KR101768390B1 - A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same - Google Patents

A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same Download PDF

Info

Publication number
KR101768390B1
KR101768390B1 KR1020160123477A KR20160123477A KR101768390B1 KR 101768390 B1 KR101768390 B1 KR 101768390B1 KR 1020160123477 A KR1020160123477 A KR 1020160123477A KR 20160123477 A KR20160123477 A KR 20160123477A KR 101768390 B1 KR101768390 B1 KR 101768390B1
Authority
KR
South Korea
Prior art keywords
ala
glu
asp
leu
lys
Prior art date
Application number
KR1020160123477A
Other languages
Korean (ko)
Other versions
KR20160118172A (en
Inventor
허란
이광호
김형준
문준옥
유송기
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to KR1020160123477A priority Critical patent/KR101768390B1/en
Publication of KR20160118172A publication Critical patent/KR20160118172A/en
Application granted granted Critical
Publication of KR101768390B1 publication Critical patent/KR101768390B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1247DNA-directed RNA polymerase (2.7.7.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/08Lysine; Diaminopimelic acid; Threonine; Valine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07Nucleotidyltransferases (2.7.7)
    • C12Y207/07006DNA-directed RNA polymerase (2.7.7.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • C12N2510/02Cells for production
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2511/00Cells for large scale production

Abstract

본 발명은 신규한 변이형 RNA 중합효소 시그마인자 A(SigA) 폴리펩티드, 이를 코딩하는 폴리뉴클레오티드, 상기 폴리펩티드를 포함하는 미생물 및 상기 미생물을 이용한 L-라이신의 생산 방법에 관한 것이다.The present invention relates to a novel mutated RNA polymerase sigma factor A (SigA) polypeptide, a polynucleotide encoding the same, a microorganism containing the polypeptide, and a method for producing L-lysine using the microorganism.

Description

L-라이신 생산능이 향상된 미생물 및 이를 이용한 L-라이신 생산방법{A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same}A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same}

본 발명은 신규한 변이형 RNA 중합효소 시그마인자 A(SigA) 폴리펩티드, 이를 코딩하는 폴리뉴클레오티드, 상기 폴리펩티드를 포함하는 미생물 및 상기 미생물을 이용한 L-라이신의 생산 방법에 관한 것이다.The present invention relates to a novel variant RNA polymerase sigma factor A (SigA) polypeptide, a polynucleotide encoding the same, a microorganism comprising the polypeptide, and a method for producing L-lysine using the microorganism.

아미노산 등 유용산물의 대량생산을 위한 균주의 개발을 위해 해당경로(glycolysis) 상의 상위 단계에서 직·간접적으로 관여하는 유전적 요인들을 찾아내어 적절히 이용한다면 보다 높은 생산수율을 가진 균주를 개발할 수 있다. 대표적인 기술로는 RNA 중합효소의 리쿠르팅 단백질(recruiting protein)에 무작위 돌연변이를 일으킴으로써 세포 내 모든 유전자의 발현을 조절하는 gTME(global transcription machinery engineering) 기술이 있다. 일례로 메사추세츠 공과대학(Massachusetts Institute of Technology)의 연구그룹은 gTME 기술을 이용하여 대장균에서 타이로신의 생산량을 크게 증가시키는 데에도 성공한 바 있다(미국등록특허 제8735132호). For the development of strains for mass production of useful products such as amino acids, strains with higher production yields can be developed if genetic factors directly or indirectly involved in the upper stage of the glycolysis are found and used appropriately. As a representative technology, there is a global transcription machinery engineering (gTME) technology that controls the expression of all genes in cells by generating random mutations in the recruiting protein of RNA polymerase. For example, a research group at the Massachusetts Institute of Technology has also successfully increased the production of tyrosine in E. coli using gTME technology (US Patent No. 8735132).

미생물의 전사단계에서 쓰여지는 RNA 중합효소(RNA polymerase)는 5개의 소단위체(subunit)로 구성된 거대분자로서, 2개의 알파 인자(α), 베타(β), 베타 프라임(β’) 및 오메가 인자(ω)로 구성되어 있으며, 완전효소(holoenzyme)는 α2ββ'ω로 표시된다. 이들 완전효소와 함께 시그마 인자(σ)는 RNA 중합효소의 프로모터 결합 특이성을 부여하는 전사의 개시 단계에 필수적인 요소이다. 코리네박테리움 속 균주는 7종의 시그마 인자(SigA, SigB, SigC, SigD, SigE, SigH, SigM)를 갖고 있으며 외부 환경 변화에 따라 특정 유전자 그룹들의 전사를 조절한다(Journal of Biotechnology 154. 2011. 101-113). 특히, SigA는 7종의 시그마 인자 중 대부분의 house keeping 유전자들 및 핵심 유전자들을 조절하는 주된 조절자로서, SigA에 무작위로 변이를 주어 목적 물질의 생산성을 높이는 연구들이 보고되었으며(Metabolic Engineering 9. 2007. 258-267), 코리네박테리움 속 균주를 이용하여 L-라이신 생산성을 증가시킨 연구도 보고된 바 있다(국제공개특허 제WO2003-054179호). RNA polymerase used in the transcription stage of microorganisms is a macromolecule composed of five subunits, two alpha factors (α), beta (β), beta prime (β') and omega factors. It is composed of (ω), and the holoenzyme is expressed as α 2 ββ'ω. Along with these complete enzymes, sigma factor (σ) is an essential element in the initiation of transcription that confers promoter-binding specificity of RNA polymerase. The strain of the genus Corynebacterium has seven types of sigma factors (SigA, SigB, SigC, SigD, SigE, SigH, SigM) and regulates the transcription of specific gene groups according to changes in the external environment (Journal of Biotechnology 154. 2011 101-113). In particular, SigA is a major regulator of most house keeping genes and core genes among seven sigma factors, and studies have been reported to increase the productivity of target substances by randomly mutating SigA (Metabolic Engineering 9. 2007). 258-267), a study of increasing L-lysine productivity using a strain of the genus Corynebacterium has also been reported (International Publication No. WO2003-054179).

