KR20220161020A - Pollen specific expression promoter from Oryza sativa Os03g52870 gene and uses thereof - Google Patents

Abstract

The present invention relates to an Oryza sativa gene-derived promoter showing pollen-specific expression. An Oryza sativa plant transformed using a vector containing the promoter specifically shows gene expression only in pollen. Thus, the Oryza sativa gene-derived promoter can be usefully used to improve the pollen development of major cereal crops or monocotyledonous plants including Oryza sativa, or to grow crops with increased productivity through the cultivation of male sterile plants. A plant pollen-specific expression promoter of the present invention consists of the base sequence represented by SEQ ID NO: 1.

Description

Pollen specific expression promoter from Oryza sativa Os03g52870 gene and uses thereof}

The present invention relates to a rice gene-derived promoter showing pollen-specific expression and its use.

Rice (Oryza sativa) is one of the most important food crops in the world and has been steadily increasing in yield over the past 20 years. However, farmland where rice is cultivated is gradually decreasing due to industrialization in each country, and new genetic resources used as breeding materials are depleted, so the introduction of useful foreign genes is required. Fortunately, with the development of molecular biology, it is possible to isolate and manipulate foreign useful genes, transforming useful genes into many plant cells, including rice, to obtain transformants in which new genes are combined, resulting in gene expression that identifies various life phenomena. It is becoming a good material for research as well as breeding.

It is expected that the production of new varieties using such transformation will not only emerge as a high value-added industry, but also contribute to solving the food problem, which is the biggest problem of mankind.

In the transformation method known to date, in the 1980s, polyethylene glycol (PEG) and electroporation were used for protoplasts. In the late 1990s, the use of gene guns became common, and recently, the use of Agrobacterium, which has been widely used in dicotyledonous plants, has also been widely used. Other methods include the pollen pathway and microinjection method.

Promoter (promoter) can confine the expression of the foreign gene to the whole body or special tissue of the plant according to the purpose of transformation, and can be classified as follows according to its function.

First, a promoter inducing systemic expression may be mentioned. As a promoter for inducing systemic expression in plants, the promoter of the 35S RNA gene of cauliflower mosaic virus (CaMV) is used as a representative promoter for dicotyledonous plants. Rice actin and corn ubiquitin gene promoters have been mainly used as promoters for inducing systemic expression in monocotyledonous plants such as rice. Yes (refer to Korean Registration No. 10-0429335). These are already inherent to induce the expression of antibiotic or herbicide resistance genes and reporter genes used as selection markers in the basic transporter for plant transformation, and are preferentially used when trying to elucidate the function of the target gene in plants from a research point of view. promoters to be considered.

Second, a seed-specific promoter may be mentioned. As a representative example, rice glutelin promoters used in the development of golden rice as promoters of major storage protein genes in rice have been widely used to induce seed-specific expression in monocotyledonous plants. Promoters mainly used to induce seed-specific expression in dicotyledonous plants include soybean-derived lectin promoter, Chinese cabbage-derived napin promoter, and γ-tocopherol methyl transferase (γ-tocopherol methyl transferase) in Arabidopsis seeds. Patent for induction of seed-specific expression of the carrot-derived DC-3 promoter and perilla-derived oleosin promoter used in the study of enhancing vitamin E production by inducing TMT) gene expression (refer to Korean Patent No. 10-0685520) ) is there. The seed-specific promoters are mainly used for the purpose of accumulating useful proteins and producing useful substances in major crops in which seeds themselves are used as food or food or raw materials for food.

Thirdly, it is a root-specific expression promoter. Arabidopsis peroxidase (prxEa) was isolated and root-specific expression was confirmed. Recently, sweet potato-derived ibMADS and sugar-inducible ADP-glucose pyrophosphatase (AGPase) genes were isolated. There is a technology (refer to Korean Patent Registration Nos. 10-0604186 and 10-0604191) confirming that the promoter induces specific expression in roots and induces root-specific transient expression in carrots and radishes.

Fourth, other tissue-specific promoters such as leaves may be mentioned. Rice and maize-derived ribulose bisphosphate carboxylase/oxygenase small subunit (rbcS) promoters that induce strong gene expression only in photosynthetic tissues such as leaves, RolD promoters that induce expression in plant roots derived from Agrobacterium, and potato-derived tubers There is a patatin promoter that induces specific expression, and a phytoene synthase (PDS) promoter that induces specific expression of tomato-derived fruit maturation.

On the other hand, the process of development into mature pollen belongs to the reproductive generation of plants that produce male gametes and is a relatively short cycle, but it is an important biological process underlying the existence of seed plants, and the genes involved in this developmental process have no agricultural utility. Very large. In particular, by constructing a transformation vector containing a promoter specifically expressed only in pollen tissues, it can be used to grow transformants with increased pollen activity. Objects cultivated in this way have very high agricultural utilization, such as increasing productivity by increasing the activity of pollen in major crops, including rice.

However, compared to other tissue-specific promoters, research on promoters that can act specifically in pollen is very lacking. Pollen development is closely related to temperature, and pollen development is particularly inhibited at low or high temperatures. In modern times, there is a high risk of crops being exposed to high temperatures or abnormally low temperatures due to global climate change, which may result in reduced productivity due to pollen development disorders. To solve this problem, it is important to develop promoters capable of controlling gene expression in pollen. Therefore, research on a new promoter capable of more precisely controlling the expression in pollen according to the intention of the developer is required.

While studying a promoter specifically expressed only in plant pollen, the present inventors constructed a vector containing a rice Os03g52870 gene-derived promoter and a foreign gene and transformed it into plants. The present invention was completed by confirming that it was not expressed in tissues but was specifically expressed only in pollen.

Accordingly, an object of the present invention is to provide a plant pollen-specific expression promoter.

Another object of the present invention is to provide a pollen-specific expression vector for plants.

Another object of the present invention is to provide a transformed transformed cell.

Another object of the present invention is to provide a transformed plant.

Another object of the present invention is to provide seeds of transgenic plants.

Another object of the present invention is to provide a method for producing a plant transformant exhibiting pollen-specific expression.

Another object of the present invention is to provide a method for expressing a foreign gene in a plant pollen-specific manner.

In order to achieve the above object, the present invention provides a plant pollen-specific expression promoter consisting of the nucleotide sequence represented by SEQ ID NO: 1.

In addition, in order to achieve the above other object, the present invention provides a plant pollen-specific expression vector comprising the promoter according to the present invention.

