KR102668767B1 - Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same - Google Patents

Abstract

The present invention relates to a Corynebacterium glutamicum mutant strain with improved L-lysine production ability and a method for producing L-lysine using the same, wherein the mutant strain encodes aspartate kinase and aspartate semialdehyde dehydrogenase. By increasing or enhancing the expression of the gene (lysC-asd operon), the production yield of L-lysine can be improved compared to the parent strain.

Description

Corynebacterium glutamicum mutant with enhanced L-lysine production ability and method for producing L-lysine using the same {Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same}

The present invention relates to a Corynebacterium glutamicum mutant strain with improved L-lysine production ability and a method for producing L-lysine using the same.

L-lysine is an essential amino acid that is not synthesized in the human or animal body and must be supplied from outside, and is generally produced through fermentation using microorganisms such as bacteria or yeast. For L-lysine production, a wild-type strain obtained in nature or a mutant strain modified to improve its L-lysine production ability can be used. Recently, in order to improve the production efficiency of L-lysine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, to produce excellent L-lysine production ability. Various recombinant strains or mutant strains and methods for producing L-lysine using them are being developed.

According to Korean Patent Nos. 10-0838038 and 10-2139806, the base sequence or amino acid sequence of a gene encoding a protein including an enzyme related to L-lysine production is changed to increase the expression of that gene or to increase the expression of an unnecessary gene. L-lysine production ability can be improved by removing . In addition, Korean Patent Publication No. 10-2020-0026881 discloses a method of changing the existing promoter of a gene to a promoter with strong activity in order to increase the expression of a gene encoding an enzyme involved in L-lysine production.

As such, various methods to increase L-lysine production capacity are being developed, but since there are dozens of types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-lysine production, changes in the activity of these proteins can be affected. Much research is still needed to determine whether L-lysine production capacity increases.

Korean Patent No. 10-0838038 Korean Patent No. 10-2139806 Korean Patent Publication No. 10-2020-0026881

The purpose of the present invention is to provide a Corynebacterium glutamicum mutant strain with improved L-lysine production ability.

Additionally, the present invention aims to provide a method for producing L-lysine using the mutant strain.

The present inventors conducted research to develop a new mutant strain with improved L-lysine production ability using Corynebacterium glutamicum strain, and as a result, the lysC gene encoding aspartate kinase, a key enzyme involved in the L-lysine biosynthetic pathway, was found. The present invention was completed by confirming that L-lysine production increased when the base sequence at a specific position in the promoter of the lysC-asd operon containing the asd gene encoding aspartate semialdehyde dehydrogenase was replaced.

One aspect of the present invention provides a Corynebacterium glutamicum mutant strain with improved L-lysine production ability by enhancing the activities of aspartate kinase and aspartate semialdehyde dehydrogenase.

“Aspartate kinase” used in the present invention is an enzyme involved in the first step of the L-lysine biosynthesis pathway and induces phosphorylation of aspartate to form aspartyl phosphate. Refers to an enzyme that catalyzes the reaction that produces it. In addition, “aspartate semialdehyde dehydrogenase” used in the present invention is an enzyme involved in the second step of the L-lysine biosynthesis pathway, which converts aspartate from aspartyl phosphate. It refers to an enzyme that catalyzes the reaction that produces aspartate semialdehyde. The lysC gene encoding aspartate kinase and the asd gene encoding aspartate semialdehyde dehydrogenase are driven by one promoter. It forms the lysC-asd operon whose expression is regulated.

According to one embodiment of the present invention, the aspartate kinase and aspartate semialdehyde dehydrogenase may be derived from a strain of the genus Corynebacterium . Specifically, the Corynebacterium genus strains include Corynebacterium glutamicum , Corynebacterium crudilactis , Corynebacterium deserti, and Corynebacterium. Corynebacterium callunae , Corynebacterium suranareeae , Corynebacterium lubricantis , Corynebacterium doosanense , Corynebacterium iphish Corynebacterium efficiens , Corynebacterium uterequi , Corynebacterium stationis , Corynebacterium pacaense , Corynebacterium singulare ), Corynebacterium humireducens , Corynebacterium marinum , Corynebacterium halotolerans , Corynebacterium spheniscorum , Corynebacterium freiburgense, Corynebacterium striatum , Corynebacterium canis , Corynebacterium ammoniagenes , Corynebacterium Corynebacterium renale , Corynebacterium pollutisoli , Corynebacterium imitans, Corynebacterium caspium , Corynebacterium testudinoris ( It may be Corynebacterium testudinoris ), Corynebacaterium pseudopelargi , or Corynebacterium flavescens, but is not limited thereto.

