KR20220149219A - Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same - Google Patents

Abstract

The present invention relates to a mutant strain of Corynebacterium glutamicum with enhanced L-lysine productivity, and a method for preparing L-lysine using the same. The mutant strain increases or enhances the expression of a gene (lysC-asd operon) encoding aspartate kinase and aspartate semialdehyde dehydrogenase, and thus can improve the production yield of L-lysine compared to a parent strain.

Description

Corynebacterium glutamicum mutant with improved L-lysine production ability and production method of L-lysine using the same {Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same}

The present invention relates to a Corynebacterium glutamicum mutant having improved L-lysine-producing ability and a method for producing L-lysine using the same.

L-lysine is an essential amino acid that is not synthesized in humans or animals and must be supplied from the outside, and is generally produced by fermentation using microorganisms such as bacteria or yeast. L- lysine production may use a wild-type strain obtained in the natural state or a mutant strain modified to improve its L- lysine production ability. Recently, in order to improve the production efficiency of L-lysine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are often used for the production of L-amino acids and other useful substances, and has excellent L-lysine production ability. Various recombinant strains or mutants and L-lysine production methods using the same are being developed.

According to Korea Patent Registration Nos. 10-0838038 and 10-2139806, the nucleotide sequence or amino acid sequence of a gene encoding a protein including an enzyme related to L-lysine production is changed to increase the expression of the gene or an unnecessary gene. By removing the L- lysine production capacity can be improved. In addition, Korean Patent Application Laid-Open No. 10-2020-0026881 discloses a method of changing an existing promoter of a gene to a promoter having strong activity in order to increase the expression of a gene encoding an enzyme involved in L-lysine production.

As described above, various methods for increasing L-lysine production capacity have been developed, but since there are dozens of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-lysine production, it is difficult to change the activity of these proteins. There is still a need for a lot of research on whether the L-lysine production capacity is increased.

Korean Patent No. 10-0838038 Korean Patent No. 10-2139806 Korean Patent Publication No. 10-2020-0026881

An object of the present invention is to provide a mutant Corynebacterium glutamicum having improved L-lysine production ability.

Another object of the present invention is to provide a method for producing L-lysine using the mutant.

The present inventors studied to develop a new mutant with improved L-lysine production ability using a Corynebacterium glutamicum strain. As a result, the lysC gene encoding aspartate kinase, a major enzyme involved in the L-lysine biosynthesis pathway, is And the present invention was completed by confirming that the production of L-lysine was increased when the nucleotide sequence at a specific position in the promoter of the lysC-asd operon containing the asd gene encoding aspartate semialdehyde dehydrogenase was substituted.

One aspect of the present invention provides a Corynebacterium glutamicum mutant with enhanced L-lysine production ability by enhancing the activity of aspartate kinase and aspartate semialdehyde dehydrogenase.

As used in the present invention, “aspartate kinase” is an enzyme involved in the first step of the L-lysine biosynthesis pathway and induces phosphorylation of aspartate to produce aspartyl phosphate. An enzyme that catalyzes a reaction that produces In addition, "aspartate semialdehyde dehydrogenase" used in the present invention is an enzyme involved in the second step of the L-lysine biosynthetic pathway, Refers to an enzyme that catalyzes a reaction to produce aspartate semialdehyde.The lysC gene encoding this aspartate kinase and the asd gene encoding aspartate semialdehyde dehydrogenase are supported by one promoter. Forms the lysC-asd operon whose expression is regulated.

