CN110029126B - Method for fixing plant hybrid vigor - Google Patents

Abstract

The present invention provides a method for inducing apomixis in plants to fix heterosis. The invention transfers 4 closely linked gene expression cassettes into hybrid plants, comprising: A. a lethal gene expression cassette E1 driven by an egg cell or embryo specific expression promoter; B. an embryogenic gene expression cassette E2 driven by a specific expression promoter of the cells of the bead-associated peer; C. pollen inactivation gene expression cassette E3 driven by pollen specific expression promoter; D. screening the marker gene expression cassette E4. The heterozygous transgenic plant forms embryo by the bead body cell in the selfing and setting process, and the sperm without transgene is combined with the central cell to form endosperm, so as to develop into seed; egg cells and sperm not carrying the transgene are normally fertilized and set; however, the egg cells carrying the transgene are aborted and cannot participate in fertilization. The invention can fix the hybrid vigor of hybrid seeds without seed production and propagation.

Description

Method for fixing plant hybrid vigor

Technical Field

The invention belongs to the technical fields of plant molecular biology and agricultural biology, and particularly relates to a method for fixing plant hybrid vigor by inducing apomixis.

Background

The rice is one of main grain crops in China, wherein the planting area of the hybrid rice accounts for more than 57 percent of the total area of the rice, the average yield is 7.2 t/hm <2 >, the yield is 1.4t higher than that of the conventional rice, and the grain yield increased by planting the hybrid rice per year can be increased by 7000 thousands of population. The perennial seed production (breeding) area of China is 18 ten thousand hm ² About, the breeding procedure and production link of hybrid rice are complex, the seed cost is high, and the price is an inherent adverse factor for restricting the development of hybrid rice. Rice breeding from three lines, two lines to one line is a historic inevitable trend. For many years, many ideas, such as none, have been proposed to explore ways and methods of fixing heterosisSexual reproduction, tube reproduction, balanced lethality, amphidiploid, etc., are ultimately considered to be an optimal approach for utilizing apomixis in plants. Mr Yuan Longping 2018 uses the 5 th generation hybrid rice using apomixis fixed rice heterosis as the direction of hybrid rice development. Compared with a three-line or two-line cross breeding system, the apomixis can be utilized to fix any heterozygous genotype, so that the breeding efficiency is improved; simplifying the production process of hybrid seeds and reducing the seed production cost.

A complete plant contains sporophyte generations (2 n) with specific reproductive structures (floral organs) in which pistils, stamens undergo meiosis and genetic recombination to produce megaspores (1 n) and microspores (1 n), respectively; the megasporophores and microspores undergo several mitosis to form female gametophytes, wherein the female gametophytes (embryo sacs) contain 7 cells (1 egg cell, 2 auxiliary cells, 1 central cell with 2 nuclei and 3 counter foot cells) and are deeply buried in ovule tissues of the parent, and the male gametophytes (pollen) contain 1 vegetative cell and 2 sperms; after pollination, the pollen tube enters the embryo sac and double fertilization occurs, wherein one sperm (male gamete) and egg cell (female gamete) combine to form a zygotic embryo (2 n), and the other sperm and central cell combine to form endosperm (3 n), thereby completing a life cycle and starting a new round of sporophyte generation. Apomixis is the reproductive manner in which plants produce embryos and seeds without sperm-egg cell fusion during the production of sporophytes from gametophytes. Including both haploid apomixis and diploid apomixis. Diploid apomixis is, because it produces offspring of exactly the same genotype as the parent plant, capable of fixing any superior genotype, and is particularly appreciated by breeders, and what we refer to as apomixis breeding is also primarily specific to this type, and includes: adventitious embryo (Adventive embryony) reproduction, apospory reproduction (Apospory) and diploid spore reproduction (diplosporry).

In 1979, the research of rice apomixis in China, and in seventy five period, the focus of the research of rice apomixis in China is to screen and identify rice multi-embryo seedling materials so as to determine embryology characteristics and breeding values of the rice multi-embryo seedling materials. However, byAfter intensive research on embryo development of multi-embryo rice, part of multi-embryo rice has haploid apomixis characteristic, and multi-embryo comes from fertilization of egg cells and assisted cell apomixis. The difficulty of fixing the heterosis of rice is considerable or even impossible with existing multi-embryo rice. Although it has been reported that materials with adventitious embryogenic properties have been found in rice, and even apomictic rice has been successfully cultivated, such messages appear to lack convincing embryological evidence. Another important content in the research of rice apomixis in China is to introduce genetic materials of distant species with apomixis characteristics into rice by using a modern biotechnology, so as to screen exploratory tests of rice apomixis germplasm. The broomcorn millet is injected by the ear and stem injection methodPanicam max imum) After the total DNA was introduced into indica rice, some individuals were obtained. The non-symmetrical somatic hybridization of japonica rice broad-affinity strain 02428 and apomictic maize strain OK85 is utilized to successfully obtain regenerated plants, the regenerated plants have obvious variation in the morphology, structure and reproduction characteristics of flowers, and the specific reproduction phenomena such as multi-anther, multi-ovule and multi-embryo sac structure appear. However, rice apomictic germplasm has not been created to be of breeding value by molecular breeding techniques and protoplast fusion techniques.

In recent years, plant biotechnology is rapidly developed, and research and improvement of crops are achieved by means of molecular biology and genetic engineering, so that the plant biological technology has good application prospects in agricultural production. Recent progress has been made in the field of apomictic studies by means of molecular biology and genetic engineering. At the end of 2018, davis division, university of California, USAVenkatesan SundaresanTeaching the apomictic system of rice published by teams; by editingPAIR1、REC8、OSD1 (MiMe) Three genes, binding ectopic expression in egg cellsBBM1(Synthetic-Apomic) Apomictic) rice apomixis was achieved. In early 2019, a rice apomixis system established by utilizing a gene editing technology published by Wang Kejian team is knocked out in Chunyou 84MiMeAndMTLfour endogenous genesApomixis can be achievedFix(Fixation of hybrids) material. The technical idea of achieving the goal of "one-line" rice breeding via the apomictic route has again attracted considerable attention from many scholars.

Disclosure of Invention

In view of the deficiencies of the prior art, it is an object of the present invention to provide a method for inducing apomixis to fix plant hybrid vigor. On the other hand, the invention also provides nucleic acid for killing egg cells, autoembryogenesis and screening marker expression and a genetic engineering intermediate, comprising an expression cassette, a recombinant vector and recombinant bacteria, and an identification method for judging whether plants adopt the method.

In order to solve the technical problems, the technical scheme of the invention is as follows:

in a first aspect, the invention provides a method of killing an egg cell and autoembryogenesis, comprising:

a method of fixing plant heterosis comprising the steps of:

A. constructing a lethal gene expression cassette E1 driven by an egg cell or embryo specific expression promoter;

B. constructing an embryogenic gene expression cassette E2 driven by a somatic cell specific expression promoter;

C. constructing a pollen inactivation gene expression cassette E3 driven by a pollen specific expression promoter;

D. and constructing a screening marker gene expression cassette E4.

E. Transferring the 4 linked expression cassettes into a receptor material, forming embryo by using the bead body cells of the heterozygous transgenic plant in the selfing and setting process, and combining sperm which does not carry the transgene with a central cell to form endosperm, so that seeds are developed; egg cells and sperm not carrying the transgene are normally fertilized and set; egg cells carrying the transgene are aborted and cannot participate in fertilization. And in the offspring seeds, the seeds with the markers are cloned seeds, and the cloned seeds and normal selfed seeds are sorted through screening the markers.