이러한 배경 하에, 본 발명자들은 숙주 세포의 성장 저해 없이 보다 높은 농도의 L-라이신을 생산하는 미생물을 개발하고자 예의 노력한 결과, 신규한 변이형 RNA 중합효소의 시그마인자 A(SigA) 폴리펩티드를 개발하여 L-라이신 생산능을 갖는 코리네박테리움 속에 도입함으로써 L-라이신의 생산능이 향상된 균주를 개발할 수 있음을 확인하여 본 발명을 완성하였다.Under this background, the present inventors have made diligent efforts to develop a microorganism that produces a higher concentration of L-lysine without inhibiting the growth of host cells, and as a result, developed a novel variant RNA polymerase sigma factor A (SigA) polypeptide. -By introducing into Corynebacterium having lysine-producing ability, it was confirmed that a strain having improved L-lysine-producing ability can be developed, thereby completing the present invention.

본 발명의 목적은 서열번호 2의 아미노산 서열로 이루어진 RNA 중합효소 시그마인자 A 활성을 가지는 폴리펩티드의 일부 아미노산을 치환한 변이형 폴리펩티드를 제공하는 것이다.An object of the present invention is to provide a variant polypeptide in which some amino acids of a polypeptide having RNA polymerase sigma factor A activity consisting of the amino acid sequence of SEQ ID NO: 2 are substituted.

본 발명의 다른 목적은 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.Another object of the present invention is to provide a polynucleotide encoding the variant polypeptide.

본 발명의 다른 목적은 상기 폴리펩티드를 포함하도록 형질전환된 미생물을 제공하는 것이다.Another object of the present invention is to provide a microorganism transformed to contain the polypeptide.

본 발명의 또 다른 목적은 상기 미생물을 배양하여 배양물을 수득하는 단계; 및 상기 배양물 또는 미생물로부터 L-라이신을 회수하는 단계를 포함하는 L-라이신의 생산방법을 제공하는 것이다.Another object of the present invention is to obtain a culture by culturing the microorganism; And recovering L-lysine from the culture or microorganism.

상기의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 신규한 RNA 중합효소 시그마인자 A 활성을 갖는 변이형 폴리펩티드를 제공한다. As one aspect for achieving the above object, the present invention provides a novel variant polypeptide having RNA polymerase sigma factor A activity.

본 발명에서 용어, "RNA 중합효소 시그마인자 A(SigA)"는 RNA 중합효소와 함께 작용하는 전사시작인자로서 시그마인자(sigma factor) 중의 하나에 해당하는 단백질(SigA)이다. 시그마인자는 특정 프로모터의 상류에 존재하는 upstream DNA(UP element)와 여러 가지 전사조절인자와 상호작용하여 전사조절에 관여한다. 특히 시그마인자 A(SigA)는 핵심 유전자의 대부분을 조절하는 주된 조절자(regulator)로 알려져 있다. 상기 SigA 단백질에 대한 정보는 NCBI GenBank와 같은 공지의 데이터베이스로부터 얻을 수 있으며, 그 예로 Accession number가 NP_601117인 단백질일 수 있다. 구체적으로, SigA 단백질은 서열번호 2의 아미노산 서열을 포함할 수 있으며, 본 발명의 SigA와 동일한 활성을 갖는 한 이에 한정되지 않는다.In the present invention, the term "RNA polymerase sigma factor A (SigA)" is a protein (SigA) corresponding to one of the sigma factors as a transcription initiation factor that works with RNA polymerase. Sigma factor is involved in transcriptional regulation by interacting with upstream DNA (UP element) present upstream of a specific promoter and various transcriptional regulators. In particular, sigma factor A (SigA) is known as a major regulator that controls most of the key genes. Information on the SigA protein can be obtained from a known database such as NCBI GenBank, for example, a protein having an accession number of NP_601117. Specifically, the SigA protein may include the amino acid sequence of SEQ ID NO: 2, and is not limited thereto as long as it has the same activity as the SigA of the present invention.

본 발명에서 용어, "변이형 폴리펩티드"는 야생형 폴리펩티드의 아미노산 서열 일부 또는 전체가 치환된 것으로, 본 발명에서는 RNA 중합효소 시그마인자 A(SigA) 활성을 가지는 폴리펩티드의 아미노산 서열 일부가 치환됨으로써 야생형(wild-type)의 아미노산 서열과 일부 다른 서열을 가진 RNA 중합효소 시그마인자 A(SigA) 활성을 가지는 폴리펩티드이다. 즉, 야생형인 SigA 폴리펩티드가 아닌, L-라이신 생산능 향상에 기여하는 SigA 변이형 폴리펩티드를 제시하는 것이다.In the present invention, the term "variant polypeptide" means that a part or all of the amino acid sequence of a wild-type polypeptide is substituted, and in the present invention, a part of the amino acid sequence of a polypeptide having RNA polymerase sigma factor A (SigA) activity is substituted. It is a polypeptide having RNA polymerase sigma factor A (SigA) activity having a sequence different from that of the amino acid sequence of -type). That is, it is not a wild-type SigA polypeptide, but a SigA variant polypeptide that contributes to improving the L-lysine production ability.

