CN107475174B

CN107475174B - Method for transforming rape

Info

Publication number: CN107475174B
Application number: CN201710702150.0A
Authority: CN
Inventors: 刘雁华; 李运亭; 贾志伟; 宋庆芳
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2017-08-16
Filing date: 2017-08-16
Publication date: 2020-08-28
Anticipated expiration: 2037-08-16
Also published as: CN107475174A

Abstract

The invention relates to a method for transforming rape, which comprises the steps of obtaining hypocotyl or cutting the hypocotyl after rape seeds germinate; infecting said hypocotyls or a cut thereof with an agrobacterium strain; performing callus induction culture on the infected hypocotyl or the cut segment thereof; selecting and culturing the rape callus by using a selective agent, and performing bud differentiation culture on the screened rape resistant callus on a ZT-containing differentiation culture medium; the seedlings of rape grown from said sprouts are cultured in turn on a first rooting medium containing cytokinins and auxins and a second rooting medium not containing any hormones. The invention has high callus induction rate, high bud differentiation rate, easy rooting, high plant survival rate and high transformation efficiency up to 8 percent.

Description

Method for transforming rape

Technical Field

The invention relates to a plant transformation method, in particular to a rape transformation and cultivation method.

Background

The rape is Brassica plant of brassicaceae and is divided into 3 cultivars of cabbage type (Brassica rapa L.), mustard type (Brassica juncea L.) and cabbage type (Brassica napu L.), wherein the cabbage type rape is the most extensive in planting area in the world, the mustard type is the second most, and the cabbage type is the least. At present, rape is one of four oil crops and is a transgenic crop with the fourth largest global planting area, and the planting area of the global transgenic rape accounts for 23 percent of the total global rape planting area in 2010, and reaches 700 ten thousand hm²And increased year by year. Since Ooms et al first used Agrobacterium tumefaciens mediated method to obtain transgenic rape in 1985, rape transgenic research has made breakthrough progress in many aspects such as disease resistance, insect resistance, herbicide tolerance, male sterility, protein component improvement, etc.

A good receptor system is an important link of rape genetic transformation, and is related to the problems of providing a receptor material suitable for transformation, whether the transformed cells can be regenerated into normal plants and the like. To date, recipient materials suitable for oilseed rape transformation include hypocotyls, cotyledonary stalks, stem segments, protoplasts, microspores, and the like. Meanwhile, the genetic transformation methods of rape mainly include an agrobacterium-mediated method, a gene gun bombardment method, an electric shock method, a PEG method, a pollen tube channel method and the like, wherein the agrobacterium-mediated method and the gene gun bombardment method are currently common transgenic methods.

The earliest Ooms et al (Ooms G, et al. Theor Appl Genet,1985,71:325-329) and Fry (Fry J, et al. plant Cell Rep,1987,6:321-325) established Agrobacterium tumefaciens-mediated transformation systems with the stem segment and the flower stem of sterile seedlings, respectively, but the transformation efficiency was not high. Moloney et al established an efficient Agrobacterium tumefaciens mediated transformation system for the first time in 1989 by using cotyledonary petioles of a cabbage type spring rape variety "wistar", with transformation efficiency of 55% (Moloney, et al 1989.plant Cell Rep.8:238-242), but the regenerated plant obtained therefrom is likely to be a chimera, and the genotype may also be heterozygous. Subsequent studies in various countries have shown that "wistar" is indeed easy to transform, but the high-efficiency rape transformation system of Moloney et al has low repeatability (Guo schland, Wang Hanzhong, China oil crop academic newspaper, 1999, 21(3):1-5), and most of the studies reported at present have transformation efficiency of not more than 1%.

Hypocotyls are also commonly used receptors for brassica napus transformation. Radke et al found that the transformation efficiency was about 2.5% when the hypocotyl of Brassica napus "wistar" was transformed as an explant (Radke SE, et. Theor. appl. Genet.1988,75: 685-694.). The current widely used hypocotyl transformation procedure is based mainly on the method established by De Block et al (De Block M, et al plant Physiol,1989,91: 694-. However, such methods also have certain drawbacks: the hypocotyl is difficult to directly regenerate adventitious buds from the incision, the hypocotyl needs to be induced by a callus stage, and the hypocotyl is difficult to root and low in transformation efficiency; meanwhile, genetic transformation of winter rape also has the problem of explant browning, which seriously affects subsequent regeneration and transformation.

Transformation of protoplasts is directed against individual plant cells, rather than multicellular tissues and organs, and can avoid chimera formation. The PEG method was used by Zhendong et al, 1994, to introduce the GUS gene into the protoplast of Brassica napus cultivar "Yunbei No. two" (Zhendong, Wei Shi Ming, xu Zhi Macro, 1994. report of Experimental biology, 37(3): 341-. However, this transformation method is affected by many factors, such as the pH of PEG, the suspension composition of protoplasts, the time of addition of exogenous DNA, the time of antibiotic selection, and the genotype of the transformed variety and the regeneration ability of protoplasts. Since protoplasts are damaged by the transformation treatment, the speed of cell division is greatly reduced, the repeatability of the experiment is poor, and the transformation efficiency is low.

The isolated microspores can also be used as recipients for the introduction of foreign DNA (Chenjun et al, journal of laser biology 1998, 7(2): 103-. 107). Experiments show that the activity of microspores is influenced after the sucrose concentration is reduced in the micro-beam laser puncturing process, and the time from micro-beam laser puncturing to cultivation at 32 ℃ needs more than 2 hours, so that the cultivation is adversely affected. The microspore embryos which have already been split are treated by microbeam laser, and the transformation efficiency is only 1 percent. The transformation system not only requires the microspores of rape varieties to have high embryoid embryogenesis rate, namely serious genotype dependence exists, but also has other adverse factors which can cause the reduction of regeneration frequency and transformation efficiency. Agrobacterium tumefaciens-mediated microspore transformation (Wangxin et al, report of botany, 2005, 22(3): 292-. The culture and screening process for embryo induction requires the use of antibiotics, which are also detrimental to microspore embryo growth. Moreover, microspore culture can be carried out only in the flowering phase, the period is long, and transgenic seeds cannot be obtained in the current year. The transplantation, vernalization, over-summer and fructification of the transgenic plant plantlets all need to manually control the temperature/humidity, and consume a large amount of electric power and manpower.

In conclusion, the tissue culture-based genetic transformation of brassica napus mainly uses agrobacterium tumefaciens as a biological medium to mediate the transformation of exogenous DNA. The transformation method utilizes cotyledon petioles and hypocotyls germinating for 4-12 days, or protoplasts of young tissues, or free microspores, to be co-cultured with agrobacterium tumefaciens with a binary vector, and then to screen for regenerated organs or embryoids capable of expressing a reporter gene (mostly an antibiotic resistance gene). The growth of Agrobacterium needs to be inhibited continuously during regeneration after co-cultivation, and as a result, the regeneration efficiency is greatly reduced. In addition, the genotype, developmental stage, sensitivity to Agrobacterium, and regeneration conditions and frequency of explants can all affect transformation efficiency. The period from collection of explants to acquisition of transformed plants is long, agrobacterium tumefaciens is required to have high activity, strict aseptic operation, a culture medium suitable for transformation and regeneration, antibiotics are added into the culture medium, a climatic chamber and culture conditions are suitable, the culture medium needs to be continuously replaced by fresh culture medium, and the like. In practice, the problems that tissue culture seedlings are difficult to cross summer, and can bloom and fruit only by meeting the vernalization process first are also encountered.

Disclosure of Invention

The invention aims to provide a method for transforming rape, which effectively overcomes the technical defects of low callus induction rate, difficult bud point differentiation, difficult rooting of transformed seedlings, high transplanting and detecting cost and the like of rape transformation in the prior art.

In order to achieve the above object, the present invention provides a method for inducing callus of rape, comprising culturing an explant of rape on a callus induction medium containing auxin;

preferably, the auxin is 2, 4-D;

preferably, the concentration of the 2,4-D is 0.1-7 mg/L;

preferably, the concentration of the 2,4-D is 5 mg/L;

preferably, the oilseed rape explant is an hypocotyl of oilseed rape or a cut thereof.

Further, the callus induction medium also comprises cytokinin;

preferably, the cytokinin is 6-BAP;

preferably, the concentration of 6-BAP is 0.01-1 mg/L;

preferably, the concentration of 6-BAP is 0.03 mg/L.