In addition, in order to achieve the above another object, the present invention provides a transformed cell transformed with the expression vector according to the present invention.

In addition, in order to achieve the above another object, the present invention provides a plant transformed with the expression vector according to the present invention or a transformed cell transformed by the expression vector.

In addition, in order to achieve the above another object, the present invention provides a seed of a transgenic plant according to the present invention.

In addition, in order to achieve the above another object, the present invention is a pollen-specific expression promoter according to the present invention and the step of introducing a vector containing a foreign gene operatively linked thereto into a plant; A method for producing a plant transformant showing red expression is provided.

In addition, in order to achieve the above another object, the present invention is a step of introducing a vector containing a pollen-specific expression promoter according to the present invention and a foreign gene operatively linked thereto into a plant; Plant pollen comprising A method for specifically expressing a foreign gene is provided.

The rice plant transformed using the vector containing the rice gene-derived promoter according to the present invention specifically shows gene expression only in pollen, thereby improving pollen development or male growth of major grains or monocotyledonous plants including rice. It can be usefully used for cultivating productivity-enhancing crops through the cultivation of infertile plants.

1 is a vector map of an expression vector including a pollen-specific expression promoter derived from the rice Os03g52870 gene of the present invention.
Figure 2 is a result of confirming expression in rice plants transformed with a vector containing a rice gene-derived promoter and GUS (beta-glucuronidase) according to the present invention using GUS staining. Figure 2a is a result of confirming the expression in immature and mature anthers of a few (spikelet) (red box (red box) shows the expression in mature anthers after removing chlorophyll). Figure 2b is the result of confirming the expression of pollen grains of various stages (YM: immature microspore, V: vacuolated pollen grains, BG: bicellular ) pollen grain, TG: tricellular pollen grain, MP: mature pollen). White Bars=Fig. 2(a): 2 mm (seedlings and shoots), Fig. 2(b): 20 μm (potted plants).
Figure 3 is a result of confirming YFP signals in pollen grains (including pollen and anther walls) of rice plants transformed using a vector containing a rice gene-derived promoter and YFP fluorescent protein according to the present invention. BG means a bicellular grain, TG means a tricellular grain, and MP means a mature pollen grain. White Bars = 20 μm.
Figure 4 shows the results of confirming expression during pollen germination in pollen grains of rice plants transformed using a vector containing a rice gene-derived promoter and YFP fluorescent protein according to the present invention. Figure 4a is the result of confirming the expression in mature pollen grains and plasma membrane. Figure 4b is the result of confirming the expression in the cytoplasm of the pollen tube (PT) immediately after germination in vitro. Figure 4c is the result of confirming the distribution of YFP signals in growing pollen tubes. Fig. 4d is a result of confirming foci where expression is concentrated in pollen grains (Fig. 4e) and pollen tubes (Fig. 4f) in the slowly growing pollen tube 15 minutes after germination. Figure 4g is the result of confirming the PM and the concentration point in the slowly growing PT at 90 minutes after germination, together with the decrease in the intensity of YEP expression in the cytoplasm. Figure 4i is a schematic diagram summarizing the expression patterns in PT growth based on the findings in Figures 4a to 4g. Among them, the red gradient indicates the main location of expression. White bars = 10 μm (Figs. 4a and 4b), 20 μm (Figs. 4c to 4e) and 5 μm (Figs. 4f to 4i).

Hereinafter, the present invention will be described in detail.

The present invention provides a plant pollen-specific expression promoter consisting of the nucleotide sequence represented by SEQ ID NO: 1.

The nucleotide sequence represented by SEQ ID NO: 1 is a rice Os03g52870 gene-derived promoter, a 2KB upstream sequence of the rice Os03g52870 gene, and the 5' untranslated region in front of the ATG of the rice Os03g52870 gene CDS (Coding Sequence). It is characterized in that it is a sequence containing UTR)). The nucleotide sequence represented by SEQ ID NO: 1 is characterized in that it is derived from -2057 to -1 bp from the translation initiation site of the coding sequence of the rice Os03g52870 gene. That is, it corresponds to the 2056 bp gene in front of the ATG of the rice Os03g52870 gene.

The promoter of the present invention is a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more to the nucleotide sequence represented by SEQ ID NO: 1. can include The "% sequence homology" for a base sequence is determined by comparing two optimally aligned sequences with a region of comparison, and a portion of the base sequence in the region of comparison is a reference sequence (with no additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to not including).

In addition, in the promoter of the present invention, the nucleotide sequence represented by SEQ ID NO: 2 may be further linked. The nucleotide sequence represented by SEQ ID NO: 2 refers to a sequence excluding the 3' stop codon (TAG) in the CDS sequence of the rice Os03g52870 gene.

Accordingly, the promoter of the present invention may have a form in which a CDS sequence is further linked to the end of the promoter sequence. As described above, when the CDS sequence is linked to the end of the promoter sequence of the rice Os03g52870 gene, a more accurate pollen-specific expression control effect can be obtained since the first exon and the intron are included.

Therefore, the present invention is a promoter composed of the nucleotide sequence represented by SEQ ID NO: 1 in Table 1 or a base represented by SEQ ID NO: 3 to which the nucleotide sequence represented by SEQ ID NO: 2 is connected to the 3' side of the nucleotide sequence represented by SEQ ID NO: 1 A promoter consisting of the sequence is provided.

The promoter of the present invention is a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more to the nucleotide sequence represented by SEQ ID NO: 2. can include The "% sequence homology" for a base sequence is determined by comparing two optimally aligned sequences with a region of comparison, and a portion of the base sequence in the region of comparison is a reference sequence (with no additions or deletions) to the optimal alignment of the two sequences. not included) may include additions or deletions (i.e., gaps). In addition, the promoter of the present invention has not only the nucleotide sequence represented by SEQ ID NO: 3, but also some bases of the nucleotide sequence represented by SEQ ID NO: 3 Substituted, deleted or added modified sequences include nucleotide sequences that specifically show promoter activity in pollen.

In addition, the nucleotide sequence variant represented by SEQ ID NO: 3 may be included within the scope of the present invention. Although the nucleotide sequence of SEQ ID NO: 3 of the present invention and functional equivalents of the nucleic acid molecules constituting it, for example, some nucleotide sequences of SEQ ID NO: 3, have been modified by deletion, substitution, or insertion, , It is a concept including variants that can functionally perform the same action as the base sequence of SEQ ID NO: 3 and the nucleic acid molecules constituting the base sequence. Specifically, it may include a base sequence having a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with the base sequence of SEQ ID NO: 3. have. The "% sequence homology" for a base sequence is determined by comparing two optimally aligned sequences with a region of comparison, and a portion of the base sequence in the region of comparison is a reference sequence (with no additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to not including).