As used in the present invention, “enhanced activity” means that the expression of genes encoding proteins such as desired enzymes, transcription factors, and transport proteins is newly introduced or increased, and the expression level is increased compared to the wild-type strain or the strain before modification. . Enhancement of this activity occurs when the activity of the protein itself is increased compared to the activity of the protein originally possessed by the microorganism through nucleotide substitution, insertion, deletion, or a combination of these encoding the gene, and increased expression or translation of the gene encoding it. If the overall level of enzyme activity within the cell is higher than that of the wild-type strain or the strain before modification, a combination thereof is also included.

According to one embodiment of the present invention, the enhancement of the activity of the aspartate kinase and aspartate semialdehyde dehydrogenase is achieved through an operon comprising genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. It may cause site-specific mutations in the promoter.

According to one embodiment of the present invention, the promoter of the operon containing genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase may be represented by the base sequence of SEQ ID NO: 1.

As used in the present invention, “promoter” refers to a specific region of DNA that regulates transcription of a gene, including a binding site for RNA polymerase that initiates mRNA transcription of the gene of interest, and generally refers to a specific region of DNA that regulates transcription of a gene. It is located upstream from the transcription start point. Promoters in prokaryotes are defined as the region around the transcription start point where RNA polymerase binds, and are generally composed of two short base sequences separated by -10 and -35 base pairs ahead of the transcription start point. . The promoter mutation in the present invention is improved to have higher activity than the wild-type promoter, and can increase the expression of genes located downstream by causing mutations in the promoter region located upstream of the transcription start point.

According to one embodiment of the present invention, the enhancement of the activity of the aspartate kinase and aspartate semialdehyde dehydrogenase is achieved through an operon comprising genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. One or more bases in the -60 to -30 region forward from the transcription start point in the promoter sequence may be substituted.

More specifically, the promoter mutation in the present invention is one or more bases in the -60 to -30 region, preferably the -55 to -35 region, -50 to -30 region, -47 to -45 region, -47 or One, two, three, four, or five bases in the -45 region may be substituted consecutively or discontinuously.

According to one embodiment of the present invention, the -47 to -45 region in the promoter sequence of the lysC-asd operon containing the aspartate kinase and aspartate semialdehyde dehydrogenase genes of the Corynebacterium glutamicum strain. By substituting the base sequence from gag to taa, a Corynebacterium glutamicum mutant strain with a new promoter sequence of the lysC-asd operon was obtained. This Corynebacterium glutamicum mutant may contain a mutated promoter of the lysC-asd operon represented by the base sequence of SEQ ID NO: 2.

“Improved production capacity” as used in the present invention means that the productivity of L-lysine is increased compared to the parent strain. The parent strain refers to a wild type or mutant strain that is subject to mutation, and includes a subject that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild-type Corynebacterium glutamicum strain or a strain mutated from the wild type.

According to one embodiment of the present invention, the parent strain is a mutant strain causing mutations in the sequences of genes involved in lysine production (e.g., lysC, zwf, and hom genes), and is provided to the Korean Culture Center of Microorganisms. It may be a Corynebacterium glutamicum strain (hereinafter referred to as 'Corynebacterium glutamicum DS1 strain') deposited with accession number KCCM12969P on April 2, 2021.

As such, the Corynebacterium glutamicum mutant strain with improved L-lysine production ability of the present invention has a mutated promoter sequence of the lysC-asd operon containing genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. It may include.

According to one embodiment of the present invention, the mutant strain may contain the base sequence represented by SEQ ID NO: 2 as the promoter sequence of an operon containing genes for aspartate kinase and aspartate semialdehyde dehydrogenase. .

According to one embodiment of the present invention, the mutant strain exhibits increased L-lysine production ability compared to the parent strain by including a promoter sequence mutation of the lysC-asd operon, and in particular, L-lysine production is 3% or more compared to the parent strain. , specifically 3 to 40%, more specifically 5 to 30%, so that 65 to 80 g of L-lysine can be produced per 1 liter of strain culture, and preferably 68 to 75 g of L-lysine can be produced. You can. In addition, the mutant strain increases L-lysine production by more than 4.6% compared to the promoter mutant strain of the conventional lysC-asd operon in which the mutation position of the promoter is different, and can produce L-lysine in high yield.

