KR20230162423A - Expressible promoter in Esteya vermicola and uses thereof - Google Patents

Abstract

The present invention can be expressed in Esteya vermicola It relates to promoters and their uses.
The promoter of the present invention has been confirmed to have excellent expression intensity in Esteja vermicola, so it can be applied when expressing a target protein in Esteja vermicola.

Description

Promoter expressible in Esteya vermicola and uses thereof {Expressible promoter in Esteya vermicola and uses thereof}

The present invention can be expressed in Esteya vermicola It relates to promoters and their uses.

Esteya vermicola is known to be an endoparasitic fungus with great potential as a biological control agent against Bursaphelenchus xylophilus , which causes pine wilt disease.

There have been attempts to discover promoters in the strain, but the promoters previously discovered in Esteja vermicola were somewhat limited in terms of gene expression. In particular, the present inventors attempted to express multiple genes by linking promoters previously discovered from Esteja vermicola to genes, but found that deletion occurred due to undesired homologous recombination. , it was confirmed through Sanger sequencing that deletion occurred even when the same promoter as above was used repeatedly (Figure 1).

Accordingly, there has been a need to discover a promoter that can be expressed in Esteja vermicola.

Under this background, the present inventors selected a promoter with excellent expression ability without causing gene deletion in Esteja vermicola and confirmed that it was possible to use this to express a gene encoding a target protein in Esteja vermicola. The present invention has been completed.

1. Z. Wang, et al., J Nematol. 2017 Mar; 49(1): 86-91.

One object of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; and a gene encoding a target protein operably linked to the polynucleotide.

Another object of the present invention is a polynucleotide of SEQ ID NO: 1 or 2 having promoter activity; and a gene encoding a target protein operably linked to the polynucleotide, to provide a composition for transfection of a microorganism of the Estella genus.

Another object of the present invention is to provide an expression vector for microorganisms of the Estella genus, containing the gene expression cassette of the present invention.

Another object of the present invention is to provide a composition for transformation of microorganisms of the Estella genus, comprising the expression vector of the present invention.

Another object of the present invention is to provide a microorganism of the Estella genus, which contains the gene expression cassette of the present invention or a vector containing the expression cassette.

Another object of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; and introducing an expression cassette containing a gene encoding a target protein operably linked to the polynucleotide into a microorganism of the Estella genus.

Another object of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; and introducing an expression cassette containing a gene encoding a target protein operably linked to the polynucleotide into a microorganism of the Estella genus.

Another object of the present invention is i) cultivating a microorganism of the Estella genus of the present invention; and ii) obtaining an expression of a gene encoding a target protein from the cultured microorganism.

Another object of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; And an expression cassette for a microorganism of the Estella genus, comprising a gene encoding a target protein operably linked to the polynucleotide; Or an expression vector containing the same; to provide a composition for producing a target material, including a microorganism of the Estella genus or a medium in which the same is cultured.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

Additionally, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Additionally, such equivalents are intended to be encompassed by this invention.

One aspect of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; And it provides an expression cassette for a microorganism of the Esteya genus, comprising a gene encoding a target protein operably linked to the polynucleotide.

Another aspect of the present invention is a polynucleotide of SEQ ID NO: 1 or 2 having promoter activity; and a gene encoding a target protein operably linked to the polynucleotide.

In the present invention, the microorganism of the Esteya genus may be, for example, Esteya vermicola , Esteya floridanum , etc., and may specifically be Esteya vermicola. Not limited.

In the present invention, the term " Esteya vermicola" is a parasitic fungus, an internal parasite with great potential as a biological control agent against Bursaphelenchus xylophilus , which causes pine wilt disease. It is known as an endoparasitic fungus.

Conventionally, the promoter discovered from Esteya vermicola causes deletion due to undesired homologous recombination when linked to a gene and expressed, and deletion occurs even when the same promoter as above is used repeatedly. It was confirmed through sequence analysis (sanger sequencing) (Figure 1).

Accordingly, there has been a need to discover a promoter capable of expression in Esteja vermicola, and the present invention selects a promoter with excellent expression ability without causing gene deletion in Esteja vermicola, and uses this to It is significant in that it was confirmed for the first time that a gene encoding a target protein can be expressed.

In the present invention, the term "promoter" refers to an untranslated nucleotide sequence upstream of the coding region that contains a binding site for polymerase and has transcription initiation activity into the mRNA of the promoter target gene, that is, the polymerase It refers to a DNA region that binds to initiate transcription of a gene. The promoter may be located at the 5' region of the mRNA transcription start site.

In the present invention, the term "polynucleotide with promoter activity" refers to the gene to be operably linked, that is, near the transcription site of the target gene, including the site where RNA polymerase or enhancer binds for expression of the target gene. It refers to the existing DNA region. For the purpose of the present invention, the polynucleotide can be used as a universal promoter, and the polynucleotide can be used to express, in a cell, a target gene operably linked thereto, compared to an existing promoter or a cell-intrinsic promoter, for the purpose. The production and/or activity of a protein encoded by a gene may be regulated (e.g., increased or decreased), and the target product involved in the production of the protein (e.g., amino acids, nucleic acids, vitamins, proteins, fatty acids, and It may be, but is not limited to, controlling (e.g., increasing or decreasing) the production and/or activity of organic acids, etc.).