According to one embodiment of the present invention, pollen-specific expression was confirmed in plants transformed using a vector containing a promoter consisting of the nucleotide sequence represented by SEQ ID NO: 3 and a fluorescent protein.

In particular, the induction of pollen-specific gene expression of the present invention was strongly expressed in the middle to late stages of pollen development.

For example, the development stages of pollen are as follows: In the pollen bag of stamens, each pollen mother cell undergoes meiosis to form tetrads in a haploid state. Afterwards, the tetramers are separated into microspores by the action of callase secreted from the tapestry tissue of the stamen (monuclear stage). Individual spores undergo asymmetric mitosis to develop into spores composed of large vegetative cells and small reproductive cells (binuclear stage). The vegetative nucleus cell plays a role in supplying nutrients necessary for the elongation of the pollen tube, which is a channel for transporting sperm nuclei without further mitosis. The reproductive nucleus cell undergoes another round of mitosis to make two sperm cells (trinuclear stage). The promoter of the present invention shows particularly strong expression in the middle and late stages of pollen development, i.e., nuclear stages 2 to 3.

In the present invention, the term "specific" means that the expression activity of the promoter is higher in a specific tissue than at least one other tissue in the same plant. The level of expression activity of the promoter is measured in advance using a commonly used method. The expression level of a promoter in a given tissue is evaluated by comparing it with that in other tissues.Generally, the expression level of a promoter can be measured by the amount of gene product, such as protein and RNA, expressed under the control of the promoter. can

In the present invention, “promoter” is generally a gene region located upstream of a coding region including a transcription initiation point, and is often a TATA box or CAAT box region that regulates gene expression, responding to external stimuli It may include an enhancer that promotes the expression of almost all genes regardless of the site that affects gene expression and the location and direction.

In the present invention, the "enhancer" is a sequence that binds to another protein of the transcription initiation complex and promotes transcription initiation by its related promoter.

In addition, the present invention provides a plant pollen-specific expression vector comprising the plant pollen-specific expression promoter according to the present invention.

In the present invention, the "vector" refers to a gene construct containing a nucleotide sequence of a gene operably linked to a suitable control sequence so as to express a target gene in a suitable host. The regulatory sequence refers to any nucleic acid sequence upstream or downstream of a transcription initiation site capable of affecting the transcription/translation of an operably linked gene. For example, it may include a promoter capable of initiating transcription, an enhancer, an operator sequence for regulating transcription, a polyadenylation signal, a ribosome binding site, a replication initiation point, a transcription termination sequence, and the like.

In the present invention, the "operably linked" refers to a functional link between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest so as to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. Operational linkage with a recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and linking uses enzymes generally known in the art.

The pollen-specific expression vector according to the present invention uses an existing vector used for protein expression as a basic skeleton, inserts a pollen-specific expression promoter of the plant of the present invention, and encodes a target protein downstream of the promoter. It can be prepared by inserting a target gene, which is a nucleotide sequence. In addition, a transcription termination sequence may be introduced. As an example of the pollen-specific expression vector of the present invention, a vector map including a pollen-specific expression promoter is shown in FIG. 1 .

The vector of the present invention is not particularly limited as long as it can be replicated in a plant body, and any vector known in the art can be used. As an example, any one selected from the group consisting of Ti-plasmids such as pCAMBIA series, pGA series, pGWB series, e.g., pGA3519, pGA3426, pGA3383, pCAMBIA3301, pCAMBIA3300, pGA3426, pGA3780, pGWB12, pGWB14 and vectors derived therefrom can be used. have. In addition, viral vectors, such as those that can be derived from double-stranded plant viruses (eg, CaMV) and single-stranded viruses, gemini viruses, and the like, can also be used, such as incomplete plant viral vectors. In one embodiment of the present invention, pUbi vectors modified from pGA3519 and pGA3427 were used. The pGA3519 vector or pUbi vector is a vector containing a GUS (beta-glucuronidase) or YFP (yellow fluorescent protein) reporter gene, and the GUS reporter gene and YFP reporter gene are examples of exogenous genes, and the promoter of the present invention (pGORI) ) was placed in front of the foreign gene to prepare pGORI promoter:GUS (hereinafter referred to as pGUS:uidA) or pGORI promoter:GUS (hereinafter referred to as pGORI:GORI-YFP).

In the present invention, the "downstream" refers to a nucleotide sequence located 3' to the reference nucleotide sequence. Specifically, downstream nucleotide sequences generally relate to sequences following the initiation point of transcription. For example, the translation initiation codon of a gene is located downstream of the initiation site of transcription.

In the present invention, the "target gene" is a nucleic acid sequence of a certain length that encodes a desired product, and has the same meaning as a foreign gene as a gene desired to be expressed in pollen. The desired product may be a biologically active protein itself or an RNA involved in the inactivation of a specific gene after transcription (eg siRNA involved in RNAi). These target genes will generally be present in the vector in the sense orientation, but may be present in the antisense orientation to inactivate a specific gene. If the target gene is a gene encoding a biologically active protein, the gene will usually include a 5'UTR, a coding sequence and a 3'UTR. In addition, the target gene may be a sequence encoding a truncated protein, a fused protein, or a tagged protein, cDNA or genomic DNA, a sequence encoding a natural product, or a desired mutant form. It may be a sequence encoding the product. Any target gene may be used as long as the target product is directly or indirectly useful to humans. In addition, the target gene may be derived from anything, such as plants, bacteria, animals, viruses, and the like.

In the present invention, the "expression of the target gene" may mean producing a protein encoded by the target gene by expressing the target gene. In the present invention, the method of expressing the gene of interest may be a method of expressing a protein encoded by the gene of interest by culturing a transformant (host cell) transformed with a vector containing the gene of interest, through which the protein End products of the biosynthetic pathways involved can be produced.

The pollen-specific expression vector of the present invention preferably includes one or more selectable marker genes in order to enable or facilitate the selection of transformed plants, or qualitatively and/or quantitatively evaluates the expression of the target gene to be expressed. One or more reporter genes may be included for analysis. As such selection marker genes or reporter genes, those known in the art can be used.