Preferably, the egg or embryo specific expression promoters include, but are not limited toAtDD45、Os03g0296600pro、ECA1-like1 pro、DCL2、AT1G74480.1、ZmEAlpromter, a lethal gene including but not limited tobarnase。

The saidAtDD45Promoters and methods of useOs03g0296600 The promoter sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, and the promoter sequences are shown as SEQ ID NO.1barnaseThe gene sequence is shown as SEQ ID NO. 3. Egg cells containing the expression cassette E1 described in A are lethal.

Preferably, the bead-coated somatic cell-specific expression promoters include, but are not limited toOs02g51090 pro、At-SVL3pro, the embryogenic genes include, but are not limited toBBM1、WUS、LEC、CLAVATA、MYB115。

The saidOs02g51090 Promoters and methods of useAt-SVL3proThe promoter sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, and the promoter sequences are shown in the specificationBBM1、WUSThe gene sequences are shown as SEQ ID NO.6 and SEQ ID NO. 7. Transgenic plant bead-donor cells containing the expression cassette E2 described in B can form embryos.

Preferably, the pollen-specific expression promoter includes, but is not limited toPG47The pollen inactivation genes include, but are not limited toZM-AA1. The saidPG47The promoter sequence is shown as SEQ ID NO.8, and the sequence is shown as SEQ ID NO. 9. Pollen containing the expression cassette E3 of C is inactivated.

Preferably, the promoters of the selectable marker gene expression cassette E4 include, but are not limited to, embryo-specific expression promoters and constitutive promoters. Said embryo specific expression promoterOsESP1The sequence is shown as SEQ ID NO. 10; the selectable marker genes include, but are not limited to, red fluorescent genesRPThe sequence is shown as SEQ ID NO. 11. A seed visible selectable marker comprising selectable marker gene expression cassette E4.

The invention also provides an expression cassette comprising a polynucleotide as described above operably linked to a heterologous polynucleotide of interest.

The invention also provides nucleic acids, which herein may be DNA, or RNA, preferably DNA.

The invention also provides a vector which comprises the expression cassette.

The present invention also provides a carrier for a solid support,comprises barnaseThe expression cassette for the gene,BBM1an embryogenic gene expression cassette comprising a sequence of the embryogenic gene,ZM- AA1the pollen inactivated gene expression cassette,RPscreening a marker gene expression cassette; the saidbarnaseIn the gene expression cassettebarnaseThe sequence of the gene is shown as SEQ ID NO.3, theBBM1Embryogenic gene expression cassettesBBM1The sequence of (2) is shown as SEQ ID NO.6, theZM-AA1Pollen inactivation gene expression cassetteZM-AA1The sequence is shown as SEQ ID NO.9, theRPIn the screening marker gene expression cassetteRPThe sequence of (C) is shown as SEQ ID NO. 11.

In another aspect, the nucleic acids of the invention may be constructed as expression cassettes inserted into any vector transformed into a cell. Primer pairs that amplify the full length or any fragment of the above-described nucleic acid fragments are also within the scope of the present invention. Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above-described nucleic acid fragments are also within the scope of the present invention. Preferred cells are plant cells, preferably rice cells, more preferably hybrid rice cells, and the nucleic acid of the invention may be introduced into the plant cells by transgenic techniques (as described in the embodiments of the invention), including into the nucleus, chloroplast, mitochondria and/or plastids of the plant cells, or by other techniques such that the nucleic acid of the invention is present in the plant cells.

The invention also provides a plant, wherein the plant cell comprises the expression cassette.

In another aspect, the invention provides a plant comprising the nucleic acid described above. As the nucleic acid is introduced, the plant provided by the invention can form asexual embryos in the cells of the bead quilt body. In this context, a plant refers to a single plant, plant group or propagation material thereof, including plants, plant varieties, plants, plant events, plant progeny, plant seeds or propagated parts of other plants, which are able to survive by synthesis of carbohydrates, proteins with water, carbon dioxide and inorganic salts, etc. by photosynthesis. The plant offspring itself is a plant, and includes plant offspring produced by transgenic technology, plant offspring produced by crossing with other plant varieties, and plant offspring produced by backcrossing or selfing.

An embodiment of the present invention also provides a plant comprising four nucleotides having sequences as shown in SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, and SEQ ID NO.11, respectively.

Preferably, the plant is a monocot or dicot plant, which is rice, maize, canola, millet, wheat, capsicum. In a specific embodiment of the present invention, the more preferred plant is rice, and more preferred is hybrid rice.

In another aspect, the invention provides the use of each of the aforementioned expression cassettes in the apomictic system. The lethal gene expression cassette E1 driven by the egg cell or embryo specific expression promoter can kill egg cells containing transgenic components; the embryogenic gene expression cassette E2 driven by the specific expression promoter of the bead-recipient cell can enable the bead-recipient cell to form asexual embryos; pollen inactivation gene expression cassette E3 driven by pollen specific expression promoter can inactivate pollen containing transgene component; screening marker gene expression cassette E4, the transgenic component-containing seeds can be provided with a screening marker for sorting. Cloned seeds can be used for fixation of heterosis.

In another aspect, the invention provides a method for identifying a propagule of the invention by determining whether the plant contains the 4 linked expression cassettes described above. By this method, it can be judged whether or not the plant belongs to the plant of the present invention. The steps of the assay may be performed by conventional nucleic acid detection and sequencing, exemplary methods include nucleic acid sequencing, polymerase Chain Reaction (PCR) detection, screening marker observation, fluorescent quantitative sorting, probe hybridization detection, sequencing, flow cytometry, and the like.

Compared with the prior art, the invention has the following beneficial effects:

the invention has the beneficial effects of inducing apomixis so as to fix plant hybrid vigour and solve the breeding problem of hybrid seeds. The method for fixing hybrid vigor of hybrid plants can eliminate complex seed production procedures of hybrid seeds, lighten labor intensity, reduce production cost of hybrid seeds and integrally improve benefits of hybrid seed industry. The lethal gene expression cassette driven by the egg cell specific expression promoter can kill egg cells containing exogenous genes, and egg cells without exogenous genes can be fertilized normally; the embryogenic gene expression cassette driven by the specific expression promoter of the bead-associated somatic cell can enable the bead-associated somatic cell of the transgenic plant to form an embryo; pollen inactivation gene expression cassette driven by pollen specific expression promoter can inactivate pollen containing exogenous gene, and pollen not containing exogenous gene can participate in normal fertilization; the selectable marker gene expression cassette can be used for sorting cloned seeds and normal pollinated fertilized seeds. The invention transfers the 4 closely linked gene expression cassettes into hybrid plants, so that the hybrid plants can produce clone seeds containing transgene components and zygotic embryo seeds without transgene components. Because the cloned seeds contain a screening marker, the cloned seeds containing the transgenic component and the zygotic embryo seeds without the transgenic component can be separated by photoelectric sorting, the cloned seeds can be used for propagation, and the zygotic embryo seeds can be used for commercial use. The invention has wide application and market prospect in the agricultural field.

Drawings

FIG. 1 is a schematic representation of the structure of the apomictic carrier p22AW of example 1 of the present invention;

FIG. 2 is a schematic view showing the structure of an apomictic vector p23OB in example 1 of the present invention;

fig. 3 is a technical roadmap of the apomictic system of the invention.