According to one embodiment of the present invention, the aspartate kinase and aspartate semialdehyde dehydrogenase may be derived from a genus strain of Corynebacterium . Specifically, the Corynebacterium sp. strain is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium Corynebacterium callunae , Corynebacterium suranareeae , Corynebacterium lubricantis , Corynebacterium doosanense, Corynebacterium doosanense , Corynebacterium ipish Ens ( Corynebacterium efficiens ), Corynebacterium utereki ( Corynebacterium uterequi ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium pacaense ( Corynebacterium pacaense ), Corynebacterium singulare ( Corynebacterium singulare ) ), Corynebacterium humireducens ( Corynebacterium humireducens ), Corynebacterium marinum ), Corynebacterium halotolerans ( Corynebacterium halotolerans ), Corynebacterium spheniscorum ( Corynebacterium spheniscorum ), Corynebacterium freiburgense ( Corynebacterium freiburgense ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium canis ( Corynebacterium canis ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium Renale ( Corynebacterium renale ), Corynebacterium pollutisoli ( Corynebacterium pollutisoli ), Coryne Bacterium imitans ( Corynebacterium imitans ), Corynebacterium caspium ( Corynebacterium caspium ), Corynebacterium testudinoris ( Corynebacterium testudinoris ), Corynebacterium pseudopelargi ( Corynebacaterium pseudopelargi ) or Corynebacterium fla Bassens ( Corynebacterium flavescens ) It may be, but is not limited thereto.

As used in the present invention, "enhanced activity" means that the expression of a gene encoding a protein, such as a desired enzyme, transcription factor, or transport protein, is newly introduced or increased, so that the expression level is increased compared to the wild-type strain or strain before modification. . The enhancement of this activity is when the activity of the protein itself is increased compared to the activity of the protein possessed by the original microorganism through nucleotide substitution, insertion, deletion, or a combination thereof, and the expression or translation increase of the gene encoding it For example, when the overall degree of enzymatic activity in the cell is higher than that of the wild-type strain or the strain before modification, a combination thereof is also included.

According to one embodiment of the present invention, the enhancement of the activity of aspartate kinase and aspartate semialdehyde dehydrogenase is an operon comprising genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. It may be to induce a site-specific mutation in the promoter of

According to one embodiment of the present invention, the promoter of the operon including the genes encoding the aspartate kinase and aspartate semialdehyde dehydrogenase may be represented by the nucleotide sequence of SEQ ID NO: 1.

As used herein, the term “promoter” refers to a specific region of DNA that regulates transcription of a gene, including a binding site for RNA polymerase that initiates mRNA transcription of a desired gene. It is located upstream from the transcription start point. In prokaryotes, a promoter is defined as a region around the transcriptional initiation point to which RNA polymerase binds, and is generally composed of two short nucleotide sequences -10 and -35 base pairs away from the transcription initiation point. . The promoter mutation in the present invention is improved to have higher activity than the wild-type promoter, and by inducing mutation in the promoter region located above the transcription start point, it is possible to increase the expression of the gene located downstream.

According to one embodiment of the present invention, the enhancement of the activity of aspartate kinase and aspartate semialdehyde dehydrogenase is an operon comprising genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. One or more bases in the -60 to -30 region forward from the transcription start point in the promoter sequence may be substituted.

More specifically, the promoter mutation in the present invention is one or more bases of the -60 to -30 region, preferably the -55 to -35 region, -50 to -30 region, -47 to -45 region, -47 or 1, 2, 3, 4, or 5 bases in the -45 region may be substituted consecutively or discontinuously.

According to an embodiment of the present invention, -47 to -45 region in the promoter sequence of the lysC-asd operon including the aspartate kinase and aspartate semialdehyde dehydrogenase genes of the Corynebacterium glutamicum strain. By substituting the nucleotide sequence from gag to taa, a Corynebacterium glutamicum mutant having a new promoter sequence of the lysC-asd operon was obtained. Such a Corynebacterium glutamicum mutant may include a mutated promoter of the lysC-asd operon represented by the nucleotide sequence of SEQ ID NO: 2.

As used in the present invention, "improved productivity" means that the productivity of L-lysine is increased compared to the parent strain. The parent strain means a wild-type or mutant strain to be mutated, and includes a target to be directly mutated or transformed with a recombinant vector. In the present invention, the parent strain may be a wild-type Corynebacterium glutamicum strain or a strain mutated from the wild-type.