In the present invention, the "reporter gene (or gene for detection)" refers to a base encoding an identifying factor that can be identified based on the effect of the gene, wherein the effect traces the inheritance of the base of interest or Used to identify the cell or organism that has inherited the base, and/or to measure gene expression induction or transcription Examples of reporter genes known and used in the art include: GUS (beta-glucuronidase) , YFP (yellow fluorescent protein), GFP (Green fluorescent protein), RFP (Red Fluorescent Protein), fluorescent proteins such as Luc (Luciferase), chloroamphenicol acetyltransferase (CAT), beta-galactosida enzyme (β-galactosidase, LacZ), beta-glucuronidase (β-glucuronidase, Gus), etc.

In addition, the pollen-specific expression vector of the present invention is in the group consisting of ampicillin, tetracyclin, kanamycin, chloroamphenicol, streptomycin and neomycin as the marker gene. It may further include one or more selected antibiotic resistance genes.

In the present invention, the "antibiotic resistance gene" is a gene having resistance to antibiotics, and since cells having this gene survive in an environment treated with the antibiotic, it is useful as a selection marker in the process of obtaining plasmids in large quantities from E. coli. used In the present invention, since the antibiotic resistance gene is not a factor that greatly affects the expression efficiency according to the optimal combination of vectors, which is a key technology of the present invention, antibiotic resistance genes commonly used as selection markers can be used without limitation.

In addition, the pollen-specific expression vector of the present invention may include a herbicide resistance gene such as glyphosate or phosphinothricin.

In addition, in the present invention, the terminator sequence controlling the termination of translation is nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator and Agrobacterium tumefaciens octo It may be any one selected from the group consisting of the terminator of the pine (Octopine) gene, but is not limited thereto, and a conventional terminator may be used.

The present invention also provides a transformed cell transformed with the pollen-specific expression vector of the plant according to the present invention.

Pollen-specific expression vectors of the present invention can be introduced into cultured host cells using well-known techniques such as infection, transduction, transfection, electroporation and transformation. Representative examples of hosts include, but are not limited to, bacterial cells such as Escherichia coli, Streptomyces, Salmonella typhimurium cells, and plant cells.

Plant cells are preferred in the present invention. Any plant cell can be used as a "plant cell" used for plant transformation. The plant cell may be any type of cultured cell, cultured tissue, cultured organ or whole plant, preferably a cultured cell, cultured tissue or cultured organ and more preferably a cultured cell. “Plant tissue” refers to differentiated or undifferentiated plant tissues such as, but not limited to, stems, leaves, cancer tissues, and various types of cells used in culture, such as single cells, protoplasts, and shoots. and callus tissue.

The transformed cells may be grown in a conventional medium. The "cultivation" means growing plants or plant cells under artificially controlled conditions in an appropriate environment. The medium contains nutrients required by the plant cells to be cultivated, i.e., cultivars, in order to cultivate specific plant cells, and may be mixed with additional substances for special purposes. The medium is also referred to as an incubator or a culture medium, and is a concept that includes all of a natural medium, a synthetic medium, or a selective medium.

The present invention also provides a plant transformed with the pollen-specific expression vector according to the present invention or a transformed cell transformed with the expression vector.

In the present invention, the plant body may be a monocotyledonous plant (Monocotyledoneae). The monocotyledonous plant is one of a large group of angiosperm plants among flowering plants, and refers to a plant having only one cotyledon, and is also referred to as a monocotyledonous plant. The monocotyledonous plants are Acorales, Alismatales, Petrosaviales, Dioscoreales, Pandanales, Liliales, Asparagales, Palm ( Arecales), rice tree (Poales), ginger tree (Zingiberales), and chicken head grass tree (Commelinales) may be any one plant selected from the group consisting of. Examples of the monocotyledonous plants include rice, reeds, corn, grass, barley, wheat, millet, sorghum, oats, rye, sugar cane, blood, bamboo, foxtail, orchid, reed, cattail, silver grass, garlic, tulips, shoots, irises , lily, millet, adlay, barraengi, dalgaebi, common fan, agave, hongjuk, gwaneumjuk, mountain garlic, flower swallow, bijjaru, and chickadee, but are not limited thereto. In the present invention, it may be more preferably rice (Oryza sativa).

In the present invention, the term "rice" has the scientific name Oryza sativa L., and is an annual herbaceous plant, and the rice in the present invention is selected from the group consisting of Japonica type, Indica type and Javanica type can be any one of them.

In addition, the plant body includes whole plants, plant organs (eg, leaves, stems, flowers, roots, etc.), seeds and plant cells (including tissue culture cells) and their offspring. Classes of plants that can be used in the method of the present invention are broad, such as classes of higher plants generally applicable to transformation techniques, and certain lower plants such as algae. This includes plants of various levels of ploidy, including polyploid, diploid and haploid.

Accordingly, the present invention provides seeds of transgenic plants according to the present invention.

In the present invention, the "transformation" refers to the introduction of DNA into cells. A cell is termed a “host cell,” and it may be a prokaryotic or eukaryotic cell. Representative prokaryotic host cells include various strains of E. coli. The introduced DNA is usually in the form of a vector containing a piece of DNA into which the DNA has been inserted. The introduced DNA sequence may originate from the same species as the host cell, or from a species different from the host cell, or it may be a hybrid DNA sequence containing some DNA from the host species and some foreign DNA.

The transformation method can be any method without limitation as long as it can be introduced into plants known in the art. For example, the calcium/polyethylene glycol method for protoplasts (see Plant Mol. Biol. 8, 363-373), electroporation of protoplasts (see 1985 Bio/Technol. 3, 1099-1102), and microinjection into plant elements. (see Mol. Gen.Genet. 202, 179-185), (DNA or RNA-coated) particle bombardment of various plant elements (see Nature 327, 70), infiltration of plants or transformation of mature pollen or microspores. infection by (incomplete) virus in Agrobacterium tumefaciens mediated gene transfer by Agrobacterium tumefaciens (see European Patent No. EP 0301316);

Optimal procedures for plant transformation with Agrobacterium vectors vary depending on the type of plant to be transformed. Exemplary methods for Agrobacterium-mediated transformation include transformation of explants of hypocotyl, shoot tip, stem, leaf or flower tissue derived from sterile seedlings and/or small plants. Such transformed plants can be propagated sexually or by cell or tissue culture. Agrobacterium mediated transformation has previously been described for a number of different plant species and methods for such transformation can be found in the literature known in the art. As the Agrobacterium strain for plant transformation that can be used in the present invention, any strain commonly used can be used.