The polynucleotide of the present invention may be included without limitation as long as it is a polynucleotide sequence having promoter activity.

As an example, the polynucleotide having promoter activity of the present invention may include the polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2. Specifically, in the present invention, the polynucleotide having promoter activity may be a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2.

In the present invention, the polynucleotide sequence of SEQ ID NO: 1 is an example of a polynucleotide having promoter activity of the elongation factor 1-alpha gene (TEF1). In the present invention, the polynucleotide sequence of SEQ ID NO: 2 is an example of a polynucleotide having the promoter activity of fructose-bisphosphate aldolase, class II.

The nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 can be confirmed in NCBI Genbank, a known database, and the sequence corresponding to SEQ ID NO: 1 may be derived from Aspergillus sp., Specifically, it may be derived from Aspergillus nidlulans , but a sequence having the same or higher activity as the polynucleotide may be included in the promoter of the present invention without limitation. The sequence corresponding to SEQ ID NO: 2 may be derived from Aspergillus sp., and specifically may be derived from Aspergillus flavus , but may have an activity equal to or greater than that of the polynucleotide. The sequence may be included in the promoter of the present invention without limitation.

As a more specific example, the polynucleotide having promoter activity of the present invention may include or (essentially) consist of the polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2.

In addition, without being limited to the above-described embodiments, various modifications may be included in the polynucleotide sequence as long as they do not significantly reduce promoter activity. As an example, as long as it has promoter activity, a polynucleotide in which a specific nucleotide is substituted in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 may also be included in the polynucleotide having promoter activity of the present invention. As another example, the nucleotide sequence of the present invention may be modified by conventionally known mutagenesis methods, such as directed evolution and site-directed mutagenesis.

At this time, the term “mutation” refers to a genetically or non-genetically stable phenotypic change, and may be used interchangeably with “transformation” or “mutation” in this specification.

In the present invention, the polynucleotide having promoter activity is SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 1 or SEQ ID NO: 2 and at least 70%, 80%, 85%, 90%, 95%, 96%, 97 It may be a polynucleotide sequence having homology or identity of %, 98%, or 99% or more.

Meanwhile, in the present invention, even if it is described as 'polynucleotide having a nucleotide sequence described in a specific sequence number' or 'polynucleotide containing a nucleotide sequence described in a specific sequence number', it is the same as a polynucleotide composed of the nucleotide sequence described in the corresponding sequence number. Alternatively, it is obvious that a polynucleotide having a nucleotide sequence in which some sequences are deleted, modified, substituted, or added can also be used in the present invention if it has a corresponding activity.

For example, if it has the same or equivalent activity as the above polynucleotide, a meaningless sequence is added inside or at the end of the nucleotide sequence of the corresponding sequence number, or a polynucleotide in which a part of the sequence inside or at the end of the nucleotide sequence of the corresponding sequence number is deleted It is obvious that it also falls within the scope of this application.

Polynucleotides having promoter activity of the present invention can be isolated or prepared using standard molecular biology techniques. For example, it can be manufactured using standard synthesis techniques using an automated DNA synthesizer, but is not limited thereto.

A polynucleotide having promoter activity of the present invention can be used as a promoter.

The promoter may be located at the 5' region of the transcription start site into mRNA.

The promoter may have increased or decreased promoter activity compared to conventional promoters. That is, it can increase or decrease not only the expression of the target gene in the host cell, but also the expression and/or activity of the protein (eg, target protein) encoded by the target gene. For the purpose of the present invention, the target gene for enhancing or attenuating expression can be changed depending on the substance to be produced, and the promoter can be used as a universal promoter for enhancing or attenuating the target gene.

In the present invention, the term “gene expression cassette” refers to a unit cassette that includes a promoter and a target gene and is capable of expressing the target gene operably linked downstream of the promoter. Various factors that can help efficient expression of the target gene may be included inside or outside such a gene expression cassette. The gene expression cassette may include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.

The “target gene” refers to a gene whose expression is to be controlled by the promoter sequence of the present invention for the purpose of the present invention. The protein encoded by the target gene can be expressed as a “target protein”, and the gene encoding the “target protein” can be expressed as a “target gene.”

In addition, the polynucleotide encoding the target protein may vary in the coding region within the range of not changing the polypeptide sequence due to codon degeneracy or in consideration of the codon preferred in the organism in which the polynucleotide is to be expressed. Transformations can occur.

Another aspect of the present invention provides an expression vector for a microorganism of the Estella genus, comprising the expression cassette of the present invention.

Another aspect of the present invention provides a composition for transformation of a microorganism of the Estella genus, comprising the expression vector.