According to one embodiment of the present invention, the parent strain is a mutant strain induced in the sequence of a gene (eg, lysC, zwf and hom genes) involved in lysine production, and the Korean Culture Center of Microorganisms. It may be a Corynebacterium glutamicum strain deposited with accession number KCCM12969P on April 2, 2021 (hereinafter referred to as 'Corynebacterium glutamicum DS1 strain').

As such, the mutant Corynebacterium glutamicum with improved L-lysine-producing ability of the present invention has a mutated promoter sequence of the lysC-asd operon including genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. may include.

According to one embodiment of the present invention, the mutant strain may include the nucleotide sequence represented by SEQ ID NO: 2 as a promoter sequence of an operon including the genes of aspartate kinase and aspartate semialdehyde dehydrogenase. .

According to an embodiment of the present invention, the mutant shows an increased L-lysine production ability compared to the parent strain by including a mutation in the promoter sequence of the lysC-asd operon, and in particular, the L-lysine production is 3% or more compared to the parent strain , specifically 3 to 40%, more specifically 5 to 30% increase to produce 65 to 80 g of L-lysine per 1 liter of strain culture, preferably 68 to 75 g of L-lysine can In addition, the mutant strain increases the production of L-lysine by 4.6% or more compared to the promoter mutant strain of the conventional lysC-asd operon having a different promoter mutation position, thereby producing L-lysine in a high yield.

Corynebacterium glutamicum mutant according to an embodiment of the present invention includes a mutant in which the promoter sequence of the operon including the genes of aspartate kinase and aspartate semialdehyde dehydrogenase in the parent strain is partially substituted It can be implemented through a recombinant vector.

As used in the present invention, “some” means not all of the base sequence or polynucleotide sequence, and may be 1 to 300, preferably 1 to 100, more preferably 1 to 50, but is limited thereto. it is not

As used herein, “variant” refers to at least one of -60 to -30 regions in the promoter sequence of an operon including genes of aspartate kinase and aspartate semialdehyde dehydrogenase involved in the biosynthesis of L-lysine. It refers to a promoter variant in which the base is substituted.

According to one embodiment of the present invention, the mutant in which the nucleotide sequence in the region of -47 to -45 in the promoter sequence of the operon including the aspartate kinase and aspartate semialdehyde dehydrogenase genes is substituted with taa is It may be one having the nucleotide sequence of SEQ ID NO: 2.

As used herein, the term “vector” refers to an expression vector capable of expressing a target protein in a suitable host cell, and refers to a gene preparation comprising essential regulatory elements operably linked to express a gene insert. Here, “operably linked” means that a gene requiring expression and its regulatory sequence are functionally linked to each other and linked in a way that enables gene expression, and “regulatory element” refers to a promoter for performing transcription, regulating transcription including any operator sequences for sequencing, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation. Such vectors include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like.

The "recombinant vector" used in the present invention can be replicated independently of the genome of the host cell after transformation into a suitable host cell, or can be sutured into the genome itself. In this case, the "suitable host cell" may include a replication origin, which is a specific nucleotide sequence from which replication is initiated as a vector capable of replication.

For the transformation, an appropriate vector introduction technique is selected according to the host cell, and the desired gene can be expressed in the host cell. For example, vector introduction can be performed by electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE- Dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof can be carried out. As long as the transformed gene can be expressed in the host cell, it may be included without limitation whether it is inserted into the chromosome of the host cell or located outside the chromosome.

The host cells include cells transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro. A host cell comprising the recombinant vector of the present invention is a recombinant host cell, a recombinant cell or a recombinant microorganism.

In addition, the recombinant vector according to the present invention may include a selection marker, the selection marker is for selecting transformants (host cells) transformed with the vector, in the medium treated with the selection marker. Since only cells expressing the selection marker can survive, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, kanamycin, streptomycin, chloramphenicol, and the like.

Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium due to homologous recombination crossover.

According to one embodiment of the present invention, the host cell may be a Corynebacterium sp. strain, for example, Corynebacterium glutamicum ( Corynebacterium glutamicum ) It may be a strain.