In addition, the present invention is a step of introducing a vector containing a pollen-specific expression promoter according to the present invention and a foreign gene operatively linked thereto into a plant; A manufacturing method is provided.

The production method may further include selecting a plant transformant in which the vector is introduced and the gene is specifically expressed in pollen.

In the plant transformant prepared by the production method according to the present invention, the foreign gene is expressed in pollen by the pollen-specific expression promoter according to the present invention, and thus, pollen development may be improved or male sterility may be exhibited.

In addition, the present invention is a step of introducing a vector containing a pollen-specific expression promoter according to the present invention and a foreign gene operatively linked thereto into a plant; provides a way

In the method for expressing the exogenous gene, expression of the exogenous gene is induced in the middle to late stages of pollen development according to the characteristics of the promoter according to the present invention.

The contents of the present invention described above are equally applied to each other unless contradictory to each other, and implementation by adding appropriate changes by a person skilled in the art is also included in the scope of the present invention.

Hereinafter, the present invention will be described in detail through examples, but the scope of the present invention is not limited only to the following examples.

Example 1. Rice plant preparation and pollen germination conditions

Dongjinbyeo (O. sativa ssp. japonica) cv. Dongjin, a japonica variety, and the resulting transgenic plants were placed in a greenhouse and rice field ( paddy field).

Pollen germination was performed by referring to the method of a known literature (BMC plant biology 20.1 (2020): 1-15. Reference). First, pollen from dehiscenced rice stamens was collected on a solid germination medium. For this, 20% sucrose, 10% PEG, 3 mM calcium nitrate, 40 mg/L boric acid, 10 mg/L vitamin B1 and 1% agar A solid medium containing was used. The collected pollen was placed in an incubator at 28° C. for 10 to 30 minutes to induce germination.

Example 2. Rice Os03g52870 Promoter region cloning and sequencing of genes

For the construction of a pollen-specific expression promoter, a fragment containing a promoter region 2075 bp upstream from the start codon together with 1473 bp of the rice Os03g52870 gene coding region was amplified by PCR.

For cloning in pGA3519 and pGA3427 in Dongjinbyeo, a wild type of rice, amplification was performed using the primers shown in Table 2, respectively.

In order to increase the accuracy of the PCR reaction, PrimeSTAR ^® GXL DNA polymerase was used, and the amplified sequence was analyzed through the Sanger sequencing method. The analyzed nucleotide sequence was cloned ^{into each vector using In-fusion ® HD} PCR cloning kit. The cloned plasmid was subjected to base analysis using the Sanger sequencing method.

vector Primer name sequence (5'-3') sequence number GUS construct pGORI-in fusion-5′ TAACGAGCTCTAGAGGATCCAATAGCCTCGACGACAACTTCATC 4 pGORI-in fusion-3′ GGCCTGACCTACCCGGGGATCCTCGCGGAACGACGAGCTGCT 5 YFP construct pGORI-3427-BamHI TACCTATTTCCGCCCGGATCCAATAGCCTCGACGACAACTTCATC 6 pGORI-3427-HindIII GCGTTGTACACGTACGAAGCTTGCGGAACGACGAGCTGCT 7

Example 3. Construction of a vector for pollen-specific expression

A recombinant vector containing the promoter and GUS was constructed. To construct the rice Os03g52870 gene-derived promoter (GORI promoter, pGORI) and GUS (β-glucuronidase) fusion vector (GORI promoter-driven GUS fusion vector (pGUS:uidA)), the promoter region prepared in Example 2 was phospho- It was cloned into the BamHI-treated binary vector pGA3519 using the In-fusion HD PCR Cloning Kit (Takara, cat.no.639648).

To construct a rice Os03g52870 gene-derived promoter and yellow fluorescent protein (YFP) fusion vector (YFE tag fusion vector (pGORI:GORI-YFP)), pUbi:YFP modified from pGA3427 was used to convert pUbi to pGORI at BamHI and HindIII sites Replaced with the :GORI fragment.

Example 4. Rice Transformation

Transformation of Dongjinbyeo was performed through Agrobacterium tumefaciens (A.tumefaciens) mediated co-cultivation using callus.

2 μg of the pollen-specific expression vector pGUS:uidA or pGORI:GORI-YFP constructed in Example 3 was mixed with competent cells (Agrobacterium tumefaciens LB4404) and left on ice for 15 minutes. Then, after putting it in liquid nitrogen for 75 seconds, it was left in a 37 ° C oven for 5 minutes, and 1 ml of LB (Luria-Bertani broth) liquid medium was added thereto, and then cultured in a shaking incubator at 28 ° C for 3 hours. . Thereafter, the cells were plated on tetracycline-resistant LB solid medium, and colonies formed after 36 hours were confirmed by PCR.

The resulting transformed Agrobacterium was used in rice transformation experiments. Dongjinbyeo seeds were grown for about 7 days on N6D solid medium in a growth room at 28° C. to generate rice callus. The resulting callus was mixed with Agrobacterium cells transformed with the pGA2707 plant expression vector cultured for 72 hours, and cultured in a medium containing N6D-acetosyringone in a growth room at 22°C in the dark. .

After washing the callus contaminated with Agrobacterium 5 times with tertiary distilled water, Hygro was passed through the 1st (hygromycin 30 mg/L) and 2nd (hygromycin 40 mg/L) subcultures under N6D solid medium. Hygromycin selection was performed. The hygromycin selection was performed for 4 weeks in a 28° C. growth room (2 weeks for each order). After transferring the split callus to MSR (hygromycin 40 mg/L) solid medium, which is a regeneration medium, and inducing regeneration in a growth room under 28°C light conditions for 4 weeks, the plants were transferred to MS solid medium and grown in a growth room under 28°C light conditions for 7 days Then, they were transferred to a greenhouse and regenerated plants were grown.

Example 5. Confirmation of expression of rice transformants

5-1. Expression confirmation method

Expression of each tissue of the rice transformants according to Example 4 was analyzed through histochemical staining using GUS staining. Tissues containing 7-day-old seedlings and spikelets of various stages were immersed in GUS staining solution (see J. Plant Biol. 62, 82-91.). After culturing the tissue at 37° C. for 2 hours, chlorophyll was removed using 70% ethanol. The samples were photographed using a SZX61 microscope, a Canon camera and an Olympus BX61 microscope.