Still further, the callus induction medium comprises MES, sucrose, 2,4-D, carbenicillin, timentin, silver nitrate, 6-BAP, proline and aspartic acid;

preferably, the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, the concentration of 2,4-D is 0.1-7mg/L, the concentration of carbenicillin is 50-300mg/L, the concentration of timentin is 20-500mg/L, the concentration of silver nitrate is 1-10mg/L, the concentration of 6-BAP is 0.01-1mg/L, the concentration of proline is 50-200mg/L, and the concentration of aspartic acid is 50-200 mg/L;

preferably, the callus induction medium comprises 4.0g/L MS salt or 3.95g/L N6 salt or 3.1g/L, B5 vitamin B5 salt, 1g/L MES, 30g/L sucrose, 2,4-D5mg/L agar, 8g/L agar, 150mg/L carbenicillin, 150mg/L timentin, 3mg/L silver nitrate, 0.03 mg/L6-BAP, 100mg/L proline and 100mg/L aspartic acid.

In order to achieve the above object, the present invention also provides a method for differentiating rape buds, comprising culturing rape resistant callus on a differentiation medium containing ZT;

preferably, the concentration of ZT is 0.1-5 mg/L;

preferably, the concentration of ZT is 1 mg/L.

Further, the differentiation medium comprises MES, sucrose, ZT, NAA, carbenicillin, timentin, silver nitrate, glutamic acid, aspartic acid and a selective agent;

preferably, the selective agent is glyphosate;

preferably, the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, the concentration of ZT is 0.1-5mg/L, the concentration of NAA is 0.01-1mg/L, the concentration of carbenicillin is 50-300mg/L, the concentration of timentin is 20-500mg/L, the concentration of silver nitrate is 1-10mg/L, the concentration of glutamic acid is 50-200mg/L, the concentration of aspartic acid is 50-200mg/L, and the concentration of glyphosate is 0.1-20 mg/L;

preferably, the differentiation medium comprises 4.3g/L MS salt or 3.95g/L N6 salt or 3.1g/L, B5 vitamin B5 salt, 1g/L MES, 30g/L, ZT1mg/L, NAA 0.5.5 mg/L sucrose, 8g/L agar, 150mg/L carbenicillin, 150mg/L timentin, 3mg/L silver nitrate, 100mg/L glutamic acid, 100mg/L aspartic acid and 8.5mg/L glyphosate.

In order to achieve the above object, the present invention also provides a method for rooting rape, comprising the steps of sequentially culturing rape seedlings on a first rooting culture medium containing cytokinin and auxin and a second rooting culture medium not containing any hormone;

preferably, the auxin is IBA;

preferably, the concentration of IBA is 0.01-1 mg/L;

preferably, the concentration of IBA is 0.25 mg/L;

preferably, the cytokinin is ZT;

preferably, the concentration of ZT is 0.1-5 mg/L;

preferably, the concentration of ZT is 1 mg/L;

preferably, the rape resistant plantlets are cultured for 5-7 days on a first rooting medium containing cytokinins and auxins, and then rooted on a second rooting medium not containing any hormones.

Further, the first root growth medium comprises MES, sucrose, ZT, IBA and cephamycin;

preferably, the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, the concentration of ZT is 0.1-5mg/L, the concentration of IBA is 0.01-1mg/L, and the concentration of cefuroxime is 50-300 mg/L;

preferably, the first rooting medium comprises 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT1mg/L, IBA0.25mg/L, agar 8g/L and cefamycin 150 mg/L.

Still further, the second rooting medium comprises MES, sucrose and cefuroxime;

preferably, the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, and the concentration of cefuroxime is 50-300 mg/L;

preferably, the second rooting medium comprises 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, agar 8g/L and cefamycin 150 mg/L.

In order to achieve the above object, the present invention also provides a method for transforming oilseed rape, comprising:

germinating rape seeds to obtain hypocotyls or cutting the hypocotyls;

infecting said hypocotyls or a cut thereof with an agrobacterium strain;

performing callus induction culture on the infected hypocotyl or the cut segment thereof;

selecting and culturing the rape callus by using a selective agent, and performing bud differentiation culture on the screened rape resistant callus on a ZT-containing differentiation culture medium;

the seedlings of rape grown from said sprouts are cultured in turn on a first rooting medium containing cytokinins and auxins and a second rooting medium not containing any hormones.

The callus induction culture of the infected hypocotyl or the cut segment thereof is specifically to perform callus induction culture of the infected hypocotyl or the cut segment thereof on a callus induction culture medium containing auxin;

preferably, the auxin is 2, 4-D;

preferably, the concentration of the 2,4-D is 0.1-7 mg/L;

preferably, the concentration of 2,4-D is 5 mg/L.

Further, the callus induction medium also comprises cytokinin;

preferably, the cytokinin is 6-BAP;

preferably, the concentration of 6-BAP is 0.01-1 mg/L;

preferably, the concentration of 6-BAP is 0.03 mg/L.

Further, the concentration of ZT is 0.1-5 mg/L;

preferably, the concentration of ZT is 1 mg/L.

Still further, the differentiation medium comprises MES, sucrose, ZT, NAA, carbenicillin, timentin, silver nitrate, glutamic acid, aspartic acid, and a selective agent;

preferably, the selective agent is glyphosate;

Further, the auxin is IBA;

preferably, the concentration of IBA is 0.01-1 mg/L;

preferably, the concentration of IBA is 0.25 mg/L;

preferably, the cytokinin is ZT;

preferably, the concentration of ZT is 0.1-5 mg/L;

preferably, the concentration of ZT is 1 mg/L;

preferably, the plantlets of canola are cultured for 5-7 days on a first rooting medium containing cytokinins and auxins, and then rooted on a second rooting medium not containing any hormones.

Still further, the first root growth medium comprises MES, sucrose, ZT, IBA, and cephamycin;

The second rooting culture medium comprises MES, sucrose and cefuroxime axetil;

To achieve the above objects, the present invention also provides a method for producing a transgenic canola plant, comprising:

germinating rape seeds to obtain hypocotyls or cutting the hypocotyls;

infecting said hypocotyls or a cut thereof with an agrobacterium strain;

screening and culturing by using a selection agent and selecting the transformed rape resistant callus;

carrying out bud differentiation culture on the rape resistant callus on a differentiation culture medium containing ZT;

the seedlings of rape from said sprouts are cultured in sequence on a first rooting medium containing cytokinins and auxins and a second rooting medium not containing any hormones to obtain transgenic rape plants.

preferably, the auxin is 2, 4-D;

preferably, the concentration of the 2,4-D is 0.1-7 mg/L;

preferably, the concentration of 2,4-D is 5 mg/L.

Further, the callus induction medium also comprises cytokinin;

preferably, the cytokinin is 6-BAP;

preferably, the concentration of 6-BAP is 0.01-1 mg/L;

preferably, the concentration of 6-BAP is 0.03 mg/L.

Further, the concentration of ZT is 0.1-5 mg/L;

preferably, the concentration of ZT is 1 mg/L.

preferably, the selective agent is glyphosate;

Further, the auxin is IBA;

preferably, the concentration of IBA is 0.01-1 mg/L;

preferably, the concentration of IBA is 0.25 mg/L;

preferably, the cytokinin is ZT;

preferably, the concentration of ZT is 0.1-5 mg/L;

preferably, the concentration of ZT is 1 mg/L;

The second rooting culture medium comprises MES, sucrose and cefuroxime axetil;

The cloned genes, expression cassettes, vectors (e.g., plasmids), proteins and protein fragments, and transformed nuclear plants of the invention can be produced using standard methods.

The present invention can be used to express any gene of interest in canola plants. The gene of interest may be a herbicide-tolerant gene, a disease-resistant gene, or an insect-resistant gene, or a selection or evaluation marker, and contains a promoter, coding region, and terminator region operable for plants. Herbicide tolerance genes include AHAS genes tolerant to imidazolinone or sulfonylurea herbicides, PAT or bar genes tolerant to glufosinate herbicides, EPSPS genes tolerant to glyphosate herbicides, and the like. The disease-resistant gene includes antibiotic synthetase genes such as nitropyrrolidin synthetase gene, plant-derived resistance gene, and the like. The insect-resistant gene comprises a bacillus thuringiensis insecticidal gene. The gene of interest may also encode an enzyme associated with a biochemical pathway, the expression of which may alter traits important in food, feed, nutraceutical, and/or pharmaceutical production. The gene of interest may be located on a plasmid. Plasmids suitable for use in the present invention may contain more than one gene of interest and/or the Agrobacterium may contain different plasmids with different genes of interest.