The terms used here are the same as described above.

In the present invention, the term "vector" refers to an artificial DNA molecule that holds genetic material so that a target gene can be expressed in a suitable host, and specifically, DNA containing the nucleotide sequence of a gene encoding a target protein operably linked thereto. It means manufactured product.

In the present invention, the term "operably linked" means that the polynucleotide having promoter activity of the present invention is functionally linked to the gene sequence to initiate and mediate transcription of the target gene. Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art, but are not limited thereto.

For the purposes of the present invention, the regulatory sequence may include a polynucleotide having the promoter activity of the present invention.

Meanwhile, the control sequence may include a promoter capable of initiating transcription, an optional operator sequence for controlling such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation. You can. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.

The vector used in the present invention is not particularly limited as long as it can be expressed in the host cell, and any vector known in the art can be used to transform the host cell. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. As an example, the vector may have an origin that allows replication in fungi.

For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used. , pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used, but are not limited to these. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used, but are not limited thereto. Additionally, the polynucleotide may be inserted into the chromosome by any method known in the art, for example, homologous recombination.

Since the vector of the present invention can be inserted into a chromosome by causing homologous recombination, it may additionally include a selection marker to confirm whether the chromosome is inserted. A selection marker is used to select cells transformed with a vector, that is, to check for insertion of a polynucleotide, and is a marker that confers selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins. Markers may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or show other expression traits, so transformed cells can be selected.

In the present invention, the term “transformation” refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoding the polynucleotide can be expressed within the host cell. As long as the transformed polynucleotide can be expressed in the host cell, it can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome. In addition, the polynucleotide includes DNA and RNA encoding the target protein, and may be introduced in any form as long as it can be introduced and expressed into a host cell. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all the elements necessary for its own expression, or in the form of a vector containing it.

The transformation method includes all methods of introducing a gene encoding the target protein into a cell, and can be performed by selecting an appropriate standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Examples include, but are not limited to, the lithium acetate-DMSO method.

Another aspect of the present invention provides a microorganism of the Estella genus, comprising the gene expression cassette of the present invention or a vector containing the expression cassette.

The terms used here are the same as described above.

A microorganism containing a gene expression cassette of the present invention or a vector containing the expression cassette may be a transformant.

As used herein, the term “transformant” refers to a host cell transformed with a recombinant expression vector containing a promoter of the present invention and a base sequence encoding a target protein operably linked to the promoter.

The transformant may be a microorganism, for example, it may be a microorganism of the Esteja genus, and as another example, it may be Esteja vermicola, Esteja floridanum, etc., and specifically may be Esteja vermicola. Not limited.

In the present invention, the term "microorganism" includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and a specific mechanism is weakened due to reasons such as insertion of foreign genes or strengthening or weakening of the activity of intrinsic genes. It is a concept that includes all modified or enhanced microorganisms. Specifically, the microorganism of the present invention may be a microorganism containing a polynucleotide having promoter activity of the present invention and a gene encoding a target protein.

In the present invention, the microorganism may include a polynucleotide having a promoter activity of the present invention, and specifically may include the polynucleotide and/or a gene operably linked to the polynucleotide and encoding a target protein. . Alternatively, the microorganism may include a vector containing the polynucleotide or gene expression control sequence and a gene encoding a target protein, but is not limited thereto. Additionally, the polynucleotide, the gene encoding the target protein, and the vector may be introduced into the microorganism by transformation, but are not limited thereto. Furthermore, as long as the microorganism can express the gene, it does not matter whether the gene encoding the polynucleotide and the target protein is located on or outside the chromosome.

By using the polynucleotide having promoter activity of the present invention as an expression control sequence of a gene encoding a target protein in a microorganism, the activity of the target protein can be enhanced.

The “enhancement of activity” may be an improvement in the activity of a specific protein of a microorganism compared to its intrinsic activity or activity before modification. “Intrinsic activity” may refer to the activity of a specific protein originally possessed by the parent strain before the change in characteristics when the characteristics of a microorganism change due to genetic mutation caused by natural or artificial factors.

Additionally, other activation enhancement methods can be used in combination. For example, in addition to using the polynucleotide sequence having promoter activity of the present invention as an expression control sequence of the gene encoding the target protein, the intracellular copy number of the gene encoding the target protein is increased, and the activity of the protein variant is increased. Methods such as a method of additionally introducing mutations into the amino acid sequence constituting the protein to enhance the activity of the protein variant and a method of additionally introducing mutations into the base sequence coding for the protein to enhance the activity of the protein variant may be used, but are not limited thereto. .

In the present invention, the term "unmodified microorganism" does not exclude strains containing mutations that may occur naturally in microorganisms, and is either a natural strain itself, a microorganism that does not contain a polynucleotide having the promoter activity of the present invention, or It also includes microorganisms that have not been transformed with a vector containing a polynucleotide having promoter activity of the present invention.