구체적으로, 상기 변이형 폴리펩티드는 서열번호 2의 아미노산 서열로 이루어진 폴리펩티드에서 하기 위치의 아미노산 중 1 이상의 아미노산이 다른 아미노산으로 치환된, RNA 중합효소 시그마인자 A 활성을 가지는 변이형 폴리펩티드로서, 상기 변이 위치는시작 메치오닌을 1번째 아미노산으로 하여 이로부터 136번째 아미노산; 254번째 아미노산; 268번째 아미노산; 281번째 아미노산; 381번째 아미노산; 429번째 아미노산; 및 445번째 내지 495번째 아미노산일 수 있다. 즉 상기 변이형 폴리펩티드는 상기 57개의 변이 위치(136번, 254번, 268번, 281번, 381번, 429번, 445-495번) 중에서 1 이상의 위치가 다른 아미노산으로 치환된 폴리펩티드일 수 있다.Specifically, the variant polypeptide is a variant polypeptide having RNA polymerase sigma factor A activity in which at least one of the amino acids at the following positions in the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid, and the mutant position Is the starting methionine as the first amino acid, from which the 136th amino acid; 254th amino acid; 268th amino acid; 281th amino acid; 381th amino acid; 429th amino acid; And 445th to 495th amino acids. That is, the variant polypeptide may be a polypeptide in which at least one of the 57 mutation positions (136, 254, 268, 281, 381, 429, 445-495) is substituted with another amino acid.

보다 구체적으로 상기 445번째 내지 495번째 아미노산 중에서, 447번째 아미노산; 451번째 아미노산; 455번째 아미노산; 479번째 아미노산; 483번째 아미노산; 488번째 아미노산; 및 491번째 아미노산으로 이루어진 아미노산 중 1종 이상의 아미노산이 다른 아미노산으로 치환될 수 있으나 이에 한정되지 않는다.More specifically, from the 445th to 495th amino acids, the 447th amino acid; 451th amino acid; 455th amino acid; 479th amino acid; 483th amino acid; 488th amino acid; And one or more of the amino acids consisting of the 491th amino acid may be substituted with another amino acid, but is not limited thereto.

구체적인 아미노산 치환은 하기 13종의 아미노산 치환 중 1종 이상이 조합된 것일 수 있으며, 시작 메치오닌으로부터 136번째 아미노산이 글리신으로 치환(D136G); 254번째 아미노산이 아스파라진으로 치환(I254N); 268번째 아미노산이 세린으로 치환(A268S); 281번째 아미노산이 세린으로 치환(T281S); 381번째 아미노산 알지닌으로 치환(L381R); 429번째 아미노산이 알지닌으로 치환(Q429R); 447번째 아미노산이 히스티딘으로 치환(L447H); 451번째 아미노산이 이소류신으로 치환(L451I); 455번째 아미노산이 발린으로 치환(M455V); 479번째 아미노산이 알지닌으로 치환(K479R); 483번째 아미노산이 알지닌으로 치환(K483R); 488번째 아미노산이 쓰레오닌으로 치환(S488T); 및 491번째 아미노산이 알지닌으로 치환(Q491R)으로 이루어진 것일 수 있다. A specific amino acid substitution may be a combination of one or more of the following 13 amino acid substitutions, and the 136th amino acid from the starting methionine is substituted with glycine (D136G); 254th amino acid is substituted with asparagine (I254N); 268th amino acid is substituted with serine (A268S); 281th amino acid is substituted with serine (T281S); Substituted by arginine at the 381th amino acid (L381R); 429th amino acid is substituted with arginine (Q429R); 447th amino acid is substituted with histidine (L447H); 451th amino acid is substituted with isoleucine (L451I); 455th amino acid is substituted with valine (M455V); 479th amino acid is substituted with arginine (K479R); 483th amino acid is substituted with arginine (K483R); 488th amino acid is substituted with threonine (S488T); And the 491 th amino acid may be substituted with arginine (Q491R).

더욱 구체적으로 상기 폴리펩티드는 서열번호 2의 아미노산 서열로 이루어진 폴리펩티드의 시작 메치오닌으로부터 136번째 및 281째 아미노산이 각각 글리신 및 세린으로 치환(D136G, T281S); 254번째 아미노산이 아스파라진으로 치환(I254N); 268번째 아미노산이 세린으로 치환(A268S); 381번째 아미노산 알지닌으로 치환(L381R); 429번째 아미노산이 알지닌으로 치환(Q429R); 447번째 아미노산이 히스티딘으로 치환(L447H); 451번째 및 491번째 아미노산이 각각 이소류신 및 알지닌으로 치환(L451I, Q491R); 455번째 아미노산이 발린으로 치환(M455V); 479번째 아미노산이 알지닌으로 치환(K479R); 483번째 아미노산이 알지닌으로 치환(K483R); 488번째 아미노산이 쓰레오닌으로 치환(S488T); 또는 상기 11종의 아미노산 치환 중 1종 이상이 조합된 것인 변이형 폴리펩티드일 수 있다.More specifically, in the polypeptide, the 136th and 281th amino acids from the starting methionine of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 are substituted with glycine and serine, respectively (D136G, T281S); 254th amino acid is substituted with asparagine (I254N); 268th amino acid is substituted with serine (A268S); Substituted by arginine at the 381th amino acid (L381R); 429th amino acid is substituted with arginine (Q429R); 447th amino acid is substituted with histidine (L447H); 451st and 491th amino acids are substituted with isoleucine and arginine, respectively (L451I, Q491R); 455th amino acid is substituted with valine (M455V); 479th amino acid is substituted with arginine (K479R); 483th amino acid is substituted with arginine (K483R); 488th amino acid is substituted with threonine (S488T); Or it may be a variant polypeptide in which one or more of the 11 kinds of amino acid substitutions are combined.