In addition, the expression of the YFP fluorescent protein in the transformed rice germinated in the solid phase PGM was confirmed using a confocal scanning laser microscope (CSLM). YFP fluorescence was detected using a 514/>530 nm excitation/emission filter set. Fluorescent images were digitized using the Zeiss LSM image browser.

In addition, to visualize the plasma membrane (PM), the germinated pollen was stained with FM4-64 (Invitrogen) at a final concentration of 10 μM and examined under a BX61 microscope or a confocal scanning laser microscope (CSLM (LSM 510 META). , Carl Zeiss) and observed in a red fluorescent protein (RFP) channel RFP fluorescence was detected using an excitation/emission filter set of 543/560-615 nm.

5-2. Identification of specific expression in pollen grains and pollen tubes of transgenic rice plants

As a result of examining the expression pattern of rice plants transformed with the recombinant vector pGUS:uidA through GUS staining, expression of GUS was mainly detected in the anther at the maturation stage of pollen grains, whereas other expression patterns including the anther wall were detected. It was confirmed that GUS staining was not observed in somatic tissue (FIG. 2a). In addition, weak GUS staining was observed in immature microspores, moderate staining was observed in bicellular pollen, and strong staining was observed in mature and germinated pollen (Fig. 2b).

In addition, expression patterns of rice plants transformed using the recombinant vector pGORI:GORI-YFP were examined and shown in FIGS. 3 and 4a to 4g.

As a result, the YFP fluorescent protein signal appeared at a detectable level in the 2 nuclear phase pollen and at a high level in the tricellular mature pollen. However, it was not detected on the anther wall (Fig. 3).

In addition, when PTs began to germinate, GORI-YFP was distributed throughout the cytoplasm of germinated tubes (Fig. 4a). In addition, GORI-YFP was mainly localized in the cytoplasm in the elongated PT, and occasionally spots appeared (FIGS. 4d to 4f). In contrast, in tubes in which rapid elongation was stopped, GORI-YFP was preferentially present at the tube shank and apical tip (FIGS. 4g and 4h). In addition, a small speckled vesicle-like structure was observed in the growing tube (Fig. 4g).

Overall, in the rice plants transformed using the vector containing the rice gene-derived promoter according to the present invention, high expression was confirmed in pollen granules and in mature pollen at the 2 nucleus stage and 3 nucleus stage, and throughout the cytoplasm of germinated pollen tubes. The distribution of was confirmed. Therefore, since the vector containing the promoter of the present invention exhibits pollen-specific expression, it is useful for cultivating productivity-enhancing crops by improving pollen development of major grains including rice or monocotyledonous plants or cultivating male sterile plants. can be utilized