In addition, the microorganism of the present invention may refer to a microorganism capable of producing an excessive amount of the desired substance compared to a wild type or unmodified microorganism, including a polynucleotide having the promoter activity of the present invention. The “target substance” may be a target gene, a target protein encoded therefrom, and a product or metabolite produced therefrom. The metabolite may be a substance produced by the product exerting its activity within the cell. For example, if the product is an enzyme, it may be a direct product produced by the activity of the enzyme or a substance produced from the metabolic pathway to which the enzyme belongs. However, it is not limited thereto, and any increase by introducing a polynucleotide having the promoter activity of the present invention may be included within the scope of the present invention.

The present invention is characterized by the discovery of a promoter that can operate in microorganisms of the Estella genus. The microorganism of the present invention can express the target protein linked to the bottom of the promoter by containing the promoter of the present invention, for example, the target substance compared to the microorganism that contains another promoter, contains a wild-type promoter, or does not contain a promoter. production capacity may have increased. As an example, the microorganism of the present invention may have a target substance production capacity of at least 80%, 600%, 900%, or 2000% compared to a microorganism that does not contain a polynucleotide having promoter activity.

Another aspect of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; and introducing an expression cassette containing a gene encoding a target protein operably linked to the polynucleotide into a microorganism of the Estella genus.

Another aspect of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; and introducing an expression cassette containing a gene encoding a target protein operably linked to the polynucleotide into a microorganism of the Estella genus.

Another aspect of the present invention includes i) cultivating a microorganism of the Estella genus of the present invention; and ii) obtaining an expression of a gene encoding a target protein from the cultured microorganism.

The terms used here are the same as described above.

In the method of the present invention, step i) may be culturing the microorganism of the present invention. The microorganism of the present invention is as described above.

In the present invention, the term “culture” refers to growing microorganisms under appropriately artificially controlled environmental conditions. In the present invention, the method of producing the target substance using a microorganism containing the polynucleotide can be performed using a method widely known in the art. Specifically, the culture may be continuously cultured in a batch process, fed batch, or repeated fed batch process (fed batch or repeated fed batch process), but is not limited thereto. The medium used for culture must meet the requirements of the specific strain in an appropriate manner.

Sugar sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, and stearic acid. , fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These substances can be used individually or in mixtures, but are not limited thereto.

Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or in a mixture, but are not limited thereto.

Agents that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate that are necessary for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins may be used. Additionally, precursors appropriate for the culture medium may be used. The above-mentioned raw materials can be added to the culture in a batch or continuous manner in an appropriate manner during the cultivation process.

During the cultivation of the microorganism, the pH of the culture can be adjusted by using basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or acid compounds such as phosphoric acid or sulfuric acid in an appropriate manner. Additionally, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Oxygen or oxygen-containing gas (e.g., air) may be injected into the culture to maintain aerobic conditions.

The temperature of the culture (medium) is usually 20°C to 45°C, specifically 25°C to 40°C. The culturing time may continue until the desired amount of target substance is obtained, but may specifically be 10 to 160 hours.

The expression product of a gene produced by the method of the present invention may be the target substance.

Step ii) may be obtaining the expression of a gene encoding a target protein from a cultured microorganism.

For example, the expression product of the gene may be the gene encoding the target protein itself or the target protein expressed therefrom, and for another example, it may be a product or metabolite produced therefrom. The metabolites are as described above. However, it is not limited thereto, and any increase by introducing a polynucleotide having the promoter activity of the present invention may be included within the scope of the present invention.

The expression product of the gene produced by the culture of the present invention may be secreted into the medium or remain within the cell.

The method of the present invention includes preparing a microorganism of the present invention, preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, culturing the microorganism. Previously, it may be additionally included.

The method may further include the step of recovering the expression of the gene from the culture medium (medium in which the culture was performed) or from the microorganism. The recovering step may be additionally included after the culturing step.

The recovery may be to collect the expression product of the gene of interest using a suitable method known in the art according to the culture method of the strain of the present invention, for example, batch, continuous, or fed-batch culture method. there is. For example, centrifugation, filtration, crystallization, treatment with protein precipitants (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity. Various chromatographies such as chromatography, HPLC, or a combination of these methods can be used, and the expression product of the desired gene can be recovered from the medium or strain using a suitable method known in the art.

Additionally, the method may additionally include a purification step. The purification can be performed using a suitable method known in the art. In one example, when the method of the present invention includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously regardless of the order, or may be performed simultaneously or integrated into one step. However, it is not limited to this.

Another aspect of the present invention is a polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; And an expression cassette for a microorganism of the Estella genus, comprising a gene encoding a target protein operably linked to the polynucleotide; It provides a composition for producing a target substance, comprising a microorganism of the Estella genus or a medium culturing the same, or an expression vector containing the same.

The terms used here are the same as described above.

The composition may further include any suitable excipients commonly used in compositions for producing the target substance, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents. However, it is not limited to this.

The promoter of the present invention has been confirmed to have excellent expression intensity in Esteya vermicola, so it can be applied when expressing a target protein in Esteya vermicola.