Corynebacterium glutamicum mutant strain according to one embodiment of the present invention includes a mutant in which the promoter sequence of an operon containing genes for aspartate kinase and aspartate semialdehyde dehydrogenase in the parent strain is partially substituted. It can be implemented through a recombinant vector.

“Part” as used in the present invention means not all of the base sequence or polynucleotide sequence, and may be 1 to 300, preferably 1 to 100, more preferably 1 to 50, but is limited thereto. That is not the case.

“Variant” used in the present invention refers to one or more of the -60 to -30 regions in the promoter sequence of the operon containing the genes for aspartate kinase and aspartate semialdehyde dehydrogenase, which are involved in the biosynthesis of L-lysine. It refers to a promoter variant in which a base has been substituted.

According to one embodiment of the present invention, a variant in which the nucleotide sequence of the -47 to -45 region in the promoter sequence of the operon containing the genes for aspartate kinase and aspartate semialdehyde dehydrogenase is substituted with taa is It may have the base sequence of SEQ ID NO: 2.

As used in the present invention, “vector” refers to an expression vector capable of expressing a target protein in a suitable host cell, and refers to a gene product containing essential regulatory elements operably linked to express the gene insert. Here, “operably linked” means that a gene requiring expression and its regulatory sequence are functionally linked to each other to enable gene expression, and “regulatory elements” are a promoter to perform transcription and regulate transcription. optional operator sequences for: sequences encoding suitable mRNA ribosome binding sites, and sequences regulating termination of transcription and translation. Such vectors include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, etc.

The “recombinant vector” used in the present invention can be transformed into a suitable host cell and then replicate independently of the host cell's genome or can be incorporated into the genome itself. At this time, the “suitable host cell” is a vector capable of replication and may include an origin of replication, which is a specific base sequence at which replication is initiated.

For the transformation, an appropriate vector introduction technology is selected depending on the host cell to express the desired gene in the host cell. For example, vector introduction can be performed using electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE- It may be performed by the dextran method, the cationic liposome method, the lithium acetate-DMSO method, or a combination thereof. As long as the transformed gene can be expressed within the host cell, it can be included without limitation, whether it is inserted into the chromosome of the host cell or located outside the chromosome.

The host cells include cells transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro. The host cell containing the recombinant vector of the present invention is a recombinant host cell, a recombinant cell, or a recombinant microorganism.

In addition, the recombinant vector according to the present invention may include a selection marker, which is used to select transformants (host cells) transformed with the vector, and is used in the medium treated with the selection marker. Because only cells expressing the selection marker are viable, selection of transformed cells is possible. Representative examples of the selection marker include kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

Genes inserted into the recombinant vector for transformation of the present invention can be replaced into host cells such as microorganisms of the Corynebacterium genus due to homologous recombination crossing.

According to one embodiment of the present invention, the host cell may be a strain of the genus Corynebacterium, for example, a strain of Corynebacterium glutamicum .

In addition, another aspect of the present invention includes a) culturing the Corynebacterium glutamicum mutant strain in a medium; and b) recovering L-lysine from the mutant strain or medium in which the mutant strain was cultured.

The culture can be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust the medium and culture conditions. Specifically, the medium may be a liquid medium, but is not limited thereto. Cultivation methods may include, for example, batch culture, continuous culture, fed-batch culture, or combinations thereof, but are not limited thereto.

According to one embodiment of the present invention, the medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium may refer to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but are not limited thereto.

According to one embodiment of the present invention, the medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, It includes fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These substances may be used individually or in mixtures, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or in a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. Additionally, precursors appropriate for the culture medium may be used. The medium or individual components may be added to the culture medium in a batch or continuous manner in an appropriate manner during the culture process, but are not limited thereto.

According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during culture. Additionally, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (e.g., air) can be injected into the culture medium. The temperature of the culture medium may typically be 20°C to 45°C, for example, 25°C to 40°C. The culturing period may continue until the desired yield of useful material is obtained, for example, 10 to 160 hours.

According to one embodiment of the present invention, the step of recovering L-lysine from the cultured mutant strain and the medium in which the mutant strain was cultured includes L-lysine produced from the medium using a suitable method known in the art according to the culture method. Can be collected or recovered. Examples include centrifugation, filtration, extraction, nebulization, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g. ammonium sulfate precipitation), chromatography (e.g. ion exchange, affinity, hydrophobic and Methods such as size exclusion) can be used, but are not limited to this.