The term "oilseed rape" as used herein refers to Brassica napus, which is based on the transfer of an Agrobacterium-mediated target gene to oilseed rape cells, which are then regenerated into transformed oilseed rape plants. The method of the invention is independent of cultivars.

As used herein, a "selectable marker" refers to a gene or polynucleotide whose expression permits the identification of cells that have been transformed with a DNA construct or vector containing the gene or polynucleotide. The selectable marker may provide resistance to toxic compounds, such as antibiotics, herbicides, and the like. Preferably, the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene is transformed and the transformed gene is cultured in the presence of glyphosate. In the culture medium containing glyphosate as selective agent, the EPSPS gene transformed rape cell grows selectively.

As used herein, "transformation" refers to the introduction of DNA into a cell such that the DNA is maintained within the cell as an extrachromosomal element or chromosomal integrant.

In the present invention, exogenous DNA is introduced into a plant, and conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

Different Agrobacterium strains can be used, including but not limited to Agrobacterium tumefaciens and Agrobacterium rhizogenes. Preferably, a transformable strain is used, and suitable Agrobacterium tumefaciens strains include strain A208, strain EHA101, LBA 4404. Suitable Agrobacterium rhizogenes include strain K599. Construction of transformable Agrobacterium vectors is well known in the art.

Transgenic plants containing heterologous nucleic acids (i.e., containing cells or tissues transformed according to the methods of the invention), as well as seeds and progeny produced by such transgenic plants, are contemplated by the present invention. Methods for culturing transformed cells into useful cultivars are well known to those skilled in the art. Plant tissue in vitro culture techniques and whole plant regeneration techniques are also well known. Accordingly, the term "seed" includes seeds of these transformed plants as well as seeds produced by the progeny of the transformed plants. The "plant" includes not only transformed and regenerated plants but also progeny of transformed and regenerated plants produced by the method of the present invention.

Successfully transformed plants can be selected from plants produced by the methods of the invention. To develop improved plants and seed lines, seeds and progeny plants of the regenerated plants of the invention can be continually screened and selected for persistence of the transgene and the integrated nucleic acid sequence. Thus, the desired transgenic nucleic acid sequence can be transferred (i.e., introgressed or mated) into other genetic lines, such as certain elite or commercially useful lines or varieties. The method of introgressing a gene of interest into a genetic plant line can be accomplished by a variety of techniques well known in the art, including by traditional breeding, protoplast fusion, nuclear transfer, and chromosome transfer. Breeding methods and techniques are also well known in the art. The transgenic plants and inbred lines obtained according to the invention can be used for the production of commercially valuable hybrid plants and crops.

The invention provides a method for transforming rape, which has the following advantages:

1. the callus induction rate is high. According to the invention, 2,4-D is added into the callus induction culture medium, particularly the concentration of 5mg/L is the best, so that the induction strength of rape callus is obviously enhanced, and a good foundation is laid for the subsequent differentiation and regeneration stages.

2. The bud differentiation rate is high. The invention selectively adds ZT into the differentiation culture medium, particularly with the concentration of 1mg/L as the best, which obviously improves the bud differentiation rate of the rape callus.

3. Easy to root and high in survival rate. In the step of rooting and regenerating the seedlings of the rape, a rooting mode of treating the seedlings by two rooting culture media is adopted, the first rooting culture medium contains a hormone IBA for inducing rooting and a hormone ZT for promoting plant growth, but the culture time is not too long; the second rooting culture medium does not contain any hormone, only provides nutrient substances and plays a supporting role, so that the problems that the rape seedlings are difficult to root or have poor root system development, weak absorption function, difficult survival after transplantation and the like are solved, the seedling culture period is shortened (from 90 days to 80 days), the production cost is reduced, and the survival rate of the transformed plants is improved.

4. In the invention, different antibiotics are used at different stages in the transformation process to inhibit the growth of agrobacterium tumefaciens, carbenicillin is used when stem bud differentiation is induced, and cefadriamycin is used when rooting is induced, so that the technical difficulty that the cefadriamycin has an inhibition effect on the cabbage type rape thin layer cell bud differentiation is solved, and a good foundation is laid for obtaining transgenic plants.

5. The conversion efficiency is high. The method for transforming the rape uses the rape hypocotyl as a transformation receptor, promotes bud differentiation by adding ZT, and adopts a rooting mode of treating by two rooting culture media, so that the transformation efficiency is high to 8 percent.

6. The invention uses glyphosate as a selective agent, thereby effectively reducing the cost of screening transgenic positive plants; meanwhile, the transgenic rape can be directly used in the development of rape products tolerant to glyphosate herbicide.

The technical solution of the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

FIG. 1 is a flow chart of construction of a recombinant cloning vector DBN01-T of the method for transforming rapeseed according to the present invention;

FIG. 2 is a flow chart of construction of a recombinant expression vector DBN100772 of the method for transforming rape according to the present invention;

FIG. 3 is a diagram showing the effect of the method for transforming rape plants of the present invention.

Detailed Description

The technical scheme of the method for transforming rape of the invention is further illustrated by the following specific examples.

First embodiment, construction of recombinant expression vector and Agrobacterium transformation with recombinant expression vector

1. Construction of a recombinant cloning vector containing a target Gene

The EPSPS nucleotide sequence is connected to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), the operation steps are carried out according to the pGEM-T vector instruction of Promega company, and a recombinant cloning vector DBN01-T is obtained, and the construction process is shown in figure 1 (wherein Amp represents ampicillin resistance gene, f1 represents replication origin of phage f1, LacZ is LacZ initiation codon, SP6 is SP6RNA polymerase promoter, T7 is T7RNA polymerase promoter, cPSPS is 5-enolpyruvylshikimate-3-phosphate synthase gene nucleotide sequence (SEQ ID NO:1), and MCS is a multiple cloning site).

The recombinant cloning vector DBN01-T was then used to transform E.coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method under the following heat shock conditions: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant cloning vector DBN01-T), water bath at 42 ℃ for 30 s; the cells were cultured with shaking at 37 ℃ for 1h (shaking table at 200 r/min), and grown overnight on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH 7.5 adjusted with NaOH) coated with IPTG (isopropylthio-. beta. -D-galactoside) and X-gal (5-bromo-4-chloro-3-indol-. beta. -D-galactoside) ampicillin (100mg/L) on the surface. White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000r/min for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ L ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 200. mu.L of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ L ice-cold solution III (3M potassium acetate, 5M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000r/min for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000r/min for 5min, removing supernatant, washing precipitate with 70% ethanol, and air drying; adding 30 μ L of TE (10mM Tris-HCl, 1mM EDTA, pH8.0) containing RNase (20 μ g/mL) to dissolve the precipitate; bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use.

After enzyme digestion identification of Nco I and Spe I, sequencing verification is carried out on positive clones, and the result shows that the EPSPS gene sequence inserted into the recombinant cloning vector DBN01-T is the nucleotide sequence shown by SEQ ID NO 1 in the sequence table.

2. Construction of recombinant expression vectors containing the target Gene

The construction of a recombinant expression vector DBN100772, which is well known to those skilled in the art, by inserting the excised EPSPS gene sequence between the Nco I and Spe I sites of an expression vector DBNBC-01, by digesting the recombinant cloning vector DBN01-T and the expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from CAMBIA group)), respectively, with restriction enzymes Nco I and Spe I, using a conventional digestion method is carried out, and the construction procedure is as shown in FIG. 2 (Kan: kanamycin gene; RB: right border; prOsAct 1: rice actin 1 promoter (SEQ ID NO:2), spAtCTP 2: coding sequence of Arabidopsis chloroplast transit peptide (SEQ ID NO:3), cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene nucleotide sequence (SEQ ID NO:1), terminator of tNOS: nopaline synthase gene (SEQ ID NO:4), LB: left border).

The recombinant expression vector DBN100772 was transformed into E.coli T1 competent cells by heat shock under the following conditions: 50 μ L of E.coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100772), water bath at 42 ℃ for 30 s; shaking at 37 deg.C for 1h (shaking table at 200 r/min); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Nco I and Spe I and then identified, and the positive clone is sequenced and identified, and the result shows that the EPSPS nucleotide sequence is correctly inserted into the recombinant expression vector DBN 100772.