본 발명의 일 구현예에 따르면, 상기 변이형 폴리펩티드는 서열번호 12 내지 22의 아미노산 서열 중 어느 하나의 아미노산 서열을 갖는 폴리펩티드일 수 있다. According to an embodiment of the present invention, the variant polypeptide may be a polypeptide having any one of the amino acid sequences of SEQ ID NOs: 12 to 22.

본 발명의 변이형 폴리펩티드는 상기 서열번호 12 내지 22로 기재한 아미노산 서열뿐만 아니라, 상기 서열과 70% 이상, 구체적으로는 80% 이상, 보다 구체적으로는 90% 이상, 더욱 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서, 야생형 SigA 단백질에 비하여 L-라이신의 생산능 향상에 기여한 단백질이라면 제한없이 포함하며, 이러한 상동성을 갖는 서열로서 실질적으로 변이형 SigA 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 본 발명의 범위에 포함됨은 자명하다.The variant polypeptide of the present invention is not only the amino acid sequence set forth in SEQ ID NOs: 12 to 22, but also 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically 99% or more of the sequence. As an amino acid sequence showing homology, any protein that contributes to the improvement of the production ability of L-lysine compared to the wild-type SigA protein is included without limitation, and as a sequence having such a homology, it has a biological activity that is substantially the same as or corresponding to the mutant SigA protein. In the case of having an amino acid sequence, it is obvious that some sequences are included in the scope of the present invention, even if they have an amino acid sequence that has been deleted, modified, substituted or added.

본 발명에서 용어, "상동성"은 단백질을 코딩하는 유전자의 아미노산 또는 염기서열에 있어서, 특정 비교 영역에서 양 서열을 최대한 일치되도록 정렬 (align)시킨 후 서열 간의 염기 또는 아미노산 잔기의 동일한 정도를 의미한다. 상동성이 충분히 높은 경우 해당 유전자의 발현 산물은 동일하거나 유사한 활성을 가질 수 있다. 상기 서열 동일성의 퍼센트는 공지의 서열 비교 프로그램을 사용하여 결정될 수 있으며, 일례로 BLAST(NCBI), CLC Main Workbench (CLC bio), MegAlignTM(DNASTAR Inc) 등을 들 수 있다.In the present invention, the term "homology" refers to the degree of identicality of bases or amino acid residues between sequences after alignment of both sequences so as to match as much as possible in a specific comparison region in the amino acid or base sequence of a gene encoding a protein do. If the homology is sufficiently high, the expression product of the gene may have the same or similar activity. The percent of sequence identity may be determined using a known sequence comparison program, and examples include BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign TM (DNASTAR Inc), and the like.

본 발명의 다른 하나의 양태는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 포함한다.Another aspect of the present invention includes a polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide.

본 발명에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드 단편을 의미한다.In the present invention, the term "polynucleotide" is a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA or RNA strand having a certain length or more, and more specifically, the variant polypeptide It means an encoding polynucleotide fragment.

본 발명에서 RNA 중합효소 시그마인자 A(SigA)의 아미노산 서열을 코딩하는 유전자는 rpoD 유전자이며, 구체적으로 코리네박테리움 글루타미쿰 유래일 수 있다. 유전 암호의 축퇴성(genetic code degeneracy)에 기인하여 동일 아미노산 서열을 코딩하는 염기서열 및 이의 변이체 또한 본 발명에 포함되며, 구체적으로 서열번호 1로 표시될 수 있으나, 이에 제한되지 않는다. In the present invention, the gene encoding the amino acid sequence of the RNA polymerase sigma factor A (SigA) is the rpoD gene, and specifically may be derived from Corynebacterium glutamicum. Base sequences encoding the same amino acid sequence and variants thereof due to genetic code degeneracy are also included in the present invention, and may be specifically represented by SEQ ID NO: 1, but are not limited thereto.

또한 변이형 폴리뉴클레오티드 역시 유전 암호의 축퇴성(genetic code degeneracy)에 기인하여 동일 아미노산 서열을 코딩하는 염기서열 및 이의 변이체 또한 본 발명에 포함된다. 구체적으로 상기 아미노산 서열 12 내지 22의 아미노산 서열 중 어느 하나의 아미노산 서열을 코딩하는 염기서열 및 이의 변이체가 포함될 수 있으나 이에 제한되지 않는다.In addition, variant polynucleotides also include a base sequence encoding the same amino acid sequence and variants thereof due to genetic code degeneracy. Specifically, a base sequence encoding any one of the amino acid sequences of the amino acid sequences 12 to 22 and a variant thereof may be included, but are not limited thereto.

본 발명의 또 하나의 양태로서, 본 발명은 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 숙주세포 및 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환된 미생물을 제공한다. 구체적으로 상기 도입은 형질전환에 의해 이루어질 수 있으나, 이에 제한되지 않는다. As another aspect of the present invention, the present invention provides a host cell comprising a polynucleotide encoding the variant polypeptide and a microorganism transformed with a vector comprising a polynucleotide encoding the variant polypeptide. Specifically, the introduction may be performed by transformation, but is not limited thereto.