According to one embodiment of the present invention, the step of recovering lysine can be performed by centrifuging the culture medium at low speed to remove biomass and separating the obtained supernatant through ion exchange chromatography.

According to one embodiment of the present invention, the step of recovering L-lysine may include a process of purifying L-lysine.

The Corynebacterium glutamicum mutant strain according to the present invention has L- The production yield of lysine can be improved.

Figure 1 shows the structure of the pCGI (Pm-lysC') vector containing a promoter in which the nucleotide sequence of the region -47 to -45 in the promoter sequence of the lysC-asd operon is replaced with taa according to an embodiment of the present invention. .

Hereinafter, the present invention will be described in more detail. However, this description is merely provided as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this example description.

Example 1. Preparation of Corynebacterium glutamicum mutant strains

To prepare a Corynebacterium glutamicum mutant strain with enhanced activities of aspartate kinase and aspartate semialdehyde dehydrogenase, Corynebacterium glutamicum DS1 strain was used.

1-1. mutagenesis

Corynebacterium glutamicum DS1 strain was cultured in CM liquid medium (containing 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone, and 5.0 g of beef extract, pH 6.8). ) Inoculate a flask containing 50 ㎖ and add N-methyl-N`-nitro-N-nitrosoguanidine (NTG), a mutagen, at a final concentration of 300 ㎍/㎖. After addition, it was cultured with shaking at 200 rpm for 20 hours at 30°C. After completion of the culture, the culture was centrifuged at 12,000 rpm for 10 minutes to remove the supernatant, washed once with saline, and washed three more times with phosphate buffer. This was suspended in 5 ml of phosphate buffer, spread on CM solid medium (CM liquid medium containing an additional 15 g/l of agar), and cultured at 30°C for 30 hours to isolate 100 colonies.

1-2. Selection of mutant strains with improved L-lysine production ability

100 isolated colonies were inoculated at a rate of 5% each into flasks containing 10 ml of the production liquid medium shown in Table 1 below, and cultured with shaking at 30°C at 200 rpm for 30 hours. By measuring the absorbance of each culture at OD 610 nm and comparing the L-lysine production, three colonies producing more than 75.0 g/l of L-lysine were selected, and the first and second enzymes of the lysine biosynthetic pathway were encoded for these. Mutations in the promoter of the lysC-asd operon containing the gene were investigated. Through nucleotide sequence analysis of these promoters, the location of the mutation in the promoter of the lysC-asd operon was confirmed.

Furtherance Content (based on 1 L) Glucose 100 g Ammonium sulfate 55g (NH ₄ ) ₂ SO ₄ 35g KH ₂ PO ₄ 1.1g MgSO ₄ ㆍH ₂ O 1.2g MnSO ₄ ㆍH ₂ O 180mg FeSO ₄ ㆍH ₂ O 180mg ThiamineㆍHCl 9mg Biotin 1.8mg CaCO ₃ 5% pH 7.0

As a result, it was confirmed that in all three colonies, the nucleotide sequence was substituted from gag to taa in the -47 to -45 region at the top of the start codon of the gene in the lysC-asd operon. Among the three colonies, one Corynebacterium glutamicum DS1 mutant strain was selected for chromosomal DNA extraction, and later, the Corynebacterium glutamicum DS1 strain was used to produce L-lysine by promoter mutation of the lysC-asd operon. An experiment was conducted to verify productivity increase.

Example 2. Preparation of Corynebacterium glutamicum mutant strains

To prepare Corynebacterium glutamicum mutants with enhanced activities of aspartate kinase and aspartate semialdehyde dehydrogenase, Corynebacterium glutamicum DS1 strain and E. coli DH5a (HIT Competent cells) ™, Cat No. RH618) was used.

The Corynebacterium glutamicum DS1 strain is a CM containing 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone, and 5.0 g of beef extract in 1 L of distilled water. Cultured at a temperature of 30°C in liquid medium (pH 6.8).

E. coli DH5a was cultured at a temperature of 37°C on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.

kanamycin and streptomycin were used from Sigma, and DNA sequencing was conducted by Macrogen Co., Ltd.