3. Recombinant expression vector transformation agrobacterium tumefaciens

The correctly constructed recombinant expression vector DBN100772 was transformed into Agrobacterium LBA4404(Invitrgen, Chicago, USA, CAT: 18313-: 100. mu.L Agrobacterium LBA4404, 3. mu.L plasmid DNA (recombinant expression vector); placing in liquid nitrogen for 10min, and heating in 37 deg.C water bath for 10 min; the transformed agrobacterium LBA4404 is inoculated in an LB test tube and cultured for 2h at the temperature of 28 ℃ and the rotating speed of 200r/min, the transformed agrobacterium LBA4404 is smeared on an LB solid plate containing 50mg/L Rifampicin (Rifampicin) and 100mg/L kanamycin until positive monoclonals grow out, the monoclonals are picked for culture and plasmids are extracted, enzyme digestion verification is carried out after restriction enzymes Nco I and Spe I are used for enzyme digestion, and the result shows that the structure of the recombinant expression vector DBN100772 is completely correct.

Second example, obtaining transgenic rape plants

1. Obtaining of explants

Soaking seeds of brassica napus variety webstar in 70% (v/v) alcohol for 1min, then sterilizing with 30% (v/v) sodium hypochlorite solution for 30min, and washing with sterile water for at least 3 times; the cleaned seeds are inoculated on a germination solid medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6), and cultured into seedlings under the conditions of temperature of 25 +/-2 ℃ and light period of 16/8 h. When the seedling age is 5-7 days, the hypocotyl of the seedling is cut into segments of about 1.0cm to serve as genetic transformation receptors for standby.

In the germination solid medium of this example, the B5 salt may also be N6 salt (concentration of 3.95g/L) or MS salt (concentration of 4.3g/L), and the sucrose concentration may be 5-100 g/L; the above components may be combined arbitrarily within their concentration range, but the germination solid medium (B5 salt 3.1g/L, B5 vitamins, sucrose 20g/L, agar 8g/L, pH5.6) is preferred.

2. Preparation of Agrobacterium liquid

Taking out Agrobacterium strain from-80 deg.C refrigerator, picking out Agrobacterium single colony containing DBN100772, activating the strain on YP culture plate (yeast extract 5g/L, peptone 10g/L, NaCl 5g/L, kanamycin 25mg/L, pH7.0) containing kanamycin (streaking with tip), placing the streaked YP culture plate in 28 deg.C incubator for 2-3 days, scraping plaque on YP culture plate, reactivating to new YP culture plate, culturing the reactivated YP culture plate in 28 deg.C incubator for one day, scraping colony, suspending in appropriate amount of infection medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS)40mg/L, 2-morpholinoethanesulfonic acid (MES)4g/L, and, 2mg/L Zeatin (ZT), pH5.3), shaking continuously to completely dilute the thallus in the infection solution, and adjusting the concentration to OD₆₆₀0.2-0.6, for standby.

In the infection medium of the embodiment, the MS salt can also be N6 salt (with the concentration of 3.95g/L) or B5 salt (with the concentration of 3.1g/L), the concentration of sucrose can be 5-100g/L, the concentration of glucose can be 5-100g/L, the concentration of AS can be 10-150mg/L, the concentration of MES can be 0.1-5g/L, and the concentration of ZT can be 0.1-5 mg/L; the above components may be combined arbitrarily within their concentration range, but the infection medium (MS salts 2.15g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, AS 40mg/L, MES 4g/L, ZT 2mg/L, pH5.3) is preferred.

3. Agrobacterium infection of rape hypocotyl cutting

The hypocotyl cut section cut out in the embodiment 1 is placed in a 50mL centrifuge tube, 30mL of the agrobacterium liquid prepared in the embodiment 2 is poured into the centrifuge tube, the agrobacterium liquid is fully contacted with the hypocotyl cut section, the mixture is kept still or is slightly shaken manually for 5-20min, preferably 10min, and the heat treatment is carried out in a water bath kettle with the constant temperature of 44 ℃ for 1-5min, preferably 1 min. And placing the infected hypocotyl sections on three layers of filter paper, and sucking agrobacterium liquid on the surfaces of the hypocotyl sections.

4. Co-culture of agrobacterium tumefaciens and rape hypocotyl by cutting

The hypocotyl cut segments of the sucked dry agrobacterium liquid are placed on a co-culture medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) for culture, a piece of filter paper is placed in the culture medium, 30 hypocotyl cut segments in each dish are optimal, and the mixture is cultured in a constant-temperature dark incubator at 22 ℃ for 2-5 days, preferably 3 days.

In the co-culture medium of this embodiment, the concentration of sucrose may be 5-100g/L, the concentration of glucose may be 5-100g/L, the concentration of MES may be 0.1-5g/L, and the concentration of ZT may be 0.1-5 mg/L; the above components may be combined arbitrarily within their concentration range, but the co-culture medium (MS salt 4.3g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) is preferred.

5. Inducing and culturing rape callus

The hypocotyl sections of the rape after co-culture are respectively transferred to 5 callus induction culture mediums with 2,4-D concentration (MS salt 4.0g/L, B5 vitamin, MES1g/L, sucrose 30g/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, 6-benzyladenine (6-BAP)0.03mg/L, proline 100mg/L, aspartic acid 100mg/L, pH5.6), wherein the 2,4-D concentration (mg/L) is 0, 0.1, 2, 5 and 7 respectively, and the rape hypocotyl sections are induced for 5-14 days, preferably 7 days under the conditions of temperature 24 +/-2 ℃ and light cycle of 16/8h, so as to eliminate agrobacterium and induce callus. After 5 to 14 days of induction, the callus induction rate (the callus induction rate is the number of induced calli/the number of hypocotyl-infected sections × 100%) was counted, 3 replicates were set for each 2,4-D concentration, and the test results were averaged as shown in table 1.

Table 1, 5 kinds of 2,4-D concentration callus induction medium treatment rape callus induction rate test results

The test results in table 1 show that: the induction rate of rape callus after the callus induction culture medium with 2,4-D is obviously higher than that of the callus induction culture medium without 2,4-D (the concentration of 2,4-D is 0mg/L), and particularly the induction rate of rape callus is as high as about 85% by taking the callus induction culture medium with 2,4-D concentration of 5mg/L as the best, so that the rape callus after the callus induction culture medium with 2,4-D concentration of 5mg/L is selected to be subjected to the following tests.

In the callus induction medium of this example, the MS salt may also be N6 salt (concentration 3.95g/L) or B5 salt (concentration 3.1g/L), MES may be 0.1-5g/L, sucrose may be 5-100g/L, 2,4-D may be 0.1-7mg/L, carbenicillin may be 50-300mg/L, timentin may be 20-500mg/L, silver nitrate may be 1-10mg/L, 6-BAP may be 0.01-1mg/L, proline may be 50-200mg/L, and aspartic acid may be 50-200 mg/L; the above components may be combined in any combination within the range of their concentrations, but the callus induction medium (MS salt 4.0g/L, B5 vitamin, MES1g/L, sucrose 30g/L, 2,4-D5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, 6-BAP 0.03mg/L, proline 100mg/L, aspartic acid 100mg/L, pH5.6) is preferred.

6. Screening and culturing rape callus

After the callus induction of the rape is finished, the callus of the rape treated by the callus induction culture medium with the concentration of 2,4-D of 5mg/L is transferred to a screening culture medium (MS salt 4.3g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT1mg/L, naphthylacetic acid (NAA)0.5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glyphosate 11.8mg/L, pH5.6) containing a glyphosate screening agent, and (3) screening and culturing for 10-30 days, preferably 18 days, at the temperature of 24 +/-2 ℃ and under the condition of a light cycle of 16/8h, so that transformed cells selectively grow to obtain rape resistant callus.

In the screening medium of this embodiment, the MS salt may also be N6 salt (concentration 3.95g/L) or B5 salt (concentration 3.1g/L), the MES may be 0.1-5g/L, the sucrose may be 5-100g/L, the ZT may be 0.1-5mg/L, the NAA may be 0.01-1mg/L, the carbenicillin may be 50-300mg/L, the timentin may be 20-500mg/L, the silver nitrate may be 1-10mg/L, the glutamic acid may be 50-200mg/L, the aspartic acid may be 50-200mg/L, and the glyphosate may be 0.1-20 mg/L; the above components may be combined arbitrarily within the range of their concentrations, but the selection medium (MS salt 4.3g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT1mg/L, NAA0.5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glyphosate 11.8mg/L, pH5.6) is preferred.