<110> University-Industry Cooperation Group of Kyung Hee University Pusan National University Industry-University Cooperation Foundation Kyungpook National University Industry-Academic Cooperation Foundation <120> Pollen specific expression promoter from Oryza sativa Os03g52870 <130> 1-57P <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 2056 <212> DNA <213> artificial sequence <220> <223> Os03g52870 promoter <400> 1 aatagcctcg acgacaactt catctacgcc acgcggacgc tgctgttcct gcgcggcgac 60 ggcacgctgg cgccgctcgc catcgagctg agcttgccgc acctgcagga cgacgggctg 120 atcaccgcca ggagcaccgt gtacacgccg gcggcgcgcg gcggcaccgg cgccggcgcc 180 gtggagtggt gggtgtggca gctcgccaag gcgtacgtca acgtgaacga ctactgctgg 240 caccagctga tcagccactg gctcaacacg cacgccgtga tggagccctt cgtcatcgcc 300 accaaccggc agctcagcgt ggcgcacccg gtgcacaagc tgctgctgcc gcactaccgc 360 gacaccatga ccatcaacgc gctggcgcgg cagacgctca tcaacggcgg cggcatcttc 420 gagatgaccg tgttcccgcg gaagcacgcg ctcgccatgt cgtcggcgtt ctacaaggac 480 tggagcttcg ccgaccaggc gctccccgac gaccttgtca agcgcggcgt cgcggtgccg 540 gacccggcga gcccgtacaa ggtgcggctg ctcatcgagg actacccgta cgccaacgac 600 gggctggccg tctggcacgc catcgagcag tgggccaccg agtacctcgc catctactac 660 cccaacgacg gcgtgctcca gggcgacgcc gagctgcagg cgtggtggaa ggaggtccgc 720 gaggtcgggc atggcgacat caaggacgcg acgtggtggc cggagatgaa gacggtggcg 780 gagctggtca aggcgtgcgc caccatcatc tggatcgggt ccgcgctgca cgccgccgtc 840 aacttcgggc agtacccgta cgccgggtac ctcccgaacc gtccgtcggt gagccggcgg 900 ccgatgccgg agccgggaac gaaggagtac gacgagctgg cgcgcgatcc ggagaaggtg 960 ttcgtccgga caatcaccaa gcagatgcag gccatcgtgg ggatctcgct gctggagatc 1020 ctgtccaagc actcctccga cgaggtgtac ctcggacagc gcgacacgcc ggagtggacg 1080 tcggacgcca aggcgctgga ggcgttcaag cggttcggcg cgcggctgac ggagatcgag 1140 agccgcgtcg tcgccatgaa caaggacccc caccgcaaga accgtgtcgg gccgaccaat 1200 ttcccctaca cgctgctcta cccaaacacc tccgacctca agggcgacgc tgccggcctc 1260 tccgccaggg gcatccccaa cagcatctcc atctgatctc catctcatca gatgaggctg 1320 ctccacggag gcgccagcgt ggacaagagt agttttacgg tggtctttac cggtagtatt 1380 ttactttcaa taattgccat gacacctaca cccggagcgt tgtgtaattt ccctttcagt 1440 tcctaataaa gaataaggaa gcatatggtt gtgtagcatt ttcaagcaaa tcctccatat 1500 atctaccatg ttttgaattg aaaggactga attaccgaaa atcctttgat gaacattatc 1560 tgaagactta ataagttgga ttaatgtcta acaaaccatt aagtgattta aattgtctgt 1620 aaactgatgg caacaatatg aacaaagagc aaaccactag tgaatgtgaa tcaagccaat 1680 agaactcatc tcaggtcata actgaatgat gtgaactgtc agtaaactga ggctattctt 1740 gatgcctttc tcctattttc ttatactaaa cattttaatc aggcaaaata gcattttcta 1800 agtttggtta gcctcctaaa ccgacgaaag ggagcaatcc gagggaagtg gggcccaccg 1860 tttcttcccc gccccaacct cgcaacggtc tcaacacttt tctcgcttcc cgccattttc 1920 tcgtcgcctc acactcccct cccctccaca catacacacc caacgctctc ccacacctct 1980 cgcagttctc tcttcttccc cccctcatct ccgccgcctc gccgcgaacg ggacgccggc 2040 caagagctcg aagctg 2056 <210> 2 <211> 1467 <212> DNA <213> artificial sequence <220> <223> Os03g52870 CDS <400> 2 atgagagata gcgacggcga aggggccggc ggcggcctcc cgcgctcgca cccgtcgaac 60 ctgccgctgc cggcgccgca ctccgaccca aacctccagt tctccgggac ggacgatgac 120 ttctccaacc gtcacagcag ctcgtcggcg acgggcggcg cgagccccgg gtactactcc 180 gactacccgt ccagcttcag cggcgagtgc tcgccgtaca acatgtcgcc ctggaaccag 240 accatggcgt cgccgtggtc gcaccacagc gacgcgtcca tggccgggct cggcggcgcg 300 cccgccatgg cgcccgggac cagcctcatc ggctcgctgg tgagggagga agggcacatc 360 tactcgctcg ccgccaagac cgacaccctg tacaccggct ccgacagcaa gaacatccgc 420 gtgtggcgca agcagaagga ttccggcggg ttcaagtcgt cgagcggcct cgtcaaggcc 480 atcgtcatct ccggcgagcg catcttcacc gggcaccagg acggcaagat cagggtgtgg 540 aaggtgtcgc ccaagaacgg cctgcacaag cgcgtcggca gcctgccccg gctgcgcgac 600 ttcctccgcg gctcgctcaa cccgtccaac tacgtcgagg tccgcaagaa ccggacggcg 660 ctctggatcc gccacagcga cgccgtgtcg tgcctgagcc cgacggactc ggcgcagggc 720 ctgctctact ccggctcgtg ggaccggacc ttcaaggtgt ggcggatcaa cgactccaag 780 tgcctcgagt ccgtggtggc gcacgacgac aacgtgaacg ccatcgtggc agcgttcgac 840 gggctggtgt tcaccgggtc ggcggacggg acggtgaagg tgtggaagag ggagctgcag 900 gggaaaggga ccaagcacgt cgcggtgcag acgctgctga agcaggagca cgcggtgaac 960 gcgctcgccg tgagcgccgt cgcgccggtg ctctactgcg gctcctccga cgggctcgtc 1020 aacttctggg aaggggagcg ccacctggtc cacggcggcg tgctgcgcgg gcacaagaag 1080 gccgtgttct gcctcgccgc cgcgggctcc ctcctcctca gcggctccgc cgacaacacc 1140 atctacgtgt ggcggcgcga cggcggcgtc cactcctgcc tctccgtgct caccggccac 1200 accgagccga tcaggtgcct cgccatcgtc gaggacaaca aggacaacgc cgccgtgccc 1260 gtcgacgccg tggacagcag cttcgcgtcg ggctcgtcca cgcggtggat tgtgtacagc 1320 ggcagcctcg acaagtcgat caaggtgtgg cgcgtcgccg aggacgcgcc tgacgcgctg 1380 ctccgtggcc ccggtggcgg cgacgcgccg cagatgttcg accggtaccc cggcgaccca 1440 ttcggcgcca gcagctcgtc gttccgc 1467 <210> 3 <211> 3523 <212> DNA <213> artificial sequence <220> <223> Os03g52870 promoter and CDS <400> 3 aatagcctcg acgacaactt catctacgcc acgcggacgc tgctgttcct gcgcggcgac 60 ggcacgctgg cgccgctcgc catcgagctg agcttgccgc acctgcagga cgacgggctg 120 atcaccgcca ggagcaccgt gtacacgccg gcggcgcgcg gcggcaccgg cgccggcgcc 180 gtggagtggt gggtgtggca gctcgccaag gcgtacgtca acgtgaacga ctactgctgg 240 caccagctga tcagccactg gctcaacacg cacgccgtga tggagccctt cgtcatcgcc 300 accaaccggc agctcagcgt ggcgcacccg gtgcacaagc tgctgctgcc gcactaccgc 360 gacaccatga ccatcaacgc gctggcgcgg cagacgctca tcaacggcgg cggcatcttc 420 gagatgaccg tgttcccgcg gaagcacgcg ctcgccatgt cgtcggcgtt ctacaaggac 480 tggagcttcg ccgaccaggc gctccccgac gaccttgtca agcgcggcgt cgcggtgccg 540 gacccggcga gcccgtacaa ggtgcggctg ctcatcgagg actacccgta cgccaacgac 600 gggctggccg tctggcacgc catcgagcag tgggccaccg agtacctcgc catctactac 660 cccaacgacg gcgtgctcca gggcgacgcc gagctgcagg cgtggtggaa ggaggtccgc 720 gaggtcgggc atggcgacat caaggacgcg acgtggtggc cggagatgaa gacggtggcg 780 gagctggtca aggcgtgcgc caccatcatc tggatcgggt ccgcgctgca cgccgccgtc 840 aacttcgggc agtacccgta cgccgggtac ctcccgaacc gtccgtcggt gagccggcgg 900 ccgatgccgg agccgggaac gaaggagtac gacgagctgg cgcgcgatcc ggagaaggtg 960 ttcgtccgga caatcaccaa gcagatgcag gccatcgtgg ggatctcgct gctggagatc 1020 ctgtccaagc actcctccga cgaggtgtac ctcggacagc gcgacacgcc ggagtggacg 1080 tcggacgcca aggcgctgga ggcgttcaag cggttcggcg cgcggctgac ggagatcgag 1140 agccgcgtcg tcgccatgaa caaggacccc caccgcaaga accgtgtcgg gccgaccaat 1200 ttcccctaca cgctgctcta cccaaacacc tccgacctca agggcgacgc tgccggcctc 1260 tccgccaggg gcatccccaa cagcatctcc atctgatctc catctcatca gatgaggctg 1320 ctccacggag gcgccagcgt ggacaagagt agttttacgg tggtctttac cggtagtatt 1380 ttactttcaa taattgccat gacacctaca cccggagcgt tgtgtaattt ccctttcagt 1440 tcctaataaa gaataaggaa gcatatggtt gtgtagcatt ttcaagcaaa tcctccatat 1500 atctaccatg ttttgaattg aaaggactga attaccgaaa atcctttgat gaacattatc 1560 tgaagactta ataagttgga ttaatgtcta acaaaccatt aagtgattta aattgtctgt 1620 aaactgatgg caacaatatg aacaaagagc aaaccactag tgaatgtgaa tcaagccaat 1680 agaactcatc tcaggtcata actgaatgat gtgaactgtc agtaaactga ggctattctt 1740 gatgcctttc tcctattttc ttatactaaa cattttaatc aggcaaaata gcattttcta 1800 agtttggtta gcctcctaaa ccgacgaaag ggagcaatcc gagggaagtg gggcccaccg 1860 tttcttcccc gccccaacct cgcaacggtc tcaacacttt tctcgcttcc cgccattttc 1920 tcgtcgcctc acactcccct cccctccaca catacacacc caacgctctc ccacacctct 1980 cgcagttctc tcttcttccc cccctcatct ccgccgcctc gccgcgaacg ggacgccggc 2040 caagagctcg aagctgatga gagatagcga cggcgaaggg gccggcggcg gcctcccgcg 2100 ctcgcacccg tcgaacctgc cgctgccggc gccgcactcc gacccaaacc tccagttctc 2160 cgggacggac gatgacttct ccaaccgtca cagcagctcg tcggcgacgg gcggcgcgag 2220 ccccgggtac tactccgact acccgtccag cttcagcggc gagtgctcgc cgtacaacat 2280 gtcgccctgg aaccagacca tggcgtcgcc gtggtcgcac cacagcgacg cgtccatggc 2340 cgggctcggc ggcgcgcccg ccatggcgcc cgggaccagc ctcatcggct cgctggtgag 2400 ggaggaaggg cacatctact cgctcgccgc caagaccgac accctgtaca ccggctccga 2460 cagcaagaac atccgcgtgt ggcgcaagca gaaggattcc ggcgggttca agtcgtcgag 2520 cggcctcgtc aaggccatcg tcatctccgg cgagcgcatc ttcaccgggc accaggacgg 2580 caagatcagg gtgtgggaagg tgtcgcccaa gaacggcctg cacaagcgcg tcggcagcct 2640 gccccggctg cgcgacttcc tccgcggctc gctcaacccg tccaactacg tcgaggtccg 2700 caagaaccgg acggcgctct ggatccgcca cagcgacgcc gtgtcgtgcc tgagcccgac 2760 ggactcggcg cagggcctgc tctactccgg ctcgtgggac cggaccttca aggtgtggcg 2820 gatcaacgac tccaagtgcc tcgagtccgt ggtggcgcac gacgacaacg tgaacgccat 2880 2940 gaagagggag ctgcagggga aagggaccaa gcacgtcgcg gtgcagacgc tgctgaagca 3000 ggagcacgcg gtgaacgcgc tcgccgtgag cgccgtcgcg ccggtgctct actgcggctc 3060 ctccgacggg ctcgtcaact tctgggaagg ggagcgccac ctggtccacg gcggcgtgct 3120 gcgcgggcac aagaaggccg tgttctgcct cgccgccgcg ggctccctcc tcctcagcgg 3180 ctccgccgac aacaccatct acgtgtggcg gcgcgacggc ggcgtccact cctgcctctc 3240 cgtgctcacc ggccacaccg agccgatcag gtgcctcgcc atcgtcgagg acaacaagga 3300 caacgccgcc gtgcccgtcg acgccgtgga cagcagcttc gcgtcgggct cgtccacgcg 3360 gtggattgg tacagcggca gcctcgacaa gtcgatcaag gtgtggcgcg tcgccgagga 3420 cgcgcctgac gcgctgctcc gtggccccgg tggcggcgac gcgccgcaga tgttcgaccg 3480 gtaccccggc gacccattcg gcgccagcag ctcgtcgttc cgc 3523 <210> 4 <211> 44 <212> DNA <213> artificial sequence <220> <223> pGORI-in fusion-5' <400> 4 taacgagctc tagaggatcc aatagcctcg acgacaactt catc 44 <210> 5 <211> 42 <212> DNA <213> artificial sequence <220> <223> pGORI-in fusion-3' <400> 5 ggcctgacct acccggggat cctcgcggaa cgacgagctg ct 42 <210> 6 <211> 45 <212> DNA <213> artificial sequence <220> <223> pGORI-3427-BamHI <400> 6 tacctatttc cgcccggatc caatagcctc gacgacaact tcatc 45 <210> 7 <211> 40 <212> DNA <213> artificial sequence <220> <223> pGORI-3427-HindIII <400> 7 gcgttgtaca cgtacgaagc ttgcggaacg acgagctgct 40