Detailed Description

The present invention will be described in detail with reference to examples. It should be noted that, without conflict, the embodiments of the present invention and features of the embodiments may be combined with each other.

Example 1

Construction of a rice expression vector carrying 4 linkage gene expression cassettes of an egg cell lethal gene, an embryogenesis gene, a pollen lethal gene and a fluorescence screening marker gene:

1. selection of specific promoters and genes of interest:

determination of 2 egg cell specific expression promoters by reference and web searchAtDD45ProAndOs03g0296600Prothe method comprises the steps of carrying out a first treatment on the surface of the Determination of ribonucleic acid hydrolase Gene of Bacillus amyloliquefaciensBarnaseIs a lethal gene; determination of 2 bead-driven cell-specific expression promotersOs02g51090ProAndAt-SVL3Prothe method comprises the steps of carrying out a first treatment on the surface of the Determination of 2 embryogenic genesWUSAndBBM1the method comprises the steps of carrying out a first treatment on the surface of the Determination of 1 embryo specific expression promoterOsESP1The method comprises the steps of carrying out a first treatment on the surface of the And determining the red fluorescent gene RP as a screening marker gene.

2. Construction of apomictic vector p22 AW:

will bepCAMBIA1300Transformation into double T-DNA vector, inSacThe left and right border sequences and the multiple cloning site 10MCS2 (the nucleotide sequence of which is shown in SEQ ID NO. 12) are inserted into the site II, and the RNase inhibitor gene is inserted into the 10MCSBarstarExpression cassette, RNase inhibitor geneBarstar(the nucleotide sequence of which is shown in SEQ ID NO. 13) carries an egg cell specific expression promoterAtDD45AndNosterminator (its nucleotide sequence is shown in SEQ ID NO. 14). In the expression vectorpCAMBIA1300Another T-DNA region was inserted into 4 expression cassettes: RNase gene for killing egg cellsBarnaseExpression cassette and embryogenic geneWUSGene expression cassette and pollen lethal amylase geneZM-AA1Expression cassette and fluorescent screening marker geneRPAn expression cassette.RNaseGeneBarnaseCarrying egg cell specific expression promoterAtDD45AndNosa terminator; embryogenic genesWUSSpecific expression promoter carrying beadOs02g51090ProAndNosa terminator; amylase geneZM-AA1Gene carried pollen late development specific expression promoterPG47Transporter peptide of maizeZM-BT1(the nucleotide sequence of which is shown in SEQ ID NO. 15) and a terminatorIN2-1(the nucleotide sequence of which is shown in SEQ ID NO. 16); carrier bodypLJ02Upper part of the cylinderRPCoding sequence carries embryo specific expression promoterOsESP1AndNosa terminator. The complete vector construction map is shown in figure 1.

3. Construction of apomictic vector p23 OB:

will bepCAMBIA1300Transformation into double T-DNA vector, inSacII site insertion of left and right border sequence and multiple cloning site 10MCS2, insertion of RNase inhibitor gene at 10MCSBarstarExpression cassette, RNase inhibitor geneBarstarCarrying egg cell specific expression promoterOs03g0296600AndNosa terminator. In the expression vectorpCAMBIA1300Another T-DNA region was inserted into 4 expression cassettes: RNase gene for killing egg cellsBarnaseExpression cassette and embryogenic geneBBM1Gene expression cassette and pollen lethal amylase geneZM-AA1Expression cassette and fluorescent screening marker geneRPAn expression cassette. RNase geneBarnaseCarrying egg cell specific expression promoterOs03g0296600 ProAndNosa terminator; embryogenic genesBBM1Specific expression promoter carrying beadAt-SVL3ProAndNosa terminator; amylase geneZM-AA1Gene carried pollen late development specific expression promoterPG47Transporter peptide of maizeZM-BT1TerminatorIN2-1The method comprises the steps of carrying out a first treatment on the surface of the Carrier bodypLJ02Upper part of the cylinderRPCoding sequence carries embryo specific expression promoterOsESP1AndNosa terminator. The complete vector construction map is shown in figure 2.

4. Recombinant plasmid transformation:

(1) Mixing 200 mu L of escherichia coli competent cells DH5a with 5 mu L of the connection product, and carrying out ice bath for 30 min;

(2) Rapidly placing in a constant-temperature water bath kettle at 42 ℃, carrying out heat shock for 90s, and carrying out ice bath for 2 min;

(3) Adding 500 mu L of LB liquid medium, and uniformly mixing;

(4) Culturing at 37deg.C and 200 rpm for 45 min to recover normal growth state of cells;

(5) Uniformly coating bacterial liquid on an LB solid culture medium plate;

(6) After 30 min, the mixture was incubated overnight in a 37℃incubator.

(7) Picking correct monoclonal bacteria, extracting plasmid and enzyme cutting to verify.

5. Obtaining recombinant bacteria:

transformation of Agrobacterium with Electroexcitation method to construct the correct plant expression vectorEHA105. The leading-in method adopts an electric excitation conversion method, and mainlyReference is made to the instructions for use of the shock meter from bio-rad company, comprising the following steps:

will be stored at-80 DEG CEHA105Competent cells were taken out and put on ice for freeze thawing, 1mm electric shock cups were put on ice for precooling, and the frozen SOC was placed at 37℃for thawing. Clean EP centrifuge tubes were pre-chilled by inserting them on ice, typically two more EP centrifuge tubes than the sample to be converted, one for negative control (no DNA added) and the other for positive control (1. Mu.l of 10 ng/. Mu.l pUC19 added). Respectively sucking 1 μl of DNA sample to be converted, placing into a precooled EP centrifuge tube, then taking 20 μl of melted EHA105 competent cells out lightly, placing into the bottom of the precooled centrifuge tube, mixing the two lightly, avoiding bubble generation as much as possible, avoiding contact of hands at the bottom of the centrifuge tube, avoiding influence of temperature change on competent conversion efficiency, and ensuring the operation process to be as fast as possible. Conversion parameters were set, resistance 200. OMEGA, capacitance 25. Mu.F, voltage 1800 and V, the cup specification 1mm, and the BioRad electro-laser instrument generally had recommended parameters. Gently sucking the mixture of competence and DNA, putting into an electric excitation cup, and tapping to uniformly distribute the mixture at the bottom of the cup. Placing the cover in an electric shock tank, closing the safety cover, pressing an electric shock red button, placing the preheated SOC at 37 ℃ in an electric shock cup after electric shock is completed, screwing up the mixture, transferring the mixture into a fungus shaking tube by using a suction head, and shaking at a constant temperature of 28 ℃ at 180rpm and 2 h. 50 μl of the bacterial liquid is coated on LB solid medium containing kanamycin (50 μg/mL) and rifampicin (25 μg/mL), 2 d is cultivated in dark at 28 ℃, single colony of agrobacterium transformant is picked up, inoculated on LB liquid medium added with the same antibiotic, and cultivated in shaking at 28 ℃ for 2 d. And adding an appropriate amount of bacterial liquid into an equal volume of sterile glycerol with the concentration of 50%, mixing, and preserving at the temperature of-80 ℃ for later use.

Example 2

Obtaining transgenic plants:

selecting egg cell lethal expression vector and embryogenesis expression vector and inoculating agrobacterium single colony containing 50mg/LkanamycinAfter 2 days of dark culture at 26℃on LB medium, the Agrobacterium cells were washed off with NB-AS liquid medium and cultured for 90-120 minutes at 28℃with 180rpm liquid shaking. Adjustment ofThe whole colony concentration is 0.8-1.0 to OD600, and can be used for transformation.