7. Differential culture of rape resistant callus

Removing the above rape resistant callus from the screening medium, cutting off water stain, browning and inactive callus, transferring fresh, tender and emerald active callus to differentiation medium (MS salt 4.3g/L, B5 vitamin, MES1g/L, sucrose 30g/L, NAA0.5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glyphosate 8.5mg/L, pH5.6) containing 3 different cytokinins (ZT 1mg/L, 6-BAP 1mg/L and Kinetin (KT)1 mg/L), culturing at 24 + -2 deg.C and 16/8h for 14-30 days to sprout, preferably 21 days. After 14-30 days of differentiation culture, the differentiation rate (differentiation rate ═ number of differentiated buds/number of hypocotyl-infected cuttings × 100%) was counted, and 3 replicates of each cytokinin were taken as an average, and the test results are shown in table 2.

TABLE 2 test results of callus differentiation rate of rape treated with differentiation medium containing 3 different cytokinins

The test results in table 2 show that: the callus differentiation rate of the rapes treated by the differentiation medium added with ZT is obviously higher than that of the differentiation medium added with 6-BAP and KT, and the callus differentiation rate of the rapes can reach 48 percent, so that the rape callus treated by the differentiation medium containing ZT is selected to be differentiated and germinated and the following experiments are carried out.

In the differentiation medium of this embodiment, the MS salt may also be N6 salt (concentration 3.95g/L) or B5 salt (concentration 3.1g/L), MES may be 0.1-5g/L, sucrose may be 5-100g/L, ZT may be 0.1-5mg/L, NAA may be 0.01-1mg/L, carbenicillin may be 50-300mg/L, timentin may be 20-500mg/L, silver nitrate may be 1-10mg/L, glutamic acid may be 50-200mg/L, aspartic acid may be 50-200mg/L, and glyphosate may be 0.1-20 mg/L; the above components may be combined arbitrarily within the range of their concentrations, but the differentiation medium (MS salt 4.3g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT1mg/L, NAA0.5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glyphosate 8.5mg/L, pH5.6) is preferred.

8. Culturing the differentiated rape bud seedlings

Transferring the rape buds which are differentiated from the callus and have plump bud points to a seedling culture medium (MS salt 4.3g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT1mg/L, NAA0.5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, pH5.6) without a glyphosate screening agent, and culturing at the temperature of 24 +/-2 ℃ and the photoperiod of 16/8h until the height of seedlings is 2-3 cm.

In the seedling culture medium of this embodiment, the MS salt may also be N6 salt (concentration 3.95g/L) or B5 salt (concentration 3.1g/L), the MES concentration may be 0.1-5g/L, the sucrose concentration may be 5-100g/L, the ZT concentration may be 0.1-5mg/L, the NAA concentration may be 0.01-1mg/L, the carbenicillin concentration may be 50-300mg/L, and the timentin concentration may be 20-500 mg/L; the above components may be combined arbitrarily within the range of their concentrations, but the seedling medium (MS salts 4.3g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, NAA0.5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, pH5.6) is preferred.

9. The rape plantlet takes root and regenerates into plants

The cultured rape seedlings are transferred to a first rooting medium (1/2MS salt 2.15g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, indolebutyric acid (IBA)0.25mg/L, agar 8g/L, cephamycin 150mg/L, pH5.6) and cultured for 5-7 days, preferably 6 days, under the conditions of temperature of 24 +/-2 ℃ and light cycle of 16/8 h. And respectively carrying out the following 2 treatments on the plantlets cultured by the first root culture medium: the first treatment is to continue culturing on the first rooting medium, the second treatment is to transfer to a second rooting medium (1/2MS salt 2.15g/L, B5 vitamin, MES1g/L, sucrose 30g/L, agar 8g/L, cefamycin 150mg/L, pH5.6) for culturing, culturing at 24 +/-2 ℃ and a photoperiod of 16/8h for rooting to about 5cm of plant height, and transferring to a greenhouse for culturing to seed. Culturing in greenhouse at 26 deg.C for 16 hr and at 20 deg.C for 8 hr in dark to obtain 2 rooted rape plants with EPSPS nucleotide sequence.

In the first rooting medium of this embodiment, the MS salt may also be N6 salt (concentration of 3.95g/L) or B5 salt (concentration of 3.1g/L), the MES concentration may be 0.1-5g/L, the sucrose concentration may be 5-100g/L, the ZT concentration may be 0.1-5mg/L, the IBA concentration may be 0.01-1mg/L, and the cephamycin concentration may be 50-300 mg/L; the above components may be combined arbitrarily within their concentration range, but the first root growth medium (1/2MS salts 2.15g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, IBA 0.25.25 mg/L, agar 8g/L, cephamycin 150mg/L, pH5.6) is preferred.

In the second rooting medium of this embodiment, the MS salt can also be N6 salt (concentration 3.95g/L) or B5 salt (concentration 3.1g/L), MES can be 0.1-5g/L, sucrose can be 5-100g/L, and cefuroxime can be 50-300 mg/L; the above components may be combined arbitrarily within their concentration range, but the second rooting medium (1/2MS salts 2.15g/L, B5 vitamins, MES1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L, pH5.6) is preferred.

Third example, TaqMan verification of Brassica napus plants transformed with EPSPS nucleotide sequence

About 100mg of the leaf of the 2 rooting-treated rape plants with the EPSPS nucleotide sequences transferred thereto was taken as a sample, genomic DNA thereof was extracted with the DNeasy Plant Maxi Kit of Qiagen, and the copy number of the EPSPS gene was detected by the Taqman probe fluorescent quantitative PCR method. Meanwhile, wild type rape plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method for detecting the copy number of the EPSPS gene comprises the following steps:

step 11, respectively taking 100mg of leaves of the 2 rooting-treated rape plants with the EPSPS nucleotide sequences and wild rape plants, respectively grinding the leaves into homogenate by using liquid nitrogen in a mortar, and taking 3 samples for each sample;

step 12, extracting the genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, and referring to the product specification of the specific method;

step 13, measuring the genomic DNA concentration of the sample by using NanoDrop2000(Thermo Scientific);

step 14, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu L;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of the wild type rape plant as a control, repeating the samples for 3 times, and taking the average value of the samples; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the EPSPS nucleotide sequence:

primer 1: CTGGAAGGCGAGGACGTCATCAATA is shown as SEQ ID NO. 5 in the sequence list;

primer 2: TGGCGGCATTGCCGAAATCGAG is shown as SEQ ID NO. 6 in the sequence list;

1, probe 1: ATGCAGGCGATGGGCGCCCGCATCCGTA is shown as SEQ ID NO. 7 in the sequence list;

the PCR reaction system is as follows:

the 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M and 860 μ L of 1 × TE buffer and was stored in amber tubes at a temperature of 4 ℃.

The PCR reaction conditions are as follows:

data were analyzed using SDS2.3 software (Applied Biosystems).

The experimental results show that the EPSPS nucleotide sequence is integrated into the chromosome group of the detected rape plant, the test results of the 2 rooting treatments are shown in the table 3 and the figure 3, the positive plants are 8 plants, and the transformation efficiency can reach 8%.

TABLE 3 test results of rape transformation efficiency

Note: the transformation efficiency is the number of positive plants/the number of hypocotyl-infected sections multiplied by 100%.

As can be seen from Table 3, in the step of rooting and regenerating the seedlings of Brassica napus into plants, the seedlings cultured by a rooting medium have a low rate of positive plants obtained from their progeny, even the positive plants cannot be obtained, and the transformation efficiency is below 2%; the seedlings cultured by the two rooting culture media have high positive plant rate of the offspring and the transformation efficiency is about 8 percent.