2-1. Construction of recombinant vectors

To increase lysine productivity by strengthening the lysine biosynthetic pathway in the strain, enhancement of aspartate kinase and aspartate semialdehyde dehydrogenase was introduced. The method used in this example involves a specific mutation in the promoter of the lysC-asd operon gene to increase the expression of the lysC-asd operon containing genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. caused. In order to replace the nucleotide sequence at positions -47 to -45 of the promoter of the lysC-asd operon gene from gag to taa, the left arm centered on the promoter mutation position of the lysC-asd operon on the Corynebacterium glutamicum DS1 strain genome. The 478 bp portion and the 475 bp portion of the right arm were amplified by PCR using primers of sequence numbers 3 and 4, and 5 and 6 in Table 2 below. In addition, using the vector pCGI (see literature [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130]) as a template, primers of SEQ ID NOs: 7 and 8, and 9 and 10 in Table 2 below were used. After PCR amplification, four PCR products were cloned using self-assembly cloning. The recombinant plasmid prepared above was named pCGI (Pm-lysC') (see Figure 1).

Primer (5' - 3') sequence number Amplification primers containing promoter mutations lysCP-F1 CCGTCACAAGACCAAGGATG 3 lysCP-R1 AGTGGCACATTGAATGCACG 4 lysCP-F2 TGATTACGCCCCCGTCACAAGACCAAGGATG 5 lysCP-R2 TGAATGCACGAGCGTATTCA 6 pCGI vector amplification
primer pCGI-F1 ACTGGCCGTTCGTTTTACAAC 7 pCGI-R1 GGCGTAATCATGGTCATAGC 8 pCGI-F2 ATGTGCCACTACTGGCCGTCGTTTTACAAC 9 pCGI-R2 TGGTCATAGCTGTTTCCTTGTG 10

The conditions for performing PCR using the above primers are as follows. Using a thermocycler (TP600, TAKARA BIO Inc., Japan), 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) was added to the reaction solution, 1 pM of oligonucleotide, and corynein selected in Example 1. Using 10 ng of chromosomal DNA or pCGI vector DNA from Bacterium glutamicum DS1 mutant strain (mutation occurred in the promoter -47 to -45 region) as a template, 1 unit of pfu-X DNA polymerase mixture (Solgent) 25 to 30 cycles were performed in the presence of . PCR performance conditions were (i) denaturation step: 30 seconds at 94°C, (ii) annealing step: 30 seconds at 58°C, and (iii) extension step: 1 to 2 at 72°C. It was carried out under conditions of 2 minutes (polymerization time of 2 minutes per 1 kb).

The gene fragment prepared in this way was cloned into the pCGI vector using self-assembly cloning. The vector was transformed into E. coli DH5a, spread on LB-agar plates containing 50 μg/ml kanamycin, and cultured at 37°C for 24 hours. After separating the finally formed colonies to confirm that the insert was correctly present in the vector, this vector was isolated and used for recombination of Corynebacterium glutamicum DS1 strain.

During genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes, and various restriction enzymes and DNA modifying enzymes were NEB products, and were used according to the supplied buffer and protocol.

2-2. Manufacturing of variant strains

A mutant strain, strain DS6, was prepared using the pCGI (Pm-lysC') vector. The final concentration of the vector was prepared to be 1 ㎍/㎕ or more and electroporation method (see Tauch et al., FEMS Microbiology letters 123 (1994) 343-347) was used on Corynebacterium glutamicum DS1 strain. This induced the first recombination. At this time, the electroporated strain was spread on CM solid medium containing 20 ㎍/㎕ kanamycin to isolate colonies, and then it was confirmed through PCR and base sequence analysis whether it was properly inserted into the induced position on the genome. In order to induce secondary recombination, the isolated strain was inoculated into a CM-agar liquid medium containing streptomycin, cultured overnight, and then spread on an agar medium containing the same concentration of streptomycin to isolate colonies. did. After confirming resistance to kanamycin among the final isolated colonies, it was confirmed through base sequence analysis whether mutations were introduced into the promoter of the lysC-asd operon gene among the strains without antibiotic resistance (Reference [Schafer et al., Gene 145 (1994) 69-73]. Finally, the Corynebacterium glutamicum mutant strain DS6, in which a mutation was introduced into the promoter of the lysC-asd operon gene, was obtained.

Comparative Example 1. Corynebacterium glutamicum mutant strain

In the promoter sequence of the lysC-asd operon encoding the aspartate kinase and aspartate semialdehyde dehydrogenase genes disclosed in Korean Patent No. 10-0930203, aaa is mutated to tgt in the -54 to -52 region. The induced mutant strain (lysCP1) was used.

Experimental Example 1. Comparison of L-lysine productivity of mutant strains

The L-lysine productivity of the parent strain Corynebacterium glutamicum DS1 strain, the DS6 strain, a lysine-producing mutant strain prepared in Example 1, and the lysCP1 strain, a conventional lysine-producing mutant strain prepared in Comparative Example 1, were compared.