In addition, another aspect of the present invention comprises: a) culturing the Corynebacterium glutamicum mutant in a medium; And b) provides a method for producing L- lysine comprising the step of recovering L-lysine from the culture medium of the mutant or mutant strain.

The culture may be performed according to an appropriate medium and culture conditions known in the art, and those skilled in the art may easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.

According to one embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner, and may be appropriately modified by a person skilled in the art. The culture medium for the Corynebacterium sp. strain may refer to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but is not limited thereto.

According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source may also be used individually or as a mixture, but is not limited thereto. Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. In addition, precursors suitable for the culture medium may be used. The medium or individual components may be added batchwise or continuously by an appropriate method to the culture medium during the culturing process, but is not limited thereto.

According to one embodiment of the present invention, it is possible to adjust the pH of the culture medium by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microorganism culture medium in an appropriate manner during culture. In addition, the use of an antifoaming agent such as fatty acid polyglycol ester during culture can suppress the formation of bubbles. Additionally, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (eg, air) may be injected into the culture medium. The temperature of the culture medium may be usually 20 °C to 45 °C, for example, 25 °C to 40 °C. The incubation period may be continued until a useful substance is obtained in a desired production amount, for example, it may be 10 to 160 hours.

According to one embodiment of the present invention, the step of recovering L-lysine from the cultured medium and the cultured mutant strain is L-lysine produced from the medium using a suitable method known in the art according to the culture method. can be collected or retrieved. e.g. centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractionation (e.g. ammonium sulfate precipitation), chromatography (e.g. ion exchange, affinity, hydrophobicity and size exclusion) may be used, but the present invention is not limited thereto.

According to one embodiment of the present invention, in the step of recovering lysine, the biomass is removed by centrifuging the culture medium at low speed, and the obtained supernatant can be separated through ion exchange chromatography.

According to one embodiment of the present invention, the step of recovering L-lysine may include a step of purifying L-lysine.

Corynebacterium glutamicum mutant according to the present invention by increasing or enhancing the expression of genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase (lysC-asd operon) compared to the parent strain L- It is possible to improve the production yield of lysine.

1 shows the structure of a pCGI (Pm-lysC') vector comprising a promoter in which the base sequence of the -47 to -45 region in the promoter sequence of the lysC-asd operon is substituted with taa according to an embodiment of the present invention. .

Hereinafter, the present invention will be described in more detail. However, these descriptions are provided for illustrative purposes only to help the understanding of the present invention, and the scope of the present invention is not limited by these illustrative descriptions.

Example 1. Preparation of Corynebacterium glutamicum mutants

In order to prepare a Corynebacterium glutamicum mutant with enhanced activity of aspartate kinase and aspartate semialdehyde dehydrogenase, a Corynebacterium glutamicum DS1 strain was used.

1-1. Mutagenesis

Corynebacterium glutamicum DS1 strain containing CM broth (glucose 5 g, NaCl 2.5 g, yeast extract 5.0 g, urea 1.0 g, polypeptone 10.0 g and beef extract 5.0 g, pH 6.8 ) inoculated into a flask containing 50 ㎖, and the mutagenic N-methyl-N`-nitro-N-nitrosoguanidine (N-methyl-N`-nitro-N-nitrosoguanidine, NTG) was added to a final concentration of 300 ㎍/㎖ After addition, the cells were incubated with shaking at 30° C. at 200 rpm for 20 hours. After completion of the culture, the culture solution was centrifuged at 12,000 rpm for 10 minutes to remove the supernatant, washed once with saline, and washed three more times with phosphate buffer. This was suspended in 5 ㎖ of phosphate buffer, then spread on CM solid medium (CM liquid medium further containing 15 g/L of agar) and cultured at 30° C. for 30 hours to separate 100 colonies.