In conclusion, 2,4-D is added into the callus induction culture medium, particularly the concentration is 5mg/L, so that the callus induction rate of the rape is obviously enhanced, and a good foundation is laid for the subsequent differentiation and regeneration stages; ZT is selectively added into a differentiation culture medium, particularly the concentration of the ZT is 1mg/L, so that the bud differentiation rate of the callus of the rape is obviously improved; meanwhile, the rooting mode of treatment by two rooting culture media is adopted, so that the problems that the rape seedlings are difficult to root or have poor root system development, weak absorption function, difficult survival after transplantation and the like are solved, the seedling culture period is shortened, the production cost is reduced, and the survival rate of the transformed plants is improved; in addition, different antibiotics are used in different stages in the transformation process to inhibit the growth of agrobacterium tumefaciens, carbenicillin is used when stem bud differentiation is induced, and cefadriamycin is used when rooting is induced, so that the technical difficulty that the cefadriamycin has an inhibition effect on the bud differentiation of the brassica napus thin-layer cells is solved; the method for transforming the rape has the advantages that the transformation efficiency is as high as 8%, and the obtained transgenic rape can be directly used for developing rape products which are tolerant to glyphosate herbicide.

Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Beijing Dabei agricultural Biotechnology Co., Ltd

<120> method for transforming rapeseed

<130>DBNBC123

<160>7

<170>PatentIn version 3.3

<210>1

<211>1368

<212>DNA

<213>Artificial sequence

<220>

<223> 5-enolpyruvylshikimate-3-phosphate synthase gene nucleotide sequence

<400>1

atgcttcacg gtgcaagcag ccgtccagca actgctcgta agtcctctgg tctttctgga 60

accgtccgta ttccaggtga caagtctatc tcccacaggt ccttcatgtt tggaggtctc 120

gctagcggtg aaactcgtat caccggtctt ttggaaggtg aagatgttat caacactggt 180

aaggctatgc aagctatggg tgccagaatc cgtaaggaag gtgatacttg gatcattgat 240

ggtgttggta acggtggact ccttgctcct gaggctcctc tcgatttcgg taacgctgca 300

actggttgcc gtttgactat gggtcttgtt ggtgtttacg atttcgatag cactttcatt 360

ggtgacgctt ctctcactaa gcgtccaatg ggtcgtgtgt tgaacccact tcgcgaaatg 420

ggtgtgcagg tgaagtctga agacggtgat cgtcttccag ttaccttgcg tggaccaaag 480

actccaacgc caatcaccta cagggtacct atggcttccg ctcaagtgaa gtccgctgtt 540

ctgcttgctg gtctcaacac cccaggtatc accactgtta tcgagccaat catgactcgt 600

gaccacactg aaaagatgct tcaaggtttt ggtgctaacc ttaccgttga gactgatgct 660

gacggtgtgc gtaccatccg tcttgaaggt cgtggtaagc tcaccggtca agtgattgat 720

gttccaggtg atccatcctc tactgctttc ccattggttg ctgccttgct tgttccaggt 780

tccgacgtca ccatccttaa cgttttgatg aacccaaccc gtactggtct catcttgact 840

ctgcaggaaa tgggtgccga catcgaagtg atcaacccac gtcttgctgg tggagaagac 900

gtggctgact tgcgtgttcg ttcttctact ttgaagggtg ttactgttcc agaagaccgt 960

gctccttcta tgatcgacga gtatccaatt ctcgctgttg cagctgcatt cgctgaaggt 1020

gctaccgtta tgaacggttt ggaagaactc cgtgttaagg aaagcgaccg tctttctgct 1080

gtcgcaaacg gtctcaagct caacggtgtt gattgcgatg aaggtgagac ttctctcgtc 1140

gtgcgtggtc gtcctgacgg taagggtctc ggtaacgctt ctggagcagc tgtcgctacc 1200

cacctcgatc accgtatcgc tatgagcttc ctcgttatgg gtctcgtttc tgaaaaccct 1260

gttactgttg atgatgctac tatgatcgct actagcttcc cagagttcat ggatttgatg 1320

gctggtcttg gagctaagat cgaactctcc gacactaagg ctgcttga 1368

<210>2

<211>1534

<212>DNA

<213>Brassica oleracea

<400>2

gattatgaca ttgctcgtgg aatgggacag ttatggtatt tttttgtaat aaattgtttc 60

cattgtcatg agattttgag gttaatctat gagacattga atcacttagc attagggatt 120

aagtagtcac aaatcgcatt caagaagctg aagaacacgt tatggtctaa tggttgtgtc 180

tctttattag aaaatgttgg tcagtagcta tatgcactgt ttctgtaaaa ccatgttggt 240

gttgtgttta tttcaagaca catgttgagt ccgttgattc agagcttttg tcttcgaaca 300

caatctagag agcaaatttg ggttcaattt ggatatcaat atgggttcga ttcagataga 360

acaataccct ttgatgtcgg gtttcgattt ggttgagatt catttttatc gggtttggtt 420

cgattttcga attcggttta ttcgccccct catagcatct acattctgca gattaatgta 480

caagttatgg aaaaaaaaat gtggttttcg aattcggttt agtagctaaa cgttgcttgc 540

agtgtagtta tgggaattat gaaacacgac cgaaggtatc aattagaaga acgggtcaac 600

gggtaagtat tgagaaatta ccggagggta aaaataaaca gtattctttt tttttcttaa 660

cgaccgacca aggttaaaaa aagaaaggag gacgagatac aggggcatga ctgtaattgt 720

acataagatc tgatctttaa accctaggtt tccttcgcat cagcaactat aaataattct 780

gagtgccact cttcttcatt cctagatctt tcgccttatc gctttagctg aggtaagcct 840

ttctatacgc atagacgctc tcttttctct tctctcgatc ttcgttgaaa cggtcctcga 900

tacgcatagg atcggttaga atcgttaatc tatcgtctta gatcttcttg attgttgaat 960

tgagcttcta ggatgtattg tatcatgtga tggatagttg attggatctc tttgagtgaa 1020

ctagctagct ttcgatgcgt gtgatttcag tataacagga tccgatgaat tatagctcgc 1080

ttacaattaa tctctgcaga tttattgttt aatcttggat ttgatgctcg ttgttgatag 1140

aggatcgttt atagaactta ttgattctgg aattgagctt gtgtgatgta ttgtatcatg 1200

tgatcgatag ctgatggatc tatttgagtg aactagcgta cgatcttaag atgagtgtgt 1260

attgtgaact gatgattcga gatcagcaaa acaagatctg atgatatctt cgtcttgtat 1320

gcatcttgaa tttcatgatt ttttattaat tatagctcgc ttagctcaaa ggatagagca 1380

ccacaaaatt ttattgtggt agaaatcggt tcgattccga tagcagctta ctgtgatgaa 1440

tgattttgag atttggtatt tgatatatgt ctactgtgtt gaatgatcgt ttatgcattg 1500

tttaatcgct gcagatttgc attgacaagt agcc 1534

<210>3

<211>228

<212>DNA

<213>Arabidopsis thaliana

<400>3

atggcgcaag ttagcagaat ctgcaatggt gtgcagaacc catctcttat ctccaatctc 60

tcgaaatcca gtcaacgcaa atctccctta tcggtttctc tgaagacgca gcagcatcca 120

cgagcttatc cgatttcgtc gtcgtgggga ttgaagaaga gtgggatgac gttaattggc 180

tctgagcttc gtcctcttaa ggtcatgtct tctgtttcca cggcgtgc 228

<210>4

<211>253

<212>DNA

<213>Agrobacterium tumefaciens

<400>4

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210>5

<211>22

<212>DNA

<213>Artificial sequence

<220>

<223> primer 1

<400>5

ggtgtgcagg tgaagtctga ag 22

<210>6

<211>21

<212>DNA

<213>Artificial sequence

<220>

<223> primer 2

<400>6

ctgtaggtga ttggcgttgg a 21

<210>7

<211>27

<212>DNA

<213>Artificial sequence

<220>

<223> Probe 1

<400>7

cggtgatcgt cttccagtta ccttgcg 27

Claims

1. A method for transforming rape, which comprises the following steps:

germinating rape seeds to obtain hypocotyls or cutting the hypocotyls;

infecting said hypocotyls or a cut thereof with an agrobacterium strain;

performing callus induction culture on the infected hypocotyl or the cut segment thereof, specifically performing callus induction culture on the infected hypocotyl or the cut segment thereof on a callus induction culture medium containing auxin and cytokinin, wherein the auxin is 0.1-7 mg/L2, 4-D, and the cytokinin is 0.01-1 mg/L6-BAP;

selecting and culturing the rape callus by using a selective agent, and performing bud differentiation culture on the screened rape resistant callus on a differentiation culture medium containing ZT and NAA, wherein the concentration of the ZT is 0.1-5mg/L, and the concentration of the NAA is 0.01-1 mg/L;

the seedlings of the rape seedlings produced by the rape buds are cultured on a first rooting culture medium containing 0.1-5mg/L ZT and 0.01-1mg/L IBA and a second rooting culture medium without any hormone in turn.