Respectively transforming hybrid rice, sterilizing hybrid rice seeds, selecting seeds with plump seeds, soaking in 75% alcohol for 30S, pouring out alcohol, washing with sterile water, and washing with HgCl ₂ Sterilizing for 8min, cleaning with sterile water for 2 times, soaking for 1min each time, and soaking with sterile water for 1 hr. The sterilized seeds were inoculated onto an induction medium and grown under light for 7d.

Sterile calli were pooled together. Soaking in Agrobacterium suspension for 5-10min, taking out, and air drying with filter paper. Inoculated to co-culture medium, co-cultured for 2 days, the co-cultured calli were washed 6 times and air-dried with filter paper and inoculated to hygromycin-resistant screening medium for 45d.

Transferring the resistant callus to a differentiation medium, culturing for 2 weeks, and then turning green to grow young buds and roots. Transferring the seedlings into small triangular flasks containing rooting medium, culturing one plant per flask under continuous illumination, hardening off the seedlings indoors when the plantlets grow to about 7-10 cm, and transplanting the plantlets into soil for growth after 3-4 d. Positive plants were screened by observation of fluorescence and PCR detection.

Example 3

Molecular detection of transgenic plants:

DNA extraction: 1.0g of the leaf blade was ground to powder with liquid nitrogen, transferred to a 2 ml EP tube and 700. Mu.l of preheated CTAB solution was added. Mixing gently in water bath at 65deg.C for 30-60 min, cooling, and adding equal volume of chloroform: isoamyl alcohol (24:1), mixing, centrifuging at 12000rpm for 10min, collecting supernatant, adding 500 μl isopropanol, and standing at-20deg.C for 30-60 min. The precipitate was collected at 12000rpm for 10min at 4℃and the supernatant was discarded. Washing the precipitate with 70% ethanol for 2 times, drying the ethanol residue, and drying 50-100 μl ddH ₂ O is dissolved and precipitated for standby.

PCR analysis: to be used forBarnaseThe gene is used as a template design primer, and the amplified product fragment is 308bp.

Forward primer F:

5'ATGGCACAGGTTATCAACACGTTTG 3'，

reverse primer:

R: 5'TGGTCCGTTGTTTTGTAAATCAGCC 3'。

PCR reaction system: DNA 30-90 ng, 10 XBuffer 2.0. Mu.l, 1mM dNTP 1.8. Mu.l, 25mM MgCl ₂ 1.5 Mu.l of each of the 10uM primers was 0.5. Mu.l, 1.5U of Tag enzyme, and ddH was added ₂ O to 20. Mu.l reaction volume. PCR circulation conditions were 94℃for 3 min;94 ℃, 1min, 64 ℃,1.5 min,72 ℃ 1.5 min,40 cycles; and extending at 72 ℃ for 5 min. Electrophoresis was performed on 1.4% agarose gel, and the electrophoresis results were recorded by photography.

Fluorescent quantitative analysis: RNA extraction was performed on T0 generation transgenic hybrid rice and wild hybrid rice controls using a total plant RNA extraction kit (Tiangen DP 432), methods referenced in the kit instructions. The total RNA is used as a template for reverse transcription to synthesize the corresponding cDNA. By using Actin as reference gene and wild plant as reference, RT-PCR method is usedBarnaseThe genes were subjected to quantitative PCR detection.

Southern blot analysis: the rice total DNA is taken for EcoRI digestion, electrophoresis and transferred to a nitrocellulose membrane Hybond-N. Labelling of the kit (Promega Co.) and [ alpha-32P Using random primers]dATP (Beijing Sehui Co.) random primer method for preparing alpha-32P markbarnaseThe gene fragment was used as a molecular probe for Southern hybridization analysis of transformed plants according to the molecular cloning method of Sambrook et al.

Example 4

Agronomic trait investigation of transgenic plants:

and (5) examining pollen fertility and fruiting conditions of the transgenic plants subjected to molecular identification. Anthers were taken at the time of flowering, and after staining with conventional I2-KI, the ratio of sterile pollen to viable pollen was observed. And compared with a wild type control, the agronomic properties such as plant height, tillering number, sword leaf length, fruiting rate, thousand seed weight and the like of the transgenic plant are observed.

Example 5

Apomixis propagation of hybrid rice:

the hybrid rice carrying the apomictic vector is selfed. Harvesting cloned seeds containing transgenic components and normal pollination fertilized seeds without transgenic components, sorting out red fluorescent seeds, namely the cloned seeds, by photoelectric sorting, and using the cloned seeds for propagation of hybrid seeds; non-transgenic hybrid seeds without red fluorescence are used commercially. The apomictic system is shown in figure 3.

The foregoing examples are set forth in order to provide a more thorough description of the present invention, and are not intended to limit the scope of the invention, since modifications of the invention in various equivalent forms will occur to those skilled in the art upon reading the present invention, and are within the scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> Hunan hybrid Rice research center