Figure 1 shows the results confirming that gene deletion occurs when a promoter previously discovered from Esteya vermicola is overlapped and expressed by linking to a gene.
Figure 2 is a schematic diagram showing the vector production steps.
Figure 3 is a schematic diagram showing the expression intensity analysis experiment of each promoter expressed in Esteja vermicola.
Figure 4 shows the results of analyzing the expression intensity of each promoter expressed in Esteja vermicola.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrating the present invention in more detail, and the scope of the present invention is not limited by these examples.

Example 1. Conventional Esteja Vermicola ( Esteya vermicola ) Confirmation of gene deletion when using the promoter discovered in

The pBHt2 vector is used as a backbone, and in front of the dLbCpf1 and crRNA array genes, including sfGFP, Cochliobolus heterotrophus is known to be a strong promoter that has previously been used as a gene expression promoter in Esteya vermicola. heterostrophus )-derived promoter (PgpdA(C/H), SEQ ID NO: 4) (Wang, et al., Pest Manag Sci. 2020 Aug;76(8):2854-2864.) was constructed, and then Expression was induced by insertion into the E. vermicola genome.

As a result, contrary to expectations, fluorescence was not observed, so the sfGFP and crRNA array cassettes were partially PCR amplified and then sanger sequenced. The results were aligned using the snapgene tool, and it was confirmed that gene deletion had occurred (Figure 1).

Example 2. Vector production

sfGFP was added to three types of constitutive promoters derived from various strains (Table 1 below) and, as a control, a C. heterostrophus- derived promoter (PgpdA (C/H), SEQ ID NO: 4) that caused the gene deletion in Example 1. A vector linking (Superfolder green fluorescent protein) was created.

Derived strain Strain used Promoter Name Length (bp) Reference Aspergillus nidulans Aspergillus nidulans
Aspergillus niger
Aspergillus aculeatus
Aspergillus luchuensis
Aspergillus brasiliensis
Aspergillus carbonarius PgpdA(A/N) (SEQ ID NO: 3) 497 Christina S. Nødvig (2015) Plos one Aspergillus nidlulans Aspergillus nidlulans
Aspergillus niger
Aspergillus aculeatus
Aspergillus luchuensis
Aspergillus brasiliensis
Aspergillus carbonarius Ptef1(A/N)
(SEQ ID NO: 1) 886 Aspergillus flavus Aspergillus oryzae P6(A/F)
(SEQ ID NO: 2) 1024 Maiko Umemura (2020) Fungal Biol Biotechnol

Specifically, a total of four types of promoters, including the control group, were each synthesized and secured as base sequence fragments. In order to link each promoter with the sfGFP fragment, primers (SEQ ID NOs: 5 to 8, 13 to 16) were used so that the 3' end of each promoter and the sequence of the sfGFP fragment overlapped by 30 bp, and the EcoRI restriction enzyme recognition sequence was located at the 5' end. It was designed, and PCR was performed using it.

In addition, a flanking sequence was given so that the sequence of the trpC, tef1 or AN4594 terminator fragment to be linked to sfGFP and its downstream sequence overlaps by 30 bp, and a primer (SEQ ID NO: 9 to 10, 17 to 18) were designed, and PCR was performed using them.

Each amplified promoter, sfGFP, and terminator were linked by performing overlap extension PCR using primers (SEQ ID NOs: 11 to 12, 19 to 20), and then the linked fragments were amplified by PCR again (PgapdA-sfGFP-TtrpC, Ptef1-sfGFP -Ttef1, P6-sfGFP-TAN4594, PgpdA(C/H)-sfGFP-TtrpC). The amplified product was digested with EcoRI and HindIII restriction enzymes, and the pBHt2 vector (plasmid #104175, addgene), a backbone vector suitable for Agrobacterium tumefaciens -mediated transformation, was linked to create an expression vector. was produced (Figure 2).

The primers used here are shown in Table 2 below.