2. The method for transforming rapeseed as claimed in claim 1, wherein the IBA is present in a concentration of 0.25 mg/L.

3. The method for transforming rapeseed as claimed in claim 1 or 2, wherein the concentration of ZT in the first rooting medium is 1 mg/L.

4. The method for transforming oilseed rape as claimed in claim 1 or 2, characterized in that the oilseed rape plantlets are cultivated on the first rooting medium for 5-7 days and then rooted on a second rooting medium without any hormones.

5. The method for transforming rapeseed as claimed in claim 3, wherein said rapeseed plantlets are cultured on said first rooting medium for 5-7 days and then rooted on a second rooting medium without any hormones.

6. The method for transforming rapeseed as claimed in any of claims 1, 2 or 5, wherein the concentration of 2,4-D is 5 mg/L.

7. The method for transforming rapeseed as claimed in claim 3, wherein the concentration of 2,4-D is 5 mg/L.

8. The method for transforming rapeseed as claimed in claim 4, wherein the concentration of 2,4-D is 5 mg/L.

9. The method for transforming rapeseed as claimed in claim 6, wherein the concentration of 6-BAP is 0.03 mg/L.

10. The method for transforming rapeseed as claimed in claim 7, wherein the concentration of 6-BAP is 0.03 mg/L.

11. The method for transforming rapeseed as claimed in claim 8, wherein the concentration of 6-BAP is 0.03 mg/L.

12. The method for transforming rapeseed plant according to any of claims 9-11, wherein the callus induction medium further comprises MES, sucrose, carbenicillin, timentin, silver nitrate, proline and aspartic acid.

13. The method for rape transformation according to claim 12, wherein the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, the concentration of carbenicillin is 50-300mg/L, the concentration of timentin is 20-500mg/L, the concentration of silver nitrate is 1-10mg/L, the concentration of proline is 50-200mg/L, and the concentration of aspartic acid is 50-200 mg/L.

14. The method for transforming rape as claimed in claim 13, wherein the callus induction medium comprises MS salt 4.0g/L or N6 salt 3.95g/L or B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, 2,4-D5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, 6-BAP 0.03mg/L, proline 100mg/L and aspartic acid 100 mg/L.

15. The method for transforming rapeseed plant according to any one of claims 1, 2, 5, 7-11, 13 and 14, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

16. The method for transforming rapeseed plant according to claim 3, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

17. The method for transforming rapeseed plant according to claim 4, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

18. The method for transforming rapeseed plant according to claim 6, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

19. The method for transforming rapeseed plant according to claim 12, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

20. The method for transforming rapeseed plant of claim 15, wherein the differentiation medium further comprises MES, sucrose, carbenicillin, timentin, silver nitrate, glutamic acid, aspartic acid and a selective agent.

21. The method for transforming canola as claimed in any one of claims 16-19, wherein said differentiation medium further includes MES, sucrose, carbenicillin, timentin, silver nitrate, glutamic acid, aspartic acid and a selection agent.

22. The method for transforming canola of claim 20, wherein said selective agent is glyphosate.

23. The method of claim 21, wherein the selective agent is glyphosate.

24. The method for rape transformation according to claim 22 or 23, wherein the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, the concentration of carbenicillin is 50-300mg/L, the concentration of timentin is 20-500mg/L, the concentration of silver nitrate is 1-10mg/L, the concentration of glutamic acid is 50-200mg/L, the concentration of aspartic acid is 50-200mg/L, and the concentration of glyphosate is 0.1-20 mg/L.

25. The method for transforming rapeseed plant of claim 24, wherein the differentiation medium comprises 4.3g/L of MS salt or 3.95g/L of N6 salt or 3.1g/L, B5 vitamin of B5 salt, 1g/L of MES, 30g/L, ZT1mg/L of sucrose, 0.5mg/L of naa, 8g/L of agar, 150mg/L of carbenicillin, 150mg/L of timentin, 3mg/L of silver nitrate, 100mg/L of glutamic acid, 100mg/L of aspartic acid and 8.5mg/L of glyphosate.

26. The method for transforming oilseed rape of any one of claims 1, 2, 5,7 to 11, 13, 14, 16 to 20, 22, 23 and 25, wherein the first rooting medium further comprises MES, sucrose and cephamycin.

27. The method for transforming canola as claimed in claim 3, wherein the first rooting medium further comprises MES, sucrose and cefuroxime.

28. The method for transforming canola as claimed in claim 4, wherein the first rooting medium further includes MES, sucrose and cefuroxime.

29. The method for transforming canola as claimed in claim 6, wherein the first rooting medium further comprises MES, sucrose and cefuroxime.

30. The method for transforming canola as claimed in claim 12, wherein said first rooting medium further comprises MES, sucrose and cefamycin.

31. The method for transforming canola as claimed in claim 15, wherein said first rooting medium further comprises MES, sucrose and cefamycin.

32. The method for transforming canola of claim 21, wherein said first rooting medium further comprises MES, sucrose and cefamycin.

33. The method of claim 24, wherein the first rooting medium further comprises MES, sucrose and cephamycin.

34. The method for rape transformation according to claim 26, wherein the concentration of MES is 0.1-5g/L, the concentration of sucrose is 5-100g/L, and the concentration of cefuroxime is 50-300 mg/L.

35. The method for the transformation of Brassica napus according to any one of claims 27 to 33, wherein the concentration of MES is 0.1 to 5g/L, the concentration of sucrose is 5 to 100g/L, and the concentration of cefuroxime is 50 to 300 mg/L.

36. The method of transforming canola as claimed in claim 34, wherein said first rooting medium includes 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, IBA0.25mg/L, agar 8g/L and cephamycin 150 mg/L.

37. The method of transforming canola as claimed in claim 35, wherein said first rooting medium includes 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, IBA0.25mg/L, agar 8g/L and cephamycin 150 mg/L.

38. The method for transforming oilseed rape of any one of claims 1, 2, 5,7 to 11, 13, 14, 16 to 20, 22, 23, 25, 27 to 34, 36 or 37, wherein the second rooting medium comprises MES, sucrose and cephamycin.

39. The method for transforming rapeseed plant according to claim 3, wherein the second rooting medium comprises MES, sucrose and cefuroxime.

40. The method for transforming rapeseed plant according to claim 4, wherein the second rooting medium comprises MES, sucrose and cefuroxime.

41. The method for transforming rapeseed plant according to claim 6, wherein the second rooting medium comprises MES, sucrose and cefuroxime.

42. The method for transforming canola as claimed in claim 12, wherein said second rooting medium comprises MES, sucrose and cefamycin.

43. The method for transforming canola of claim 15, wherein said second rooting medium comprises MES, sucrose and cefamycin.

44. The method for transforming canola of claim 21, wherein said second rooting medium comprises MES, sucrose and cefamycin.

45. The method for transforming canola of claim 24, wherein said second rooting medium comprises MES, sucrose and cefamycin.

46. The method for transforming canola of claim 26, wherein said second rooting medium comprises MES, sucrose and cefamycin.

47. The method for transforming canola of claim 35, wherein said second rooting medium comprises MES, sucrose and cefamycin.

48. The method for rape transformation according to claim 38, wherein the concentration of MES in the second rooting medium is 0.1-5g/L, the concentration of sucrose is 5-100g/L, and the concentration of cefuroxime is 50-300 mg/L.

49. The method for rape seed conversion according to any one of claims 39 to 47, wherein the MES concentration in the second rooting medium is 0.1 to 5g/L, the sucrose concentration is 5 to 100g/L, and the cephamycin concentration is 50 to 300 mg/L.

50. The method for transforming Brassica napus in claim 48, wherein said second rooting medium comprises 1/2MS salts 2.15g/L or 1/2N6 salts 3.95g/L or 1/2B5 salts 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, agar 8g/L and cephamycin 150 mg/L.

51. The method for transforming Brassica napus according to claim 49, wherein said second rooting medium comprises 1/2MS salts 2.15g/L or 1/2N6 salts 3.95g/L or 1/2B5 salts 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, agar 8g/L and cephamycin 150 mg/L.