<120> a method for fixing plant hybrid vigor

<130> 1

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 1002

<212> DNA

<213> Synthesis

<400> 1

aaatgttcct cgctgacgta agaagacatt agtaatggtt ataatatata gctttctatg 60

aatgtatggt gagaaaatgt ctgttcactg attttgagtt tggaataaaa gcatttgcgt 120

ttggtttatc attgcgttta tacaaggaca gagatccact gagctggaat agcttaaaac 180

cattatcaga acaaaataaa ccattttttg ttaagaatca gagcatagta aacaacagaa 240

acaacctaag agaggtaact tgtccaagaa gatagctaat tatatctatt ttataaaagt 300

tatcatagtt tgtaagtcac aaaagatgca aataacagag aaactaggag acttgagaat 360

atacattctt gtatatttgt attcgagatt gtgaaaattt gaccataagt ttaaattctt 420

aaaaagatat atctgatcta gatgatggtt atagactgta attttaccac atgtttaatg 480

atggatagtg acacacatga cacatcgaca acactatagc atcttattta gattacaaca 540

tgaaattttt ctgtaataca tgtctttgta cataatttaa aagtaattcc taagaaatat 600

atttatacaa ggagtttaaa gaaaacatag cataaagttc aatgagtagt aaaaaccata 660

tacagtatat agcataaagt tcaatgagtt tattacaaaa gcattggttc actttctgta 720

acacgacgtt aaaccttcgt ctccaatagg agcgctactg attcaacatg ccaatatata 780

ctaaatacgt ttctacagtc aaatgcttta acgtttcatg attaagtgac tatttaccgt 840

caatcctttc ccattcctcc cactaatcca actttttaat tactcttaaa tcaccactaa 900

gcttcgaatc catccaaaac cacaatataa aaacagaact ctcgtaactc aatcatcgca 960

aaacaaaaca aaacaaaaca aaaaccccaa aaagaaagaa ta 1002

<210> 2

<211> 2078

<212> DNA

<213> Synthesis

<400> 2

tatacatggg agtctagtgc aatattactc atgttttgca aaagattgtg tcatttgggt 60

cttgatgagc tgaaccatgg attctaggca catttcagta tgtttcataa tgatgcttaa 120

tatgttgtgt tccacttgta caattatttt acaatacata cttttgtggt tataacttct 180

atattatctt taatgttgac aagaaaaagg aatatacagg tatgttgctg ttggagacga 240

atcatttctt ctcaaccatg ggcaacagaa tcaatctttt cttgtcagtg cagcagcaaa 300

tattcaacga gcattggttg atgcaaagtt atccaataaa atgaaagtag ttgtaccttg 360

tagctcagat gtatatctga acacatcggc tttgccttct aaagcttatt tcaggccaga 420

agttaacgag accatagctg agcttctctc tttccttgcc aatcatagct caccgtttat 480

ggttgagttg aatccctttt cgagctttca acataagaag aacctgtcat tggattacta 540

tcttttccaa ctaatgtcac atccagtaag tgatggccat atcaagtatg acaattactt 600

tgatgcaagc atagatgctc tggttacttc tctaactaaa gccggattca gtaacatgga 660

catcattgtt gggagagtag gatggccatc agatggagct gttaatgcta cacctgctat 720

tgcccaatcc ttcatgactg gcctggtcaa ccatctggca agaaaatctg ggactccact 780

acgtccgaaa gtgcctccaa ttgagacata tctcttcagc cttttagatg aagatcaacg 840

aagtatagcg agtggaagtt atgaaagaca ccacggcatt tttacctttg atggccaagc 900

aaagtattat gtcaacttgg gacaaggttc taaagctctg gagaatgctc ctgatgtgca 960

gtaccttccg tcaaaatggt gtgtgttgga taacaacaag gacatatcta atgtttcttc 1020

cagtttctct gcagcttgct ccaatgccga ctgcactgct ctgtcgcctg gtggctcctg 1080

ctcaggtatt ggctggcctg gtaatgtgtc atatgcgttc aacaacttct atcagcagca 1140

tgatcagagt gaggaaggct gcagcttcaa tggcctaggt ctgataacca ctgttgatcc 1200

atctgttgat aattgcatgt ttaatcttgc aattgacaca tctaccgctg cttccttcca 1260

tccaatattg gccatgttgc agatattagt tttgtttttc tgtacttaca atttattgtg 1320

atgtggctat ctatgaatgt atcacttctg atgtctttgg tccaaattgt gatggctcta 1380

tatgctctgt tccttttcaa ggaatggaat gatggatgaa tgttcacgtt cttgagttcc 1440

taaatggtac taattttgca aaaactttct atatgtgttt tttgttaaga atgttgtttt 1500

aaacccatct tttcacttta taatatttaa ttaaatcgtt cgtaccctcg aatagttatt 1560

gcaaattata cttaactatt cagtcattca gcacaaaaga acagggccat gaaattgtaa 1620

tactagtaca tttctgttct tttcttttct ttttgaggtt gtctgaaaca cctgtatctt 1680

aaactatcgc agactagcca atgagtcgta ctcacctgaa actgaaacca agtgattaac 1740

caagctggtt cgacagtaat tccatccata atgcagctcc ggagcccttc atatcctgca 1800

tgttactcaa acaacatccc cacctcctca tttcctctcc cctattgcat tgcataattg 1860

cagaagatta agccgctaat gcataattac acattatttg tgtccactaa ttttcccttt 1920

cccacacgct acgaaactca aaagccggcc tcctcgcctc cttccctgaa cgttactaat 1980

cgcgtcatgt ataaatacag agcttgccca cgcaccggca cattgcatcg cactacgcac 2040

atctacacga tacccaagca gcaaagctag aaagaaaa 2078

<210> 3

<211> 336

<212> DNA

<213> Synthesis

<400> 3

atggcacagg ttatcaacac gtttgacggg gttgcggatt atcttcagac atatcataag 60

ctacctgata attacattac aaaatcagaa gcacaagccc tcggctgggt ggcatcaaaa 120

gggaaccttg cagacgtcgc tccggggaaa agcatcggcg gagacatctt ctcaaacagg 180

gaaggcaaac tcccgggcaa aagcggacga acatggcgtg aagcggatat taactataca 240

tcaggcttca gaaattcaga ccggattctt tactcaagcg actggctgat ttacaaaaca 300

acggaccatt atcagacctt tacaaaaatc agataa 336

<210> 4

<211> 1808

<212> DNA

<213> Synthesis

<400> 4

tttccatcct atcgagatgt actactccac ttctgttctg tgcaggttga atatatgtgg 60

cccaatcaca tcttgccact aaaaatctta catttatcca tatactccac gaacagtaga 120

ttttactcat ccctgattag acccaaaaca atcatgagca cggtagacaa cacaagctta 180

gggcgtcttg cacgattagg tattgttcgg tttagagggg attgaagagg attagagggg 240

actgaggggt aataatttca caccataata ggtattgaat aaatcccctc taatcccttc 300

ctcatgagaa ttaaccgaac aagcccttac cccgctacac ccaaaaatgt ttccgctggg 360

gtgcaatact gctatcgatg gcttcttacg taggaatttc atttttctaa tattttttca 420

ttaaaaattg tacaaatatg acaaatctct tttataaaac aaaggtttct atagaaatta 480

tgcgagcaca tatgttcaca tatacacata tttcatattt atgactaatt atttttttca 540

acgacaccga caaatccgtc aataggcttt atttttcttt cacaaagccc gtaaacttcc 600

ataggagcct actacatcag tggcttcgtg ccgcactaac gaggcatcta tagtgattga 660

ctttatcaat gtaaaatatg acagccaaat attttgatgg gaggtgttca tggttatatg 720

tacgtttata ctccgtatga gtgagtagca ctccctccgt tctgagatat ttactagtac 780

tacgaatctg gaaatactct ttattcagat tcattgtact ataaaagtat ctcatatatc 840

caaaaatttt tatattttga gaccgagtga atatatgttt gtggttttcc tacatgtgag 900

tagagtgcat cagtggatat tagagcctcc acgatatggg aatagtatca gccagtgtgt 960

tgatgacgtc aaagctcaaa gggtagatga aaagttcatg cttcaaaaat ggcatgtctt 1020

ggaaactggg attttcctaa taatgagaaa tcctatgtgc agagaggaga caaaagcact 1080

gctcaacaca ctgcaggctg caaagatttg ctagtactac tactccagta cacaaacaca 1140