sequence number sequence name Sequence (5'->3') 5 OEPgpdA_F gatcggaattcgcgtaagctccctaattggc 6 OEPgpdA_R gaaaagttcttctcctttgctcatcggtgatgtctgctcaagc 7 OEsfGFP_F tcaccgatgagcaaaggagaagaacttttcac 8 OEsfGFP_R taaatcattatttgtagagctcatccatgccat 9 OETtrpC_F ggcatggatgagctctacaaataatgatttaatagctccatgtcaacaagaa 10 OETtrpC_R cgatcaagcttgagccaagagcggattcct 11 PgpdA_TtrpC_F gatcgggaattcgcgtaagctc 12 PgpdA_TtrpC_R cgatcaagcttgagccaagag 13 OEP6_F gatcggaattcttatgactattttctttttttagggtcagct 14 OEP6_R gaaaagttcttctcctttgctcattgtgatagttgaaagattcgatcagatag 15 OEsfGFP_F3 atcacaatgagcaaaggagaagaacttttc 16 OEsfGFP_R3 tttaCGAGACCttatttgtagagctcatccatgcca 17 OETAN4594_F ggatgagctctacaaataaGGTCTCGtaaaAATAGTTCATATTCCACTCTGGAAGGAG 18 OETAN4594_R cgatcaagcttGGTCTCCgaggTCTGTTAGC 19 P6_TAN4594_F gatcggaattcttatgactattttcttttttaggg 20 P6_TAN4594_R cgatcaagcttGGTCTCCga 21 OEPtef1_F gatcggaattccgagacagcagaatcaccg 22 OEPtef1_R gaaaagttcttctcctttgctcatggtgaaggttgtgttatgttttgtg 23 OEsfGFP_F2 ttcaccatgagcaaaggagaagaacttttcac 24 OEsfGFP_R2 ggcataaaatcgaatgtccgcttatttgtagagctcatccatgcca 25 OETtef1_F ctacaaataagcgggacattcgattatgcc 26 OETtef1_R cgatcaagcttgtattgggatgaattttgtatgcacg 27 Ptef1_Ttef1_F gatcggaattccgagacagca 28 Ptef1_Ttef1_R cgatcaagcttgtattgggatgaat 29 OEPgpdaA_CH_F attacGAATTcTTTGAAGATTGGGTTCCTCTTTGAGA 30 OEPgpdaA_CH_R gaaaagttcttctcctttgctcatgGAATTGGGTACTCAAATTGGTTCCC 31 OEsfGFP_F0 CAATTCatgagcaaaggagaagaacttttcac 32 OEsfGFP_R0 gacatggagctattaaatcattatttgtagagctcatccatgccat 33 OETtrpC_F ggcatggatgagctctacaaataatgatttaatagctccatgtcaacaagaa 34 OETtrpC_R cgatcaagcttgagccaagagcggattcct 35 PgpdA_CH_TtrpC_F TTTGAAGATTGGGTTCCTCTTTGAG 36 PgpdA_CH_TtrpC_R gagccaagagcggattcc

Example 3. Measurement of promoter expression intensity in Esteja vermicola

A total of four types of vectors prepared in Example 2 were introduced into Agrobacterium tumefaciens AGL1 cells through electroporation, and co-cultivation with Esteya vermicola resulted in each vector being esterified. It was integrated into the genome of Y. vermicola. Five transformants were randomly selected in selective medium, and cultured in PDB medium for 6 days at 26°C with agitation at 150 rpm to obtain relatively uniform spores. For the obtained spores, absorbance at 600 nm and fluorescence at 485 (Ex)/516 (Em) nm were measured, and the fluorescence was divided by the absorbance to analyze the expression intensity of each promoter expressed in Esteja vermicola (Figure 3).

As a result, as shown in Figure 4, the fluorescence intensity of sfGFP expressed from a vector containing the Ptef1 (A/N) and P6 (A/F) promoters in Esteja vermicola was lower than that of Cocliobolus heterostro, which was previously known as a strong promoter. The fluorescence intensity of sfGFP expressed from a vector containing the PgpdA (C/H) promoter from Pus was superior to that of sfGFP, confirming that the expression of the Ptef1 (A/N) and P6 (A/F) promoters in Esteja vermicola was excellent. did.

From the results of the above example, it was confirmed that the expression of the Ptef1 (A/N) and P6 (A/F) promoters in Esteja vermicola was excellent, and this can be applied when expressing the target protein in Esteja vermicola. .

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concepts thereof.

