> Artificial Synthesis

<400>4

atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60

accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240

gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360

aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420

atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480

acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540

tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660

caccacctgt tcctgtag 678

<210>5

<211>2771

<212>DNA

<213> Artificial Synthesis

<400>5

agcttgcatg cctgcaggtc gactctagag gatctgcacc ggacactgtc tggtggcata 60

cctgccggtc cggtgtgcca gatcagggca cccttcggtt cctttgctcc tttgcttttg 120

aaccctaact ttgatcgttt attggtttgt gttgaacctt tatgcacctg tggaatatat 180

aatctagaac aaactagtta gtccaatcat ttgtgttggg cattcaacca ccaaaattat 240

ttataggaaa aggttaaacc ttatttccct ttcaatctcc ccctttttgg tgattgatgc 300

caacacaaac caaagaaaat atataagtgc agaattgaac tagtttgcat aaggtaagtg 360

cataggttac ttagaattaa atcaatttat acttttactt gatatgcatg gttgctttct 420

tttattttaa cattttggac cacatttgca ccacttgttt tgttttttgc aaatcttttt 480

ggaaattctt tttcaaagtc ttttgcaaat agtcaaaggt atatgaataa gattgtaaga 540

agcattttca agatttgaaa tttctccccc tgtttcaaat gcttttcctt tgactaaaca 600

aaactccccc tgaataaaat tctcctctta gctttcaaga gggttttaaa tagatatcaa 660

ttggaaatat atttagatgc taattttgaa aatataccaa ttgaaaatca acataccaat 720

ttgaaattaa acataccaat ttaaaaaatt tcaaaaagtg gtggtgcggt ccttttgctt 780

tgggcttaat atttctcccc ctttggcatt aatcgccaaa aacggagact ttgtgagcca 840

tttatacttt ctccccattg gtaaatgaaa tatgagtgaa agattatacc aaatttggac 900

agtgatgcgg agtgacggcg aaggataaac gataccgtta gagtggagtg gaagccttgt 960

cttcgccgaa gactccattt ccctttcaat ctacgactta gcatagaaat acatttgaaa 1020

acacattagt cgtagccacg aaagagatat gatcaaaggt atacaaatga gctatgtgtg 1080

taatgtttca atcaaagttt cgagaatcaa gaatatttag ctcattccta agtttgctaa 1140

aggttttatc atctaatggt ttggtaaaga tatcgactaa ttgttctttg gtgctaacat 1200

aagcaatctc gatatcaccc ctttgttggt gatccctcaa aaagtgatac cgaatgtcta 1260

tgtgcttagt gcggctgtgt tcaacgggat tatccgccat gcagatagca ctctcattgt 1320

cacataggag agggactttg ctcaatttgt agccatagtc cctaaggttt tgcctcatcc 1380

aaagtaattg cacacaacaa tgtcctgcgg caatatactt ggcttcggcg gtagaaagag 1440

ctattgagtt ttgtttcttt gaagtccaag acaccaggga tctccctaga aactgacaag 1500

tccctgatgt gctcttccta tcaattttac accctgccca atcggcatct gaatatccta 1560

ttaaatcaaa ggtggatccc ttggggtacc aaagaccaaa tttaggagtg taaactaaat 1620

atctcatgat tcttttcacg gccctaaggt gaacttcctt aggatcggct tggaatcttg 1680

cacacatgca tatagaaagc atactatctg gtcgagatgc acataaatag agtaaagatc 1740

ctatcatcga ccggtatacc ttttggtcta cggatttacc tcccgtgtcg aggtcgagat 1800

gcccattagt tcccatgggt gtcctgatgg gcttggcatc cttcattcca aacttgttga 1860

gtatgtcttg aatgtacttt gtttggctga tgaaggtgcc atcttggagt tgcttgactt 1920

gaaatcctag aaaatatttc aacttcccca tcatagacat ctcgattttc ggaatcatga 1980

tcctactaaa ctcttcacaa gtagatttgt tagtagaccc aaatataata tcatcaacat 2040

aaatttggca tacaaacaaa acttttgaaa tggttttagt aaagagagta ggatcggctt 2100

tactgactct gaagccatta gtgataagaa aatctcttag gcattcatac catgctgttg 2160

gggcttgctt gagcccataa agcgcctttg agagtttata aacatggtta gggtactcac 2220

tatcttcaaa gccgagaggt tgctcaacat agacctattc accccatttg atcacttttt 2280

tggtccttca ggatctaata gttatgtata atttagagtc tcttgtttaa tggccagata 2340

tttctaatta atctaagaat ttatgatatt ttttaatttt ttatcatgtc tgatgagaat 2400

taacataaag gctcaattgg gtcctgaatt aataatagag tgaaaattaa tccagaggct 2460

ctattagaac cttcaattag taataccaag atatatataa gatagtagag tatagtttaa 2520

atgttggcat tgttcattct ttcttttgtt atttaattta tgctttccac ggtggttagt 2580

ggttacttct gaagggtcca aataatgcat gaagagtttg aggacaagaa gtctgcccta 2640

aaaatagcga tgcaaaggca tggtgtccaa gccatacata tagcgcacta attttatcag 2700

cagaacaatg gtatttatag gtcctagtgc ccaggcaaca agagacacga ataaagcatc 2760

gatcacgaca c 2771

<210>6

<211>278

<212>DNA

<213> Artificial Synthesis

<400>6

ggtgaccagc tcgaatttcc ccgatcgttc aaacatttgg caataaagtt tcttaagatt 60

gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt acgttaagca 120

tgtaataatt aacatgtaat gcatgacgtt atttatgaga tgggttttta tgattagagt 180

cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa actaggataa 240

attatcgcgc gcggtgtcat ctatgttact agatcggg 278

<210>7

<211>1254

<212>DNA

<213> Artificial Synthesis

<400>7