tcattggcca cttccctaat ctcatttaac gtttgcataa cgcactcatt ctgcggttac 1200

tgcattagct actcatgaat gtggctattt actagtagta caattctaag tgccattccc 1260

aggaggagtg agcagcttct ccacccttaa tcaggggcgg agctaattgg ttttggcgat 1320

caatctgcct cgtcgagtcg tcgttccgcc ctccacactt cccagttcgc gactgcgcca 1380

acgattgcgc gagcaccgct gccgcaactc aactcccgtg accgacggcg gcaatcggtg 1440

gccggcgagg cagcgatcag gatcagggta agtatatttc atctcctcct cctgtccttt 1500

ggccctccct tctctgatcc ctcccgtctt cattaagctc taatcctagg tactaaatta 1560

ctaatttgat tagtaagcgg ttaggccact agaacttgcg cccttgccga cggccaacac 1620

gacgctcgca ggccacaaga caaaagctga atgaagcacc ggcatcgcat gaactgatcg 1680

cattgtgttg gtaaattcta tacttctatg tcgacatatt acatttatag tgttaaagaa 1740

aatttatgtt cagttggacc atcctagcct aaaatcgtag ctacgccact gcccttaagc 1800

ccttgccc 1808

<210> 5

<211> 853

<212> DNA

<213> Synthesis

<400> 5

tggttctgct acatgcagat gatactatcc gttgttgaat ttgtcgatta gaattctttt 60

tggtgtacac aatgcggttg tcataacgcc ttaatagctt gtattagtca aagaactgca 120

tatggtcttg tgttttcttg tcatcgtgtt tttgtaacca caaactgttt tgagctatac 180

tactatatat attgagatat atctgccgtt tcgatacaca cttgggatct ggggatgagc 240

acatcgtaaa acaaaataga agttgatcct caaaacttct ttgtaacctt gtgtcatcac 300

aacaaaaaat cttcaatgtg tttgttctct ccttaaagta tatcttgatt catgcagtaa 360

caaaggcaaa actcttttgc aagagtatag aaaccagact caagctgtgc gatggtgatt 420

cttttggaga agttggattt gtgctctgat gtaaagggaa acttaagcta aaaggtccat 480

caatggaggt gacacatagt tttagaaaat gtgcttttct catgctagaa atgttatgga 540

gacccaaaaa tgcttttcgg aaaaaattct catgctagta gctaggctct acttaacgag 600

gtgacagcta aaataagttc tttttattcc attttcagaa tagtgacatt cttctcacaa 660

atatagaaaa actacaatta atgctactgc agagtctgat tacgttttaa gctaattttt 720

ccatttttag gacgtggtag attgtgtaga ttattgctaa acagctcatg agttcaataa 780

ttcacttatt cttcactcca tcttcagcaa aaaaaaaaaa agtaagaaga aacactgaaa 840

gctctccact acc 853

<210> 6

<211> 1680

<212> DNA

<213> Synthesis

<400> 6

atggcctcca tcaccaactg gctcggcttc tcctcctcct ccttctccgg cgccggcgcc 60

gaccccgtcc tgccccaccc gccgctgcaa gagtggggga gcgcttatga gggcggcggc 120

acggtggcgg ccgccggcgg ggaggagacg gcggcgccga agctggagga cttcctcggc 180

atgcaggtgc agcaggagac ggccgccgcg gcggcggggc acggccgtgg aggcagctcg 240

tcggtcgttg ggctgtccat gatcaagaac tggctacgca gccagccgcc gcccgcggtg 300

gttgggggag aagacgctat gatggcgctc gcggtgtcga cgtcggcgtc gccgccggtg 360

gacgcgacgg tgccggcctg catttcgccg gatgggatgg ggtcgaaggc ggccgacggc 420

ggcggcgcgg ccgaggcggc ggcggcggcg gcggcgcaga ggatgaaggc ggccatggac 480

acgttcgggc agcggacgtc catctaccgg ggtgtcacca agcacaggtg gacaggaagg 540

tatgaagccc atctttggga taacagctgc agaagagaag gtcagactcg caaaggcaga 600

caagtcaatg caggaggata tgataaggaa gaaaaagctg ctagggctta tgatttggct 660

gcccttaaat actggggcac tacaacgacg acgaattttc cggtaagcaa ctacgaaaaa 720

gagttggatg aaatgaagca catgaatagg caggaatttg ttgcatccct tagaagaaaa 780

agcagtggat tttcacgtgg tgcttccata tatcgtggtg ttacaagaca ccatcagcat 840

ggaaggtggc aagcaaggat aggacgggtg gcaggaaaca aggatctgta tttgggcaca 900

tttggcaccc aagaggaagc tgcagaggca tatgatatcg ctgcaatcaa attccgtggt 960

ctcaatgctg tgacaaactt tgacatgagc cggtacgatg tcaagagcat cattgaaagc 1020

agcaatctcc caattggtac tggaaccacc cggcgattga aggactcctc tgatcacact 1080

gataatgtca tggacatcaa tgtcaatacc gaacccaata atgtggtatc atcccacttc 1140

accaatgggg ttggcaacta tggttcgcag cattatggtt acaatggatg gtcgccaatt 1200

agcatgcagc cgatcccctc gcagtacgcc aacggccagc ccagggcatg gttgaaacaa 1260

gagcaggaca gctctgtggt tacagcggcg cagaacctgc acaatctaca tcattttagt 1320

tccttgggct acacccacaa cttcttccag caatctgatg ttccagacgt cacaggtttc 1380

gttgatgcgc cttcgaggtc cagtgactca tactccttca ggtacaatgg aacaaatggc 1440

tttcatggtc tcccgggtgg aatcagctat gctatgccgg ttgcgacagc ggtggaccaa 1500

ggtcagggca tccatggcta tggagaagat ggtgtggcag gcattgacac cacacatgac 1560

ctgtatggca gccgtaatgt gtactacctt tccgagggtt cgcttcttgc cgatgtcgaa 1620

aaagaaggcg actatggcca atctgtgggg ggcaacagct gggttttgcc gacaccgtag 1680

<210> 7

<211> 879

<212> DNA

<213> Synthesis

<400> 7

atggagccgc cacagcatca gcatcatcat catcaagccg accaagaaag cggcaacaac 60

aacaacaaca agtccggctc tggtggttac acgtgtcgcc agaccagcac gaggtggaca 120

ccgacgacgg agcaaatcaa aatcctcaaa gaactttact acaacaatgc aatccggtca 180

ccaacagccg atcagatcca gaagatcact gcaaggctga gacagttcgg aaagattgag 240

ggcaagaacg tcttttactg gttccagaac cataaggctc gtgagcgtca gaagaagaga 300

ttcaacggaa caaacatgac cacaccatct tcatcaccca actcggttat gatggcggct 360

aacgatcatt atcatcctct acttcaccat catcacggtg ttcccatgca gagacctgct 420

aattccgtca acgttaaact taaccaagac catcatctct atcatcataa caagccatat 480

cccagcttca ataacgggaa tttaaatcat gcaagctcag gtactgaatg tggtgttgtt 540

aatgcttcta atggctacat gagtagccat gtctatggat ctatggaaca agactgttct 600

atgaattaca acaacgtagg tggaggatgg gcaaacatgg atcatcatta ctcatctgca 660

ccttacaact tcttcgatag agcaaagcct ctgtttggtc tagaaggtca tcaagaagaa 720

gaagaatgtg gtggcgatgc ttatctggaa catcgacgta cgcttcctct cttccctatg 780

cacggtgaag atcacatcaa cggtggtagt ggtgccatct ggaagtatgg ccaatcggaa 840

gttcgccctt gcgcttctct tgagctacgt ctgaactag 879

<210> 8

<211> 2771

<212> DNA

<213> Synthesis

<400> 8

agcttgcatg cctgcaggtc gactctagag gatctgcacc ggacactgtc tggtggcata 60

cctgccggtc cggtgtgcca gatcagggca cccttcggtt cctttgctcc tttgcttttg 120

aaccctaact ttgatcgttt attggtttgt gttgaacctt tatgcacctg tggaatatat 180

aatctagaac aaactagtta gtccaatcat ttgtgttggg cattcaacca ccaaaattat 240

ttataggaaa aggttaaacc ttatttccct ttcaatctcc ccctttttgg tgattgatgc 300

caacacaaac caaagaaaat atataagtgc agaattgaac tagtttgcat aaggtaagtg 360

cataggttac ttagaattaa atcaatttat acttttactt gatatgcatg gttgctttct 420

tttattttaa cattttggac cacatttgca ccacttgttt tgttttttgc aaatcttttt 480

ggaaattctt tttcaaagtc ttttgcaaat agtcaaaggt atatgaataa gattgtaaga 540