<110> Korea Advanced Institute of Science and Technology <120> Expressible promoter in Esteya vermicola and uses it <130> KPA211726-KR <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 886 <212> DNA <213> Unknown <220> <223> Ptef1(A/N) <400> 1 cgagacagca gaatcaccgc ccaagttaag cctttgtgct gatcatgctc tcgaacgggc 60 caagttcggg aaaagcaaag gagcgtttag tgaggggcaa tttgactcac ctcccaggca 120 acagatgagg ggggcaaaaa gaaagaaatt ttcgtgagtc aatatggatt ccgagcatca 180 ttttcttgcg gtctatcttg ctacgtatgt tgatcttgac gctgtggatc aagcaacgcc 240 actcgctcgc tccatcgcag gctggtcgca gacaaattaa aaggcggcaa actcgtacag 300 ccgcggggtt gtccgctgca aagtacagag tgataaaagc cgccatgcga ccatcaacgc 360 gttgatgccc agctttttcg atccgagaat ccaccgtaga ggcgatagca agtaaagaaa 420 agctaaacaa aaaaaaattt ctgcccctaa gccatgaaaa cgagatgggg tggagcagaa 480 ccaaggaaag agtcgcgctg ggctgccgtt ccggaaggtg ttgtaaaggc tcgacgccca 540 aggtgggagt ctaggagaag aatttgcatc gggagtgggg cgggttaccc ctccatatcc 600 aatgacagat atctaccagc caagggtttg agcccgcccg cttagtcgtc gtcctcgctt 660 gcccctccat aaaaggattt cccctccccc tcccacaaaa ttttctttcc cttcctctcc 720 ttgtccgctt cagtacgtat atcttccctt ccctcgcttc tctcctccat ccttctttca 780 tccatctcct gctaacttct ctgctcagca cctctacgca ttactagccg tagtatctga 840 gcacttctcc cttttatatt ccaaaaaca taacacaacc ttcacc 886 <210> 2 <211> 1024 <212> DNA <213> Unknown <220> <223> P6(A/F) <400> 2 ttatgactat tttctttttt agggtcagct gagcagggac aagagggcct agacataaaa 60 agacgcaaag gacagaaaga tgccgaacga gttggaaagg aaagaacggg tacggggatg 120 agatctccgc cgatttcccc gatgtttggc tatagcacga aagaaatacg gagaggggaat 180 gggtcaatct tttagcagga ggggagaacc ccagattcgc gcaacaaacaa catcacaatt 240 caaatttgtc atgttgtgtt tatgaaccgg ttaatgaggg tatccagaac gggggttgaa 300 ggtggatctc atacaggaga attattatct attttctaat ttctacactg catgaatggc 360 atgtcatagg tgtttcgggt ccatggaaga agagaaggtg atgatgtcat gtgatggcgg 420 ggattttcgg gaggcgcctg ggtcctgttg ggcctgaggc cagcaaccag cgtcatcgtt 480 gaaccccacc aaacaagtcc aagtcgtcac gggaagaaaa gggaagaagg acacgaactt 540 ccatccatta ccctcgggca ctgggaaatg actaactaaa tactacttct tctgccttgt 600 ttctcggctt cttcttcttt ctcctttttt ccctttttct tatatatcat cataaccccc 660 gcctcttctt ctttcccctc ccctccaatt ctcagcatca cgccagcaac cggtcagtga 720 aatcatactg ataccatccg ttccccacta cccggtgagt tctttcgagt gctgttgccc 780 ctccattagt ggctcagctg cccctcctcg tccctccctt tgccaatgac acttttatta 840 aatcccctgc tccgtattcg tcgttcggta aagatcctta gttcggaagc tcctacagaa 900 cttatttcta gctgttcact tcctcctcca tcctttcctt ctcctcttcc atttcttctc 960 ccaaactaat ccaattccta gtcgagtaag accagctatc tgatcgaatc tttcaactat 1020 caca 1024 <210> 3 <211> 732 <212> DNA <213> Unknown <220> <223> PgpdA(A/N) <400> 3 gcgtaagctc cctaattggc ccatccggca tctgtagggc gtccaaatat cgtgcctctc 60 ctgctttgcc cggtgtatga aaccggaaag gccgctcagg agctggccag cggcgcagac 120 cgggaacaca agctggcagt cgacccatcc ggtgctctgc actcgacctg ctgaggtccc 180 tcagtccctg gtaggcagct ttgccccgtc tgtccgcccg gtgtgtcggc ggggttgaca 240 aggtcgttgc gtcagtccaa catttgttgc catattttcc tgctctcccc accagctgct 300 cttttctttt ctctttcttt tcccatcttc agtatattca tcttcccatc caagaacctt 360 tatttcccct aagtaagtac tttgctacat ccatactcca tccttcccat cccttattcc 420 tttgaacctt tcagttcgag ctttcccact tcatcgcagc ttgactaaca gctacccccgc 480 ttgagcagac atcaccgtga tttaatagct ccatgtcaac aagaataaaa cgcgtttcgg 540 gtttacctct tccagataca gctcatctgc aatgcattaa tgcattggac ctcgcaaccc 600 tagtacgccc ttcaggctcc ggcgaagcag aagaatagct tagcagagtc tattttcatt 660 ttcgggagac gagatcaagc agatcaacgg tcgtcaagag acctacgaga ctgaggaatc 720 cgctcttggc tc 732 <210> 4 <211> 423 <212> DNA <213> Unknown <220> <223> PgpdA(C/H) <400> 4 tttgaagatt gggttcctct ttgagagagt taatagactt gaattgagga atggaaatcg 60 ggctgagctc actgctttat atgtgagaaa aggtgatgag caggtggtaa gaggcagatt 120 tttgtggtcg gtgctgtgtt ttgttgggtt tgagctaggt ggggtgaggg aggggcaagc 180 taaatagcta ccagccctga ggacgtcaca gagttttagt agttcttttt ctgccatcgg 240 acatgcagct cacgcctaga cccaattaca ccctttgcgc cctcccacac atccggccgg 300 ttggatcatt gtcagatacg gcagagaaat cgcaacctcg gccaagggta gccacgattc 360 gaagccgcga aattgggggt ttcggaatgt cgtcaagcgg gaaccaattt gagtacccaa 420 ttc 423 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223>OEPgpdA_F <400> 5 gatcggaatt cgcgtaagct ccctaattgg c 31 <210> 6 <211> 43 <212> DNA <213> Artificial Sequence <220> <223>OEPgpdA_R <400> 6 gaaaagttct tctcctttgc tcatcggtga tgtctgctca agc 43 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_F <400> 7 tcaccgatga gcaaaggaga agaacttttc ac 32 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_R <400> 8 taaatcatta tttgtagagc tcatccatgc cat 33 <210> 9 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> OETtrpC_F <400> 