gaaaatagaa cgcacgcgcg gtcgctggcg tttctatgac gagaaccata aacaggtaaa 60

ggcagagccg atcctgtaca ctttacttaa aaccattatc tgagtgttaa atgtccaatt 120

tactgaccgt acaccaaaat ttgcctgcat taccggtcga tgcaacgagt gatgaggttc 180

gcaagaacct gatggacatg ttcagggatc gccaggcgtt ttctgagcat acctggaaaa 240

tgcttctgtc cgtttgccgg tcgtgggcgg catggtgcaa gttgaataac cggaaatggt 300

ttcccgcaga acctgaagat gttcgcgatt atcttctata tcttcaggcg cgcggtctgg 360

cagtaaaaac tatccagcaa catttgggcc agctaaacat gcttcatcgt cggtccgggc 420

tgccacgacc aagtgacagc aatgctgttt cactggttat gcggcggatc cgaaaagaaa 480

acgttgatgc cggtgaacgt gcaaaacagg ctctagcgtt cgaacgcact gatttcgacc 540

aggttcgttc actcatggaa aatagcgatc gctgccagga tatacgtaat ctggcatttc 600

tggggattgc ttataacacc ctgttacgta tagccgaaat tgccaggatc agggttaaag 660

atatctcacg tactgacggt gggagaatgt taatccatat tggcagaacg aaaacgctgg 720

ttagcaccgc aggtgtagag aaggcactta gcctgggggt aactaaactg gtcgagcgat 780

ggatttccgt ctctggtgta gctgatgatc cgaataacta cctgttttgc cgggtcagaa 840

aaaatggtgt tgccgcgcca tctgccacca gccagctatc aactcgcgcc ctggaaggga 900

tttttgaagc aactcatcga ttgatttacg gcgctaagga tgactctggt cagagatacc 960

tggcctggtc tggacacagt gcccgtgtcg gagccgcgcg agatatggcc cgcgctggag 1020

tttcaatacc ggagatcatg caagctggtg gctggaccaa tgtaaatatt gtcatgaact 1080

atatccgtaa cctggatagt gaaacagggg caatggtgcg cctgctggaa gatggcgatt 1140

agccattaac gcgtaaatga ttgctataat tatttgatat ttatggtgac atatgagaaa 1200

ggatttcaac atcgacggaa aatatgtagt gctgtctgta agcactaata ttca 1254

Claims (4)

1. A seed sorting method for fixing the heterosis of plants is characterized by comprising the following steps:

A. constructing an embryo autonomous generation gene expression box E1 driven by an egg cell specific expression promoter;

B. constructing a screening marker gene expression cassette E2 regulated and controlled by E3;

C. constructing an expression cassette E3 of pollen specificity regulation E2;

D. creating a MiMe mutant;

E. creating transgenes, transferring the transgenes into the E1, E2 and E33 linked expression cassettes and carrying MiMe mutation sites;

e3 regulates and controls E2, asexual embryo seeds produced by parthenogenesis and fixed with heterosis and zygotic embryo seeds formed by pollination and fertilization are sorted;

the plant is a monocotyledon or a dicotyledon;

the promoter of E2 is connected with a terminator in the step B; the promoter of the E2 is an embryo-specific expression promoter, and comprises Lec1, OsESP1, ESD4Like5 and pBnaA09g 21960D;

the pollen-specific gene switch expression of E3 in the step C can remove the terminator connected with the promoter in E2, the regulation system of E3 comprises a double-strand break induction enzyme system, a genome editing system, a recombinase system and a transposon system, and the pollen-specific expression promoter in E3 comprises PG 47;

the mutation type of the MiMe mutant in the step D refers to the knock-out of PAIR1, REC8 and OSD1 genes;

2. the method of claim 1, wherein the egg cell specific expression promoter of E1 in step a comprises AtDD45, Os03g0296600pro, ECA1-like1 pro, DCL2, AT1G74480.1, ZmEAl promoter, and the embryogenic gene of E1 comprises BBM1, WUS, LEC, CLAVATA, MYB 115.

3. A vector that knocks out MiMe and inserts 3 linked expression cassettes: an embryogenesis gene BBM1 expression cassette, a fluorescence screening marker gene RFP expression cassette and a Cre recombinase switch regulation expression cassette; the nucleotide sequence of BBM1 in the expression cassette of the embryo autonomous gene BBM1 is shown in SEQ ID NO. 2; the nucleotide sequence of RFP in the fluorescent screening marker gene RFP expression cassette is shown in SEQ ID NO. 4; the nucleotide sequence of Cre recombinase in the Cre recombinase switch regulation expression cassette is shown in SEQ ID NO. 7;

the MiMe knockout refers to the knockout of PAIR1, REC8 and OSD1 genes;

the embryo self-generating gene BBM1 carries an egg cell specific expression promoter AtDD45 and a Nos terminator, the RFP carries an embryo specific expression promoter OsESP1, loxP-Nos-loxP and a Nos terminator, and the Cre recombinase is carried by a pollen specific expression promoter PG47 and is connected with the Nos terminator.

4. Use of the method according to claim 1, the vector according to claim 3 for fixing heterosis, cloning seeds.

Images