Each strain was inoculated into a 100 ml flask containing 10 ml of lysine medium with the composition shown in Table 1, and cultured with shaking at 30°C for 28 hours at 180 rpm. After completion of the culture, the production of L-lysine was measured using HPLC (Shimazu, Japan) for lysine analysis, and the results are shown in Table 3.

strain L-Lysine (g/L) L-lysine production per unit cell (g/gDCW) Parent strain (DS1) 64.5 6.98 Mutant strain (DS6) 70.5 8.31 Mutant strain (lysCP1) 67.5 7.57

As shown in Table 3, the Corynebacterium glutamicum mutant DS6 strain has a specific position (-47 to -45 region) of the promoter sequence of the lysC-asd operon as the optimal base sequence for strengthening the lysine biosynthetic pathway. It was confirmed that the substitution increased the productivity of L-lysine by about 9.3% compared to the parent strain Corynebacterium glutamicum DS1 strain.

In addition, the Corynebacterium glutamicum mutant strain DS6 was confirmed to have increased L-lysine productivity by more than 4.6% compared to the conventional mutant strain lysCP1, which has a different mutation position (-54 to -52 region) and sequence (tgt).

These results showed that enhanced expression of genes in the lysC-asd operon due to mutations in the promoter -47 to -45 region enhances lysine biosynthetic performance, thereby improving the L-lysine production ability of the strain.

So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

<110> DAESANG CORPORATION <120> Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same <130> PN210036 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 353 <212> DNA <213> Artificial Sequence <220> <223> Promoter sequence of lysC gene <400> 1 ccatcttttg gggtgcggag cgcgatccgg tgtctgacca cggtgcccca tgcgattgtt 60 aatgccgatg ctagggcgaa aagcacggcg agcagattgc tttgcacttg attcagggta 120 gttgactaaa gagttgctcg cgaagtagca cctgtcactt ttgtctcaaa tattaaatcg 180 aatatcaata tatggtctgt ttattggaac gcgtcccagt ggctgagacg catccgctaa 240 agccccagga accctgtgca gaaagaaaac actcctctgg ctaggtagac acagtttata 300 aaggtagagt tgagcgggta actgtcagca cgtagatcga aaggtgcaca aag 353 <210> 2 <211> 353 <212> DNA <213> Artificial Sequence <220> <223> Mutant promoter sequence of lysC gene <400> 2 ccatcttttg gggtgcggag cgcgatccgg tgtctgacca cggtgcccca tgcgattgtt 60 aatgccgatg ctagggcgaa aagcacggcg agcagattgc tttgcacttg attcagggta 120 gttgactaaa gagttgctcg cgaagtagca cctgtcactt ttgtctcaaa tattaaatcg 180 aatatcaata tatggtctgt ttattggaac gcgtcccagt ggctgagacg catccgctaa 240 agccccagga accctgtgca gaaagaaaac actcctctgg ctaggtagac acagtttata 300 aaggtataat tgagcgggta actgtcagca cgtagatcga aaggtgcaca aag 353 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> lysCP-F1 <400> 3 ccgtcacaag accaaggatg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> lysCP-R1 <400> 4 agtggcacat tgaatgcacg 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lysCP-F2 <400> 5 tgattacgcc ccgtcacaag accaaggatg 30 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> lysCP-R2 <400> 6 tgaatgcacg agcgtattca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pCGI-F1 <400> 7 actggccgtc gtttacaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pCGI-R1 <400> 8 ggcgtaatca tggtcatagc 20 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pCGI-F2 <400> 9 atgtgccact actggccgtc gtttacaac 30 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pCGI-R2 <400> 10 tggtcatagc tgtttcctgt g 21

Claims (5)

A Corynebacterium glutamicum mutant strain with improved L-lysine production ability in which gag in the -47 to -45 region of the promoter sequence of SEQ ID NO: 1, which is the promoter of the lysC-asd operon, is replaced with taa,
The lysC-asd operon is a Corynebacterium glutamicum mutant containing genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase.
delete delete In claim 1,
The mutant strain is a Corynebacterium glutamicum mutant strain containing the base sequence represented by SEQ ID NO: 2.
a) cultivating the mutant strain of claim 1 in a medium; and
b) A method for producing L-lysine comprising the step of recovering L-lysine from the mutant strain or medium in which the mutant strain was cultured.