9 ggcatggatg agctctacaa ataatgattt aatagctcca tgtcaacaag aa 52 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OETtrpC_R <400> 10 cgatcaagct tgagccaaga gcggattcct 30 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PgpdA_TtrpC_F <400> 11 gatcgggaatt cgcgtaagct c 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PgpdA_TtrpC_R <400> 12 cgatcaagct tgagccaaga g 21 <210> 13 <211> 41 <212> DNA <213> Artificial Sequence <220> <223>OEP6_F <400> 13 gatcggaatt cttatgacta ttttcttttt tagggtcagc t 41 <210> 14 <211> 53 <212> DNA <213> Artificial Sequence <220> <223>OEP6_R <400> 14 gaaaagttct tctcctttgc tcattgtgat agttgaaaga ttcgatcaga tag 53 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_F3 <400> 15 atcacaatga gcaaaggaga agaacttttc 30 <210> 16 <211> 36 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_R3 <400> 16 tttacgagac cttatttgta gagctcatcc atgcca 36 <210> 17 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> OETAN4594_F <400> 17 ggatgagctc tacaaataag gtctcgtaaa aatagttcat attccactct ggaaggag 58 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> OETAN4594_R <400> 18 cgatcaagct tggtctccga ggtctgttag c 31 <210> 19 <211> 35 <212> DNA <213> Artificial Sequence <220> <223>P6_TAN4594_F <400> 19 gatcggaatt cttatgacta ttttcttttt taggg 35 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223>P6_TAN4594_R <400> 20 cgatcaagct tggtctccga 20 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OEPtef1_F <400> 21 gatcggaatt ccgagacagc agaatcaccg 30 <210> 22 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> OEPtef1_R <400> 22 gaaaagttct tctcctttgc tcatggtgaa ggttgtgtta tgttttgtg 49 <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_F2 <400> 23 ttcaccatga gcaaaggaga agaacttttc ac 32 <210> 24 <211> 45 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_R2 <400> 24 ggcataaaatc gaatgtccgc ttatttgtag agctcatcca tgcca 45 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OETtef1_F <400> 25 ctacaaataa gcgggacattc gatttatgcc 30 <210> 26 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> OETtef1_R <400> 26 cgatcaagct tgtattggga tgaattttgt atgcacg 37 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ptef1_Ttef1_F <400> 27 gatcgggaatt ccgagacagc a 21 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Ptef1_Ttef1_R <400> 28 cgatcaagct tgtattggga tgaat 25 <210> 29 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> OEPgpdaA_CH_F <400> 29 attacgaatt ctttgaagat tgggttcctc tttgaga 37 <210> 30 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> OEPgpdaA_CH_R <400>30 gaaaagttct tctcctttgc tcatggaatt gggtactcaa attggttccc 50 <210> 31 <211> 32 <212> DNA <213> Artificial Sequence <220> <223>OEsfGFP_F0 <400> 31 caattcatga gcaaaggaga agaacttttc ac 32 <210> 32 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> OEsfGFP_R0 <400> 32 gacatggagc tattaaatca ttatttgtag agctcatcca tgccat 46 <210> 33 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> OETtrpC_F <400> 33 ggcatggatg agctctacaa ataatgattt aatagctcca tgtcaacaag aa 52 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OETtrpC_R <400> 34 cgatcaagct tgagccaaga gcggattcct 30 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PgpdA_CH_TtrpC_F <400> 35 tttgaagatt gggttcctct ttgag 25 <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PgpdA_CH_TtrpC_R <400> 36 gagccaagag cggattcc 18

Claims (8)

A polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2 having promoter activity; And a gene expression cassette for a microorganism of the Esteya genus, comprising a gene encoding a target protein operably linked to the polynucleotide.
The expression cassette according to claim 1, wherein the microorganism is Esteya vermicola .
An expression vector for Esteya genus microorganisms, comprising the gene expression cassette of claim 1.
A microorganism of the Estella genus, comprising the gene expression cassette of claim 1 or a vector containing the expression cassette.
The microorganism according to claim 4, wherein the microorganism is Esteya vermicola .
i) cultivating the Estella genus microorganism of paragraph 4; and
ii) obtaining the expression of a gene encoding a target protein from the cultured microorganism,
Method for producing the target substance.
The method of claim 6, wherein the microorganism is Esteya vermicola .
Polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 2; And a method for producing a microbial transformant of the Estella genus, comprising the step of introducing an expression cassette containing a gene encoding a target protein operably linked to the polynucleotide into the Esteja genus microorganism.