구체적으로 SigA 변이형 폴리펩티드를 포함하는 미생물은 야생형 SigA 폴리펩티드를 포함하는 미생물에 비하여 숙주세포의 성장을 저해함이 없이 L-라이신의 생산능이 향상되므로, 이들 미생물로부터 L-라이신을 고수율로 수득할 수 있다.Specifically, the microorganism containing the SigA variant polypeptide improves the production capacity of L-lysine without inhibiting the growth of host cells compared to the microorganism containing the wild-type SigA polypeptide, so that L-lysine can be obtained in high yield from these microorganisms. I can.

본 발명에서 용어, "벡터"는 숙주 세포로 염기의 클로닝 및/또는 전이를 위한 임의의 매개물을 말한다. 벡터는 다른 DNA 단편이 결합하여 결합된 단편의 복제를 가져올 수 있는 복제단위(replicon)일 수 있다. "복제단위"란 생체 내에서 DNA 복제의 자가 유닛으로서 기능하는, 즉, 스스로의 조절에 의해 복제가능한, 임의의 유전적 단위(예를 들면, 플라스미드, 파지, 코스미드, 염색체, 바이러스)를 말한다. 상기 "벡터"는 시험관 내, 생체 외 또는 생체 내에서 숙주 세포로 염기를 도입하기 위한 바이러스 및 비 바이러스 매개물을 포함하며, 또한 미니구형 DNA를 포함할 수 있다. 예를 들면, 상기 벡터는 박테리아 DNA 서열을 갖지 않는 플라스미드일 수 있다. 또한, 상기 벡터는 트랜스포존(Annu Rev Genet. 2003; 37:3-29.), 또는 인공 염색체를 포함할 수 있다. 구체적으로는 pACYC177, pACYC184, pCL1920, pECCG117, pUC19, pBR322, pDZ 및 pMW118 벡터 등을 사용할 수 있으며 이에 제한되지 않는다.In the present invention, the term "vector" refers to any medium for cloning and/or transfer of a base into a host cell. The vector may be a replicon capable of binding other DNA fragments to bring about replication of the bound fragment. "Replication unit" refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, replicable by its own regulation. . The "vector" includes viral and non-viral mediators for introducing a base into a host cell in vitro, ex vivo or in vivo, and may also include minispherical DNA. For example, the vector may be a plasmid that does not have a bacterial DNA sequence. In addition, the vector may include a transposon (Annu Rev Genet. 2003; 37:3-29.) or an artificial chromosome. Specifically, pACYC177, pACYC184, pCL1920, pECCG117, pUC19, pBR322, pDZ and pMW118 vectors may be used, but are not limited thereto.

본 발명에서 용어, "형질전환"은 유전자를 숙주세포 내에 도입하여 숙주세포 내에서 발현시킬 수 있도록 하는 것이며, 형질전환된 유전자는 숙주세포 내에서 발현될 수 있으면 숙주세포의 염색체 내 삽입 또는 염색체 외에 위치하고 있는 것이든 제한하지 않고 포함된다.In the present invention, the term "transformation" refers to introducing a gene into a host cell so that it can be expressed in a host cell, and if the transformed gene can be expressed in a host cell, it is inserted into the chromosome of the host cell or other than the chromosome. Includes, without limitation, whatever is located.

상기 유전자는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 폴리뉴클레오티드 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 유전자에 작동 가능하게 연결되어 있는 프로모터, 전사종결신호, 리보좀 결합부위 및 번역종결신호를 포함한다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 유전자는 그 자체 또는 폴리뉴클레오티드 구조체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으나 이에 제한되지 않는다.The gene may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct containing all elements necessary for self-expression. The expression cassette usually includes a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the gene itself or in the form of a polynucleotide structure may be introduced into a host cell and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

상기 숙주세포 또는 미생물은 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하거나, 또는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어 변이형 폴리펩티드를 발현할 수 있는 세포 또는 미생물로서, 본 발명의 목적상 상기 숙주세포 또는 미생물은 SigA 변이형 폴리펩티드를 포함하여 L-라이신을 생산할 수 있는 미생물이라면 모두 가능하다. 구체적 예로, 에스케리키아(Escherichia) 속, 세라티아(Serratia) 속, 어위니아(Erwinia) 속, 엔테로박테리아(Enterobacteria) 속, 살모넬라 (Salmonella) 속, 스트렙토마이세스(Streptomyces) 속, 슈도모나스(Pseudomonas) 속, 브레비박테리움(Brevibacterium) 속 또는 코리네박테리움(Corynebacterium) 속 등의 미생물 균주가 포함될 수 있으며, 구체적으로 코리네박테리움 속 미생물일 수 있고, 보다 구체적인 예로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으나 이에 한정되지 않는다. The host cell or microorganism is a cell or microorganism capable of expressing a mutant polypeptide by transforming with a vector containing a polynucleotide encoding a mutant polypeptide or a polynucleotide encoding a mutant polypeptide. For the purpose of, the host cell or microorganism may be any microorganism capable of producing L-lysine including a SigA variant polypeptide. Specifically, for example, Escherichia (Escherichia) genus, Serratia marcescens (Serratia), An air Winiah (Erwinia) genus, Enterobacter bacteria (Enterobacteria) genus, Salmonella (Salmonella) genus Streptomyces (Streptomyces) genus Pseudomonas (Pseudomonas) Microbial strains such as genus, Brevibacterium genus, or Corynebacterium genus may be included, and specifically, may be microorganisms of the genus Corynebacterium, and a more specific example is Corynebacterium glutami Corynebacterium glutamicum ), but is not limited thereto.