Claims (13)

A plant pollen-specific expression promoter consisting of the nucleotide sequence represented by SEQ ID NO: 1.
According to claim 1,
The promoter is characterized in that the nucleotide sequence represented by SEQ ID NO: 2 is further linked, the promoter.
According to claim 2,
The promoter is characterized in that consisting of the nucleotide sequence represented by SEQ ID NO: 3, the promoter.
A plant pollen-specific expression vector comprising the promoter according to any one of claims 1 to 3.
A transformed cell transformed with the expression vector of claim 4.
A plant transformed with the expression vector of claim 4 or a transformed cell transformed with the expression vector.
According to claim 6,
The transformed plant, characterized in that the plant is a monocotyledonous plant.
According to claim 7,
The monocot plants are rice, reeds, corn, grass, barley, wheat, millet, sorghum, oats, rye, sugar cane, blood, bamboo, foxtail, orchid, reed, cattail, silver grass, garlic, tulips, dandelion, iris, lily , Transformed plants, characterized in that any one selected from the group consisting of millet, adlay, indica, dalgaebi, common fan, agave, hongjuk, gwaneumjuk, mountain garlic, kkotjebi, bijjaru and chickadee.
Seeds of the transgenic plants of claim 6.
A step of introducing a vector containing a pollen-specific expression promoter according to any one of claims 1 to 3 and a foreign gene operatively linked thereto into a plant; exhibiting pollen-specific expression comprising A method for producing plant transformants.
According to claim 10,
Characterized in that, the production method further comprises; selecting a plant transformant in which the vector is introduced and the gene is specifically expressed in pollen.
A step of introducing a vector comprising a pollen-specific expression promoter according to any one of claims 1 to 3 and a foreign gene operatively linked thereto into a plant; How to express a gene.
According to claim 12,
The method, characterized in that the exogenous gene expression is induced in the middle to late stages of pollen development.

Images