52. A method of producing a transgenic canola plant comprising:

germinating rape seeds to obtain hypocotyls or cutting the hypocotyls;

infecting said hypocotyls or a cut thereof with an agrobacterium strain;

carrying out bud differentiation culture on the rape resistant callus on a differentiation culture medium containing ZT and NAA, wherein the concentration of the ZT is 0.1-5mg/L, and the concentration of the NAA is 0.01-1 mg/L;

the plantlets of rape seedlings grown from the above rape shoots are cultured in sequence on a first rooting medium containing 0.1-5mg/L ZT and 0.01-1mg/L IBA and a second rooting medium not containing any hormone to obtain transgenic rape plants.

53. The method of producing a transgenic canola plant of claim 52, wherein the concentration of IBA is 0.25 mg/L.

54. The method of producing a transgenic canola plant of claim 52 or 53, wherein the concentration of ZT in the first root growing medium is 1 mg/L.

55. The method of producing a transgenic canola plant of claim 52 or 53, wherein the canola plantlets are cultured on the first rooting medium for 5-7 days and then rooted on a second rooting medium that does not contain any hormones.

56. The method of producing a transgenic canola plant of claim 54, wherein the canola plantlets are cultured on the first rooting medium for 5-7 days and then rooted on a second rooting medium not containing any hormones.

57. The method for producing a transgenic canola plant according to any one of claims 52, 53 or 56, wherein the concentration of 2,4-D is 5 mg/L.

58. The method of producing a transgenic canola plant of claim 54, wherein the concentration of 2,4-D is 5 mg/L.

59. The method of producing a transgenic canola plant of claim 55, wherein the concentration of 2,4-D is 5 mg/L.

60. The method of producing a transgenic canola plant according to claim 57, wherein the concentration of 6-BAP is 0.03 mg/L.

61. The method of producing a transgenic canola plant of claim 58, wherein the concentration of 6-BAP is 0.03 mg/L.

62. The method of producing a transgenic canola plant of claim 59, wherein the concentration of 6-BAP is 0.03 mg/L.

63. The method for producing a transgenic canola plant according to any one of claims 60-62, wherein the callus induction medium further comprises MES, sucrose, carbenicillin, timentin, silver nitrate, proline and aspartic acid.

64. The method of claim 63, wherein the MES concentration is 0.1-5g/L, the sucrose concentration is 5-100g/L, the carbenicillin concentration is 50-300mg/L, the timentin concentration is 20-500mg/L, the silver nitrate concentration is 1-10mg/L, the proline concentration is 50-200mg/L, and the aspartic acid concentration is 50-200 mg/L;

65. the method of claim 64, wherein the callus induction medium comprises MS salts 4.0g/L or N6 salts 3.95g/L or B5 salts 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, 2,4-D5mg/L, agar 8g/L, carbenicillin 150mg/L, timentin 150mg/L, silver nitrate 3mg/L, 6-BAP 0.03mg/L, proline 100mg/L and aspartic acid 100 mg/L.

66. The method for producing a transgenic canola plant according to any one of claims 52, 53, 56, 58-62, 64, 65, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

67. The method of producing a transgenic canola plant of claim 54, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

68. The method of producing a transgenic canola plant of claim 55, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

69. The method of producing a transgenic canola plant according to claim 57, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

70. The method of producing a transgenic canola plant of claim 63, wherein the concentration of ZT in the differentiation medium is 1 mg/L.

71. The method of producing a transgenic canola plant of claim 66, wherein the differentiation medium further comprises MES, sucrose, carbenicillin, timentin, silver nitrate, glutamic acid, aspartic acid and a selection agent.

72. The method of any one of claims 67 to 70, wherein the differentiation medium further comprises MES, sucrose, carbenicillin, timentin, silver nitrate, glutamic acid, aspartic acid and a selection agent.

73. The method of producing a transgenic canola plant of claim 71, wherein the selection agent is glyphosate.

74. The method of producing a transgenic canola plant of claim 72, wherein the selection agent is glyphosate.

75. The method of claim 73 or 74, wherein the MES concentration is 0.1-5g/L, the sucrose concentration is 5-100g/L, the carbenicillin concentration is 50-300mg/L, the timentin concentration is 20-500mg/L, the silver nitrate concentration is 1-10mg/L, the glutamic acid concentration is 50-200mg/L, the aspartic acid concentration is 50-200mg/L, and the glyphosate concentration is 0.1-20 mg/L.

76. The method of producing a transgenic canola plant of claim 75, wherein the differentiation medium comprises 4.3g/L MS salt or 3.95g/L N6 salt or 3.1g/L, B5 vitamin B5 salt, 1g/L MES, 30g/L, ZT1mg/L, NAA 0.5.5 mg/L sucrose, 8g/L agar, 150mg/L carbenicillin, 150mg/L timentin, 3mg/L silver nitrate, 100mg/L glutamic acid, 100mg/L aspartic acid and 8.5mg/L glyphosate.

77. A method of producing a transgenic canola plant according to any one of claims 52, 53, 56, 58-62, 64, 65, 67-71, 73, 74, 76, wherein the first rooting medium further comprises MES, sucrose and cephamycin.

78. The method of producing a transgenic canola plant of claim 54, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

79. The method of producing a transgenic canola plant of claim 55, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

80. The method of producing a transgenic canola plant of claim 57, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

81. The method of producing a transgenic canola plant of claim 63, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

82. The method of producing a transgenic canola plant of claim 66, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

83. The method of producing a transgenic canola plant of claim 72, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

84. The method of producing a transgenic canola plant of claim 75, wherein the first rooting medium further comprises MES, sucrose and cefamycin.

85. The method of claim 77, wherein the MES concentration is 0.1-5g/L, the sucrose concentration is 5-100g/L, and the cephamycin concentration is 50-300 mg/L.

86. The method of any one of claims 78 to 84, wherein the MES concentration is 0.1 to 5g/L, the sucrose concentration is 5 to 100g/L and the cefadriamycin concentration is 50 to 300 mg/L.

87. The method of producing a transgenic canola plant of claim 85, wherein the first rooting medium comprises 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, IBA0.25mg/L, agar 8g/L, and cephamycin 150 mg/L.

88. The method of producing a transgenic canola plant of claim 86, wherein the first rooting medium comprises 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT1mg/L, IBA0.25mg/L, agar 8g/L, and cephamycin 150 mg/L.

89. The method of producing a transgenic canola plant according to any one of claims 52, 53, 56, 58-62, 64, 65, 67-71, 73, 74, 76, 78-85, 87, 88, wherein the second rooting medium comprises MES, sucrose and cephamycin.

90. The method of producing a transgenic canola plant of claim 54, wherein the second rooting medium comprises MES, sucrose and cefamycin.

91. The method of producing a transgenic canola plant of claim 55, wherein the second rooting medium comprises MES, sucrose and cefamycin.

92. The method of producing a transgenic canola plant according to claim 57, wherein the second rooting medium comprises MES, sucrose and cefamycin.

93. The method of producing a transgenic canola plant of claim 63, wherein the second rooting medium comprises MES, sucrose and cefamycin.

94. The method of producing a transgenic canola plant of claim 66, wherein the second rooting medium comprises MES, sucrose and cefamycin.

95. The method of producing a transgenic canola plant of claim 72, wherein the second rooting medium comprises MES, sucrose and cefamycin.

96. The method of producing a transgenic canola plant of claim 75, wherein the second rooting medium comprises MES, sucrose and cefamycin.

97. The method of producing a transgenic canola plant of claim 77, wherein the second rooting medium comprises MES, sucrose and cefamycin.

98. The method of producing a transgenic canola plant of claim 86, wherein the second rooting medium comprises MES, sucrose and cefamycin.

99. The method of claim 89, wherein the MES concentration in the second rooting medium is 0.1-5g/L, the sucrose concentration is 5-100g/L, and the cephamycin concentration is 50-300 mg/L.

100. The method of any one of claims 90 to 98, wherein the MES concentration in the second rooting medium is 0.1-5g/L, the sucrose concentration is 5-100g/L, and the cephamycin concentration is 50-300 mg/L.

101. The method of producing a transgenic canola plant of claim 99, wherein the second rooting medium comprises 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, agar 8g/L, and cephamycin 150 mg/L.

102. The method of producing a transgenic canola plant of claim 100, wherein the second rooting medium comprises 1/2MS salt 2.15g/L or 1/2N6 salt 3.95g/L or 1/2B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, agar 8g/L, and cephamycin 150 mg/L.