본 발명의 일 구체예에서는, L-라이신의 생산능을 가진 코리네박테리움 글루타미쿰의 여러 균주(KCCM11016P, KFCC10750, KCCM10770P 및 CJ3P)에 서열번호 12 내지 22의 아미노산 서열 중 어느 하나의 아미노산 서열을 갖는 변이형 폴리펩티드를 도입하여 상기 균주의 L-라이신 생산능을 비교한 결과, 상기 변이형 폴리펩티드를 도입한 모든 균주에서 야생형 SigA 폴리펩티드를 포함한 균주보다 더 많은 L-라이신을 생산함을 확인하였다(실시예 7 내지 10 및 표 8 내지 11). 이와 같은 결과는 본 발명의 변이형 폴리펩티드를 포함하는 미생물은 L-라이신의 생산능이 향상된 균주로서, 상기 미생물을 배양함으로써 높은 수율의 L-라이신을 수득할 수 있는 경제적 이점을 시사하는 것이다.In one embodiment of the present invention, the amino acid sequence of any one of the amino acid sequences of SEQ ID NOs: 12 to 22 in several strains of Corynebacterium glutamicum having the ability to produce L-lysine (KCCM11016P, KFCC10750, KCCM10770P and CJ3P) As a result of comparing the L-lysine production ability of the strain by introducing the variant polypeptide having the variant polypeptide, it was confirmed that all strains into which the variant polypeptide was introduced produced more L-lysine than the strain containing the wild-type SigA polypeptide ( Examples 7 to 10 and Tables 8 to 11). These results suggest that the microorganism containing the mutant polypeptide of the present invention is a strain having improved L-lysine production ability, and the economic advantage of obtaining high yield L-lysine by culturing the microorganism.

이에, 본 발명자들은 상기 L-라이신 생산능이 향상된 균주인 KCCM11016P::SigA(L447H)를 코리네박테리움 글루타미쿰 "CA01-2277"이라 명명하였고, 2013년 11월 22일자로 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 기탁하여 수탁번호 KCCM11479P를 부여받았다.Accordingly, the present inventors named the strain KCCM11016P::SigA(L447H), the strain with improved L-lysine production ability, as Corynebacterium glutamicum "CA01-2277", and as of November 22, 2013, an international deposit under the Budapest Treaty. It was deposited with the Korean Microorganism Conservation Center (KCCM), an institution, and was given the accession number KCCM11479P.

본 발명의 또 하나의 양태로서, 본 발명은 기술된 미생물을 배양하는 단계 및 배양된 미생물 또는 배양 배지로부터 L-라이신을 회수하는 단계를 포함하는, L-라이신을 생산하는 방법을 제공한다.As another aspect of the present invention, the present invention provides a method for producing L-lysine, comprising culturing the described microorganism and recovering L-lysine from the cultured microorganism or culture medium.

본 발명에서 용어, "배양"은 상기 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 발명의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 구체적인 배양 온도, 배양 시간 및 배지의 pH 등의 조건은 당업자의 일반적인 지식 또는 종래에 공지된 방법에 따라서 수행될 수 있으며, 이에 따라 적절하게 조절될 수 있다. 구체적으로는 이들 공지된 배양 방법은 문헌[Chmiel; Bioprozesstechnik 1. Einfuhrung indie Bioverfahrenstechnik(Gustav Fischer Verlag, Stuttgart, 1991), 및 Storhas; Bioreaktoren und periphere Einrichtungen(Vieweg Verlag, Braunschweig / Wiesbaden, 1994)]에 상세히 기술되어 있다. 또한, 배양 방법에는 회분식 배양(batch culture), 연속식 배양(cintinuous culture) 및 유가식 배양(fed-batch culture)이 포함되며, 구체적으로는 배치 공정 또는 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the term "culture" means growing the microorganism in an appropriately artificially controlled environmental condition. The cultivation process of the present invention may be performed according to a suitable medium and culture conditions known in the art. Conditions such as specific culture temperature, culture time, and pH of the medium may be performed according to general knowledge of a person skilled in the art or a conventionally known method, and may be appropriately adjusted accordingly. Specifically, these known culture methods are described in Chmiel; Bioprozesstechnik 1. Einfuhrung indie Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991), and Storhas; Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig / Wiesbaden, 1994). In addition, the cultivation method includes batch culture, cintinuous culture, and fed-batch culture, and specifically, a batch process or an injection batch or a fed-batch or repeated injection batch process (fed batch or Repeated fed batch process) can be cultured continuously, but is not limited thereto.

배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 상기 배지에서 사용될 수 있는 탄소원으로는 글루코즈, 사카로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산 등이 포함될 수 있다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으며, 이에 한정되지 않는다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄 등이 포함될 수 있고, 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으며, 이에 한정되지 않는다. 사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염 등이 포함될 수 있다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나 이에 한정되지 않는다.The medium used for cultivation must meet the requirements of a specific strain in an appropriate manner, and the carbon sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, Oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, fatty acids such as palmitic acid, stearic acid, linoleic acid, alcohols such as glycerol, ethanol, organic acids such as acetic acid, and the like may be included. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, and the like. , The nitrogen source may also be used individually or as a mixture, but is not limited thereto. Personnel that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins can be used. In addition, precursors suitable for the culture medium may be used. The above-described raw materials may be added to the culture in a batch or continuous manner by an appropriate method in the culture process, but are not limited thereto.