agcattttca agatttgaaa tttctccccc tgtttcaaat gcttttcctt tgactaaaca 600

aaactccccc tgaataaaat tctcctctta gctttcaaga gggttttaaa tagatatcaa 660

ttggaaatat atttagatgc taattttgaa aatataccaa ttgaaaatca acataccaat 720

ttgaaattaa acataccaat ttaaaaaatt tcaaaaagtg gtggtgcggt ccttttgctt 780

tgggcttaat atttctcccc ctttggcatt aatcgccaaa aacggagact ttgtgagcca 840

tttatacttt ctccccattg gtaaatgaaa tatgagtgaa agattatacc aaatttggac 900

agtgatgcgg agtgacggcg aaggataaac gataccgtta gagtggagtg gaagccttgt 960

cttcgccgaa gactccattt ccctttcaat ctacgactta gcatagaaat acatttgaaa 1020

acacattagt cgtagccacg aaagagatat gatcaaaggt atacaaatga gctatgtgtg 1080

taatgtttca atcaaagttt cgagaatcaa gaatatttag ctcattccta agtttgctaa 1140

aggttttatc atctaatggt ttggtaaaga tatcgactaa ttgttctttg gtgctaacat 1200

aagcaatctc gatatcaccc ctttgttggt gatccctcaa aaagtgatac cgaatgtcta 1260

tgtgcttagt gcggctgtgt tcaacgggat tatccgccat gcagatagca ctctcattgt 1320

cacataggag agggactttg ctcaatttgt agccatagtc cctaaggttt tgcctcatcc 1380

aaagtaattg cacacaacaa tgtcctgcgg caatatactt ggcttcggcg gtagaaagag 1440

ctattgagtt ttgtttcttt gaagtccaag acaccaggga tctccctaga aactgacaag 1500

tccctgatgt gctcttccta tcaattttac accctgccca atcggcatct gaatatccta 1560

ttaaatcaaa ggtggatccc ttggggtacc aaagaccaaa tttaggagtg taaactaaat 1620

atctcatgat tcttttcacg gccctaaggt gaacttcctt aggatcggct tggaatcttg 1680

cacacatgca tatagaaagc atactatctg gtcgagatgc acataaatag agtaaagatc 1740

ctatcatcga ccggtatacc ttttggtcta cggatttacc tcccgtgtcg aggtcgagat 1800

gcccattagt tcccatgggt gtcctgatgg gcttggcatc cttcattcca aacttgttga 1860

gtatgtcttg aatgtacttt gtttggctga tgaaggtgcc atcttggagt tgcttgactt 1920

gaaatcctag aaaatatttc aacttcccca tcatagacat ctcgattttc ggaatcatga 1980

tcctactaaa ctcttcacaa gtagatttgt tagtagaccc aaatataata tcatcaacat 2040

aaatttggca tacaaacaaa acttttgaaa tggttttagt aaagagagta ggatcggctt 2100

tactgactct gaagccatta gtgataagaa aatctcttag gcattcatac catgctgttg 2160

gggcttgctt gagcccataa agcgcctttg agagtttata aacatggtta gggtactcac 2220

tatcttcaaa gccgagaggt tgctcaacat agacctattc accccatttg atcacttttt 2280

tggtccttca ggatctaata gttatgtata atttagagtc tcttgtttaa tggccagata 2340

tttctaatta atctaagaat ttatgatatt ttttaatttt ttatcatgtc tgatgagaat 2400

taacataaag gctcaattgg gtcctgaatt aataatagag tgaaaattaa tccagaggct 2460

ctattagaac cttcaattag taataccaag atatatataa gatagtagag tatagtttaa 2520

atgttggcat tgttcattct ttcttttgtt atttaattta tgctttccac ggtggttagt 2580

ggttacttct gaagggtcca aataatgcat gaagagtttg aggacaagaa gtctgcccta 2640

aaaatagcga tgcaaaggca tggtgtccaa gccatacata tagcgcacta attttatcag 2700

cagaacaatg gtatttatag gtcctagtgc ccaggcaaca agagacacga ataaagcatc 2760

gatcacgaca c 2771

<210> 9

<211> 1561

<212> DNA

<213> Synthesis

<400> 9

atggcggcga caatggcagt gacgacgatg gtgacgagga gcaaggagag ctggtcgtca 60

ttccaggtcc cggcggtggc attcccttgg aagccacgag gtggcaagac cggcggcctc 120

gagttccctc gccgggcgat gttcgccagc gtcggcctca acgtgtgccc gggcgtcccg 180

gcggggcgcg acccgcggga gcccgatccc aaggtcgtcc gggcggcctg cggcctgctc 240

caggcacaag tcctcttcca ggggtttaac tgggagtcgt gcaagcagca gggaggctgg 300

tacaacaggc tcaaggccca ggtcgacgac atcgccaagg ccggcgtcac gcacgtctgg 360

ctgcctccac cctcgcactc cgtctcgcca caaggctaca tgccaggccg cctatacgac 420

ctggacgcgt ccaagtacgg cacggcggcg gagctcaagt ccctgatagc ggcgttccac 480

ggcaggggcg tgcagtgcgt ggcggacatc gtcatcaacc accggtgcgc ggaaaagaag 540

gacgcgcgcg gcgtgtactg catcttcgag ggcgggactc ccgacgaccg cctggactgg 600

ggccccggga tgatctgcag cgacgacacg cagtactcgg acgggacggg gcaccgcgac 660

acgggcgagg ggttcgcggc ggcgcccgac atcgaccacc tcaacccgcg cgtgcagcgg 720

gagctctccg cctggctcaa ctggctcagg tccgacgccg tggggttcga cggctggcgc 780

ctcgacttcg ccaagggcta ctcgccggcc gtcgccagaa tgtacgtgga gagcacgggg 840

ccgccgagct tcgtcgtcgc ggagatatgg aactcgctga gctacagcgg ggacggcaag 900

ccggcgccca accaggacca gtgccggcag gagctgctgg actggacgcg ggccgtcggc 960

gggcccgcca tggcgttcga cttccccacc aagggcctgc tgcaggcggg cgtgcagggg 1020

gagctgtggc ggctgcgcga cagctccggc aacgcggccg gcctgatcgg gtgggcgccc 1080

gagaaggccg tcaccttcgt cgacaaccat gacaccgggt cgacgcagaa gctctggccg 1140

ttcccatccg acaaggtcat gcagggctac gcctacatcc tcacccatcc aggagtcccc 1200

tgcattttct acgaccacat gttcgactgg aacctgaagc aggagatatc cacgctgtct 1260

gccatcaggg cgcggaacgg caaccgcgcc gggagcaagc tgcggatcct cgtggcggac 1320

gcggacgcgt acgtggccgt cgtcgacgag aaggtcatgg tgaagatcgg gacaaggtac 1380

ggcgtgagca gcgtggtccc gtcggatttc cacccggcgg cgcacggcaa ggactactgc 1440

gtctgggaga aagcgagcct ccgcgtcccg gcggggcgcc acctctagca gctcagattg 1500

ctcagtcttg tgctgcattg caaacacagc agcacgacac tgcataacgt cttttccttg 1560

a 1561

<210> 10

<211> 1439

<212> DNA

<213> Synthesis

<400> 10

agagggcaga gaaagaatgc ttgtggttca tttcttatct tcaagcacta tccctgaaga 60

aaagacagat atacataagg aaatgattaa tatgagcata gaatgcttgc agttcaattt 120

cttatcttca agcactgccc cagaagaata gacaggtgaa cataaggaaa tgattaatat 180

gaacatactg aacaaacaaa atcgcaataa ggatggatac cttgagtaaa gattgaagaa 240

tatccatggt gctctggttt ccatcgtaac ctttccgctt ttgcagtttt cactgtggta 300

attagatttg tttagaaaca ggaagaataa tgtgtttgcc agtgagatct ttcaatttat 360

tgcaccaaaa ctgatgagga cagtcaacta cctagcagtc atgtactgtt ggtatgacac 420

caaactggcc aaacatcttt atctcaatag cgctatatat agctaaaact gatgactttt 480

tcatcttttc tcctcatcaa ttatactatc actttccaag ttagggaaat gacaccattc 540

ggctggaaag ctattgtttt gatcaacgtg gacttgctat gaccagtgat ttactttcat 600

ccctggcatg ctgataatgt catgaataaa acgacaaaaa gtacatgcat actgaaataa 660

ggagggattt cctctggaat aggaaaaccg caaagaggaa caatatatgg tgttaacaag 720

ggatttgtca ctattgggaa gaataattgg ccaattttag catcttaggc atttcattcc 780

aatcactata aggcaggaaa aggcacaagc ggaccatttt tttactggat aggcagatca 840

attctttctt tctttctgag acatttgcat ccaaaaagcc caacatggca tgtaccattg 900