1-2. Selection of mutants with improved L-lysine production capacity

100 isolated colonies were inoculated 5% each in a flask containing 10 ml of the production broth shown in Table 1, and incubated with shaking at 30° C. at 200 rpm for 30 hours. The absorbance of each culture medium was measured at OD 610 nm and L-lysine production was compared to select 3 colonies that produced more than 75.0 g/L of L-lysine. mutations in the promoter of the lysC-asd operon including the Through sequencing of these promoters, the promoter mutation position of the lysC-asd operon was confirmed.

Furtherance Content (based on 1 L) Glucose 100 g Ammonium sulfate 55 g (NH ₄ ) ₂ SO ₄ 35 g KH ₂ PO ₄ 1.1 g MgSO ₄ ㆍH ₂ O 1.2 g MnSO ₄ ㆍH ₂ O 180 mg FeSO ₄ ㆍH ₂ O 180 mg Thiamine・HCl 9 mg Biotin 1.8 mg CaCO ₃ 5% pH 7.0

As a result, it was confirmed that the nucleotide sequence was substituted from gag to taa in the region -47 to -45 above the start codon of the gene in the lysC-asd operon in all three colonies. One Corynebacterium glutamicum DS1 mutant strain for chromosomal DNA extraction among 3 colonies was selected, and thereafter, L-lysine by promoter mutation of the lysC-asd operon using the Corynebacterium glutamicum DS1 strain. An experiment was performed to verify the productivity increase.

Example 2. Preparation of Corynebacterium glutamicum mutants

In order to prepare a Corynebacterium glutamicum mutant with enhanced activity of aspartate kinase and aspartate semialdehyde dehydrogenase, Corynebacterium glutamicum DS1 strain and E. coli DH5a (HIT Competent cells ™, Cat No. RH618) was used.

The Corynebacterium glutamicum DS1 strain is a CM of 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone and 5.0 g of beef extract in 1 L of distilled water. Incubated in a liquid medium (pH 6.8) at a temperature of 30 ℃.

E. coli DH5a was cultured at a temperature of 37° C. on LB medium having a composition of 10.0 g of tryptone, 10.0 g of NaCl and 5.0 g of yeast extract in 1 L of distilled water.

Products of Sigma were used for kanamycin and streptomycin, and DNA sequencing analysis was requested by Macrogen Co., Ltd. and analyzed.

2-1. Construction of Recombinant Vector

Enrichment of aspartate kinase and aspartate semialdehyde dehydrogenase was introduced into the strain to enhance lysine biosynthetic pathway to increase lysine productivity. In order to increase the expression of the lysC-asd operon including genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase, the method used in this Example is a promoter-specific mutation of the lysC-asd operon gene. caused In order to replace the nucleotide sequence at positions -47 to -45 in the promoter of the lysC-asd operon gene from gag to taa, the left arm centered on the promoter mutation position of the lysC-asd operon on the genome of the Corynebacterium glutamicum DS1 strain. The 478 bp portion and the 475 bp portion of the right arm were amplified by PCR using the primers of SEQ ID NOs: 3 and 4 and 5 and 6 of Table 2 below. In addition, using the vector pCGI (see Kim et al., Journal of Microbiological Methods 84 (2011) 128-130) as a template, using the primers of SEQ ID NOs: 7 and 8, and 9 and 10 of Table 2 below After PCR amplification, 4 PCR products were cloned using self-assembly cloning. The prepared recombinant plasmid was named pCGI (Pm-lysC') (see FIG. 1).

Primer (5' - 3') SEQ ID NO: Amplification primers containing promoter mutations lysCP-F1 CCGTCACAAGACCAAGGATG 3 lysCP-R1 AGTGGCACATTGAATGCACG 4 lysCP-F2 TGATTACGCCCCGTCACAAGACCAAGGATG 5 lysCP-R2 TGAATGCACGAGCGTATTCA 6 pCGI vector amplification
primer pCGI-F1 ACTGGCCGTCGTTTTACAAC 7 pCGI-R1 GGCGTAATCATGGTCATAGC 8 pCGI-F2 ATGTGCCACTACTGGCCGTCGTTTTACAAC 9 pCGI-R2 TGGTCATAGCTGTTTCCTGTG 10