또한, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 배양 중에는 지방산 폴리클리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다. 배양물의 온도는 보통 27℃ 내지 37℃, 구체적으로는 30℃ 내지 35℃이다. 배양기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속 될 수 있으며, 구체적으로는 10 내지 100시간일 수 있다. L-라이신은 배양 배지 중으로 배출되거나, 미생물 중에 포함되어 있을 수 있다.In addition, the pH of the culture can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the culture in an appropriate manner during the culture. During cultivation, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas may be injected without the injection of gas to maintain the anaerobic and microaerobic state. The temperature of the culture is usually 27°C to 37°C, specifically 30°C to 35°C. The cultivation period may be continued until the production amount of the desired useful substance is obtained, and specifically, may be 10 to 100 hours. L-lysine may be discharged into the culture medium or contained in microorganisms.

또한, 본 발명의 L-라이신을 생산하는 방법에는 배양된 미생물 또는 배양 배지로부터 L-라이신을 회수하는 방법은 당업계에 널리 알려져 있다. 상기 L-라이신 회수 방법에는, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이들 예에 한정되는 것은 아니다.In addition, in the method of producing L-lysine of the present invention, a method of recovering L-lysine from cultured microorganisms or culture medium is widely known in the art. The L-lysine recovery method may include filtration, anion exchange chromatography, crystallization and HPLC, but is not limited to these examples.

본 발명으로 L-라이신 생산 능력을 상향 조절할 수 있는 변이체 RNA 중합효소 시그마인자 A의 변이형 폴리펩티드를 확인할 수 있다. 또한 이를 바탕으로 당해 변이형 폴리펩티드를 발현하는 미생물은 L-라이신의 생산수율이 현저히 우수하므로, 산업적인 면에서 생산의 편의성과 함께 제조원가 절감 등의 효과를 기대할 수 있다.In the present invention, a variant polypeptide of a variant RNA polymerase sigma factor A capable of up-regulating L-lysine production capacity can be identified. In addition, based on this, the microorganism expressing the mutant polypeptide has a remarkably excellent production yield of L-lysine, so it is possible to expect effects such as reduction in manufacturing cost as well as convenience of production from an industrial point of view.

이하, 본 발명을 하기 예에서 보다 구체적으로 설명한다. 그러나 이들 예는 본 발명의 이해를 돕기 위한 것일 뿐, 이들에 의해 본 발명이 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail in the following examples. However, these examples are only intended to aid understanding of the present invention, and the present invention is not limited thereto.

실시예 1: 인공 돌연변이법을 이용한 SigA 변이형 폴리펩티드 확보Example 1: Secure SigA variant polypeptide using artificial mutagenesis

본 실시예에서는 변이형 SigA를 획득하기 위하여 하기의 방법으로 염색체 내 1차 교차삽입용 벡터 라이브러리를 제작하였다. 코리네박테리움 SigA(서열번호 2)를 암호화하는 rpoD 유전자(서열번호 1)를 대상으로 Error-prone PCR 법을 수행하여 염기 치환변이가 무작위적으로 도입된 rpoD 유전자 변이체 단편(1497bp)들을 획득하였다. 상기 Error-prone PCR은 GenemorphII Random Mutagenesis Kit (Stratagene)을 사용하여 수행하였으며, 코리네박테리움 글루타미쿰 ATCC13032 게놈 DNA를 주형으로 프라이머 1(서열번호 3) 및 프라이머 2(서열번호 4)를 사용하였다. 증폭된 유전자 단편 내에 변이가 1kb 당 0 내지 4.5 개가 도입되도록 하였으며, PCR 조건은 변성 96℃, 30초; 어닐링 53℃, 30초; 및 중합반응 72℃, 2분을 30회 반복하였다. In this example, in order to obtain a mutant SigA, a vector library for primary cross-insertion in a chromosome was prepared by the following method. Corynebacterium SigA (SEQ ID NO: 2) encoded by the targeting rpoD gene (SEQ ID NO: 1) performing a Error-prone PCR method base substitution mutation is randomly introduced into a rpoD Genetic variant fragments (1497 bp) were obtained. The Error-prone PCR was performed using GenemorphII Random Mutagenesis Kit (Stratagene), and primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4) were used using Corynebacterium glutamicum ATCC13032 genomic DNA as a template. . 0 to 4.5 mutations per 1 kb were introduced into the amplified gene fragment, and PCR conditions were denaturation 96° C., 30 seconds; Annealing 53° C., 30 seconds; And polymerization reaction at 72° C. for 2 minutes was repeated 30 times.