acttgatata gtgagaaact ggcctaacaa ttttacctgg tcagaatttt agttcatggc 960

ccaacattag cagcttttat taaaatggag catatcatga atgaataaca catgatggta 1020

aattactagc acgagaaagc attgggaaaa aaatcacacc aaagcaacca atctatgcat 1080

ctaatgcaaa tttccacaat cttcagagat gcaaaacatg cattatcgaa ttatatgcta 1140

tgttccatcc cactcgaatg cgaagttttc catgctaaaa ttgaaagaaa tgcgttaaaa 1200

caagagaaac gacaattgct gacttggtgg caattgtggc atactcgtag aaaaaaatgt 1260

tttatctgat ataaataaaa gaacatggga aatctggtgt ttgatagtag ttttggtaaa 1320

tacacactaa gctgttaggc ctggtaattt tgatagtgca gcatcaccta aatctgaact 1380

gatctttaag cataaactag ggtgtgcatt ctttgctcag ctgtccttgt aattccata 1439

<210> 11

<211> 678

<212> DNA

<213> Synthesis

<400> 11

atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60

accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240

gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360

aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420

atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480

acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540

tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660

caccacctgt tcctgtag 678

<210> 12

<211> 98

<212> DNA

<213> Synthesis

<400> 12

tccccgcggg gatggcagga tatattgtgg tgtaaacaag gcgcgcctcc ttaattaagg 60

tgacaggata tattggcggg taaacctccc cgcgggga 98

<210> 13

<211> 273

<212> DNA

<213> Synthesis

<400> 13

atgaaaaaag cagtcattaa cggggaacaa atcagaagta tcagcgacct ccaccagaca 60

ttgaaaaagg agcttgccct tccggaatac tacggtgaaa acctggacgc tttatgggat 120

tgtctgaccg gatgggtgga gtacccgctc gttttggaat ggaggcagtt tgaacaaagc 180

aagcagctga ctgaaaatgg cgccgagagt gtgcttcagg ttttccgtga agcgaaagcg 240

gaaggctgcg acatcaccat catactttct taa 273

<210> 14

<211> 278

<212> DNA

<213> Synthesis

<400> 14

ggtgaccagc tcgaatttcc ccgatcgttc aaacatttgg caataaagtt tcttaagatt 60

gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt acgttaagca 120

tgtaataatt aacatgtaat gcatgacgtt atttatgaga tgggttttta tgattagagt 180

cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa actaggataa 240

attatcgcgc gcggtgtcat ctatgttact agatcggg 278

<210> 15

<211> 225

<212> DNA

<213> Synthesis

<400> 15

atggcggcga caatggcagt gacgacgatg gtgacgagga gcaaggagag ctggtcgtca 60

ttgcaggtcc cggcggtggc attcccttgg aagccacgag gtggcaagac cggcggcctc 120

gagttccctc gccgggcgat gttcgccagc gtcggcctca acgtgtgccc gggcgtcccg 180

gcggggcgcg acccgcggga gcccgatccc aaggtcgtcc gggcg 225

<210> 16

<211> 348

<212> DNA

<213> Synthesis

<400> 16

gatctgacaa agcagcatta gtccgttgat cggtggaaga ccactcgtca gtgttgagtt 60

gaatgtttga tcaataaaat acggcaatgc tgtaagggtt gttttttatg ccattgataa 120

tacactgtac tgttcagttg ttgaactcta tttcttagcc atgccaagtg cttttcttat 180

tttgaataac attacagcaa aaagttgaaa gacaaaaaaa aaaacccccg aacagagtgc 240

tttgggtccc aagctacttt agactgtgtt cggcgttccc cctaaatttc tccccctata 300

tctcactcac ttgtcacatc agcgttctct ttcccctata tctccacg 348

Claims (4)

1. A method for fixing rice heterosis, comprising the steps of:

A. constructing a lethal gene expression cassette E1 driven by an egg cell or embryo specific expression promoter;

B. constructing an embryogenic gene expression cassette E2 driven by a somatic cell specific expression promoter;

C. constructing a pollen inactivation gene expression cassette E3 driven by a pollen specific expression promoter;

D. constructing a screening marker gene expression cassette E4;

E. transferring the 4 linked expression cassettes into a receptor material, forming embryo by using the bead body cells of the heterozygous transgenic plant in the selfing and setting process, and combining sperm which does not carry the transgene with a central cell to form endosperm, so that seeds are developed; egg cells and sperm not carrying the transgene are normally fertilized and set; the egg cells carrying the transgenes are aborted and cannot participate in fertilization, and the seeds with markers in offspring seeds are cloned seeds, and the cloned seeds and normal selfing seeds are sorted through screening markers;

wherein the egg cell or embryo specific expression promoter isAtDD45ProOr (b)Os03g0296600ProThe terminator is a Nos; lethal gene isBarnaseThe method comprises the steps of carrying out a first treatment on the surface of the The specific expression promoter of the bead-quilt peer cell isOs02g51090ProOr (b)At-SVL3ProThe terminator is a Nos; embryogenic genesWUSOr (b)BBM1The method comprises the steps of carrying out a first treatment on the surface of the The pollen specific expression promoter isPG47The terminator is IN2-1; pollen inactivating geneZM-AA1The method comprises the steps of carrying out a first treatment on the surface of the The promoter for expression of the screening marker gene is OsESP1, and the terminator is Nos.

2. An expression cassette, wherein said expression cassette is a linked expression cassette of the E1, E2, E3 and E4 expression cassettes of claim 1.

3. The method of claim 1, wherein the method of integrating the expression cassette of claim 2 into a recipient material includes, but is not limited to, transgenic technology.

4. A carrier comprisingbarnaseThe expression cassette for the gene,BBM1an embryogenic gene expression cassette comprising a sequence of the embryogenic gene,ZM-AA1the pollen inactivated gene expression cassette,RPscreening a marker gene expression cassette; the saidbarnaseGene listIn the boxbarnaseThe sequence of the gene is shown as SEQ ID NO.3, theBBM1Embryogenic gene expression cassettesBBM1The sequence of (2) is shown as SEQ ID NO.6, theZM-AA1Pollen inactivation gene expression cassetteZM-AA1The sequence is shown as SEQ ID NO.9, theRPIn the screening marker gene expression cassetteRPThe sequence of (C) is shown as SEQ ID NO. 11.

Images