The conditions for performing PCR using the above primers are as follows. Using a Thermocycler (TP600, TAKARA BIO Inc., Japan), each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) 100 μM was added to the reaction solution to which 1 pM of the oligonucleotide was added, and the coryne selected in Example 1 Using 10 ng of DNA of each chromosomal DNA or pCGI vector of Bacterium glutamicum DS1 mutant strain (a mutation occurs in the promoter -47 ~ -45 region) as a template, 1 unit of pfu-X DNA polymerase mixture (Solgent) 25 to 30 cycles were performed in the presence of PCR conditions are (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 1-2 at 72°C It was carried out under the conditions of minutes (providing a polymerization time of 2 minutes per 1 kb).

The gene fragment thus prepared was cloned into the pCGI vector using self-assembly cloning. The vector was transformed into E. coli DH5a, spread on an LB-agar plate containing 50 μg/ml of kanamycin, and cultured at 37° C. for 24 hours. After the final colony was isolated and it was confirmed that the insert was accurately present in the vector, this vector was isolated and used for recombination of the Corynebacterium glutamicum DS1 strain.

For gene manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes, and NEB products were used for various restriction enzymes and DNA modifying enzymes, and were used according to the supplied buffers and protocols.

2-2. manufacturing of mutants

A mutant strain DS6 was prepared using the pCGI (Pm-lysC') vector. Electroporation (see Tauch et al., FEMS Microbiology letters 123 (1994) 343-347) was used to prepare the vector to have a final concentration of 1 μg/μl or more, and to Corynebacterium glutamicum DS1 strain. to induce primary recombination. At this time, the electroporated strain was spread on a CM solid medium containing 20 μg/μl of kanamycin to isolate colonies, and then it was confirmed through PCR and sequencing whether it was properly inserted into the induced position on the genome. In order to induce secondary recombination, the isolated strain was inoculated on CM-agar liquid medium containing streptomycin, cultured overnight or more, and spread on an agar medium containing the same concentration of streptomycin to isolate colonies. did. After confirming the resistance to kanamycin among the finally isolated colonies, it was confirmed by sequencing whether a mutation was introduced into the promoter of the lysC-asd operon gene among strains without antibiotic resistance (Schafer et al., Gene 145). (1994) 69-73). Finally, a Corynebacterium glutamicum mutant DS6 strain in which a mutation was introduced into the promoter of the lysC-asd operon gene was obtained.

Comparative Example 1. Corynebacterium glutamicum mutant strain

In the promoter sequence of the lysC-asd operon encoding aspartate kinase and aspartate semialdehyde dehydrogenase genes disclosed in Korean Patent Registration No. 10-0930203, aaa is mutated to tgt in the region -54 to -52 The induced mutant (lysCP1) was used.

Experimental Example 1. Comparison of L-Lysine Productivity of Mutants

L- lysine productivity of the parent strain Corynebacterium glutamicum DS1 strain, the lysine-producing mutant DS6 strain prepared in Example 1 and the lysCP1 strain, which is the conventional lysine-producing mutant of Comparative Example 1, was compared.

Each strain was inoculated into a 100 ml flask containing 10 ml of lysine medium having the composition shown in Table 1, respectively, and cultured with shaking at 30° C. for 28 hours and 180 rpm. Lysine analysis after the end of culture was measured by the production of L-lysine by HPLC (Shimazu, Japan), the results are shown in Table 3.

strain L-Lysine (g/L) L-lysine production per unit cell (g/gDCW) parent strain (DS1) 64.5 6.98 Variant (DS6) 70.5 8.31 mutant (lysCP1) 67.5 7.57

As shown in Table 3 above, in the Corynebacterium glutamicum mutant DS6 strain, the specific position (-47 to -45 region) of the promoter sequence of the lysC-asd operon is the optimal base sequence for the enhancement of the lysine biosynthesis pathway. By substitution, it was confirmed that the productivity of L-lysine was increased by about 9.3% compared to the parent strain Corynebacterium glutamicum DS1 strain.

In addition, it was confirmed that the Corynebacterium glutamicum mutant DS6 strain increased the productivity of L-lysine by 4.6% or more compared to the conventional mutant lysCP1 having a different mutation position (-54 to -52 region) and sequence (tgt).

Through these results, it was found that enhancing the expression of genes in the lysC-asd operon due to mutation of the promoter -47 to -45 region improves the L-lysine production capacity of the strain by enhancing the lysine biosynthesis performance.

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> DAESANG CORPORATION <120> Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same <130> PN210036 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 353 <212> DNA <213> Artificial Sequence <220> <223> Promoter sequence of lysC gene <400> 1 ccatcttttg gggtgcggag cgcgatccgg tgtctgacca cggtgcccca tgcgattgtt 60 aatgccgatg ctagggcgaa aagcacggcg agcagattgc tttgcacttg attcagggta 120 gttgactaaa gagttgctcg cgaagtagca cctgtcactt ttgtctcaaa tattaaatcg 180 aatatcaata tatggtctgt ttattggaac gcgtcccagt ggctgagacg catccgctaa 240 agccccagga accctgtgca gaaagaaaac actcctctgg ctaggtagac acagtttata 300 aaggtagagt tgagcgggta actgtcagca cgtagatcga aaggtgcaca aag 353 <210> 2 <211> 353 <212> DNA <213> Artificial Sequence <220> <223> Mutant promoter sequence of lysC gene <400> 2 ccatcttttg gggtgcggag cgcgatccgg tgtctgacca cggtgcccca tgcgattgtt 60 aatgccgatg ctagggcgaa aagcacggcg agcagattgc tttgcacttg attcagggta 120 gttgactaaa gagttgctcg cgaagtagca cctgtcactt ttgtctcaaa tattaaatcg 180 aatatcaata tatggtctgt ttattggaac gcgtcccagt ggctgagacg catccgctaa 240 agccccagga accctgtgca gaaagaaaac actcctctgg ctaggtagac acagtttata 300 aaggtataat tgagcgggta actgtcagca cgtagatcga aaggtgcaca aag 353 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> lysCP-F1 <400> 3 ccgtcacaag accaaggatg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> lysCP-R1 <400> 4 agtggcacat tgaatgcacg 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lysCP-F2 <400> 5 tgattacgcc ccgtcacaag accaaggatg 30 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> lysCP-R2 <400> 6 tgaatgcacg agcgtattca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pCGI-F1 <400> 7 actggccgtc gttttacaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pCGI-R1 <400> 8 ggcgtaatca tggtcatagc 20 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pCGI-F2 <400> 9 atgtgccact actggccgtc gttttacaac 30 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pCGI-R2 <400> 10 tggtcatagc tgtttcctgt g 21

Claims (5)

Aspartate kinase and aspartate semialdehyde dehydrogenase activity is enhanced Corynebacterium glutamicum ( Corynebacterium glutamicum ) mutant with improved L-lysine production ability.
The method according to claim 1,
The enhancement of the activity of aspartate kinase and aspartate semialdehyde dehydrogenase is site-specific in the promoter of the lysC-asd operon comprising genes encoding aspartate kinase and aspartate semialdehyde dehydrogenase. Corynebacterium glutamicum mutant strain that induces mutation.
3. The method according to claim 2,
The promoter of the lysC-asd operon comprising genes encoding the aspartate kinase and aspartate semialdehyde dehydrogenase is a Corynebacterium glutamicum mutant represented by the nucleotide sequence of SEQ ID NO: 1.
The method according to claim 1,
The mutant Corynebacterium glutamicum mutant comprising the nucleotide sequence represented by SEQ ID NO: 2.
a) culturing the mutant of claim 1 in a medium; and
b) a method for producing L-lysine comprising the step of recovering L-lysine from the culture medium of the mutant or mutant strain.

Images