프라이머 번호Primer number 염기 서열Base sequence 서열번호Sequence number 1One GTGGAGAGCAGCATGGTAGGTGGAGAGCAGCATGGTAG 33 22 CGCAGAGGAAAACAGTGGCCGCAGAGGAAAACAGTGGC 44

상기 증폭된 유전자 단편을 pCR2.1-TOPO TA Cloning Kit(Invitrogen)을 이용하여 pCR2.1-TOPO 벡터(이하 'pCR2.1')에 연결하였고, 대장균 DH5α에 형질전환하여 카나마이신(25 mg/ℓ)이 포함된 LB 고체배지에 도말하였다. 형질전환된 콜로니 20종을 선별한 후 플라스미드를 획득하여 염기서열을 분석한 결과, 1.5 mutations/kb 빈도로 서로 다른 위치에 변이가 도입된 것을 확인하였다. 약 20,000 개의 형질전환된 대장균 콜로니를 취하여 플라스미드를 추출하였고, 이를 pCR2.1-rpoD(mt) 라이브러리로 명명하였다. The amplified gene fragment was ligated to a pCR2.1-TOPO vector (hereinafter'pCR2.1') using pCR2.1-TOPO TA Cloning Kit (Invitrogen), transformed into E. coli DH5α, and kanamycin (25 mg/l). ) Was spread on LB solid medium containing. After selecting 20 transformed colonies, plasmids were obtained and sequenced. As a result, it was confirmed that mutations were introduced at different locations with a frequency of 1.5 mutations/kb. About 20,000 transformed E. coli colonies were taken to extract a plasmid, which was named pCR2.1-rpoD(mt) library.

이후 대조군으로 사용하기 위한 야생형의 rpoD 유전자를 갖는 플라스미드를 제작하였다. 프라이머 1(서열번호 3) 및 프라이머 2(서열번호 4)를 이용하여 코리네박테리움 글루타미쿰 ATCC13032 게놈 DNA를 주형으로 상기와 같은 조건으로 PCR하였다. 중합효소는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였고, 이에 따라 제작된 플라스미드를 pCR2.1-rpoD(WT)으로 명명하였다. After that, a plasmid having a wild-type rpoD gene was prepared for use as a control. Using Primer 1 (SEQ ID NO: 3) and Primer 2 (SEQ ID NO: 4), Corynebacterium glutamicum ATCC13032 genomic DNA was subjected to PCR under the same conditions as described above as a template. As the polymerase, PfuUltra high-reliability DNA polymerase (Stratagene) was used, and the plasmid thus produced was named pCR2.1-rpoD (WT).

실시예 2: L-라이신 생산능이 증가된 SigA 변이주 라이브러리 제작Example 2: Construction of SigA mutant library with increased L-lysine production capacity

KCCM11016P(대한민국 등록특허 제10-0159812호) 균주를 모균주로 하여 상기 제작된 pCR2.1-rpoD(mt) 라이브러리를 상동염색체 재조합에 의해 형질전환하고 카나마이신(25 mg/ℓ) 및 하기와 같은 성분이 포함된 복합평판배지에 도말하여 약 25,000개의 콜로니를 확보하였으며, 이를 KCCM11016P/pCR2.1-rpoD(mt)-1 내지 KCCM11016P/pCR2.1-rpoD(mt)-25000으로 명명하였다. 또한, 상기 제작된 pCR2.1- rpoD(WT) 벡터를 KCCM11016P 균주에 형질전환하여 대조군 균주를 제작하였으며, KCCM11016P/pCR2.1-rpoD(WT)으로 명명하였다. The pCR2.1-rpoD(mt) library prepared above using the KCCM11016P (Korea Patent Registration No. 10-0159812) strain as the parent strain was transformed by homologous chromosome recombination, and kanamycin (25 mg/l) and the following components About 25,000 colonies were secured by spreading on the composite plate medium containing this, which was named as KCCM11016P/pCR2.1-rpoD(mt)-1 to KCCM11016P/pCR2.1-rpoD(mt)-25000. In addition, the prepared pCR2.1-rpoD(WT) vector was transformed into the KCCM11016P strain to prepare a control strain, and was named KCCM11016P/pCR2.1-rpoD(WT).

상기 확보된 형질전환체들은 염색체 상에 2 카피의 rpoD 유전자를 보유하게 되나, pCR2.1-rpoD(mt) 라이브러리 및 pCR2.1-rpoD(WT) 벡터는 프로모터가 없는 rpoD 유전자 단편이 삽입되어 있기 때문에 균주의 염색체 내로 상동재조합에 의해 삽입될 경우 2 카피의 rpoD 유전자들 중 1 카피만이 발현되어 변이형 또는 야생형의 SigA 단백질을 발현시킬 수 있다. The obtained transformants are 2 copies of rpoD on the chromosome. The gene is retained, but the pCR2.1-rpoD (mt) library and the pCR2.1-rpoD (WT) vector have 2 copies when inserted into the chromosome of the strain by homologous recombination because the rpoD gene fragment without a promoter is inserted. of Only one copy of the rpoD genes can be expressed to express a mutant or wild-type SigA protein.

<복합평판배지 (pH 7.0)><Composite flat plate (pH 7.0)>

포도당 10 g, 펩톤 10 g, Beef extract 5 g, 효모추출물 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, 요소 2 g, Sorbitiol 91 g, 한천 20 g (증류수 1 리터 기준)Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitiol 91 g, Agar 20 g (based on 1 liter of distilled water)

실시예 3: L-라이신 생산능이 증가된 SigA 변이주 라이브러리 스크리닝Example 3: SigA mutant library screening with increased L-lysine production capacity

상기 실시예 2에서 확보된 약 25,000개의 콜로니를 각각 하기와 같은 성분이 포함된 300 ㎕의 선별배지에 접종하여 96-deep well plate 에서 32℃, 1000 rpm 으로 약 24시간 동안 배양하였다. 배양 중 생산된 L-라이신의 생산량을 분석하기 위하여 닌하이드린 방법을 이용하였다(J. Biol. Chem. 1948. 176:367?388). 배양이 완료된 후 배양 상층액 10 ㎕ 와 닌하드린 반응용액 190 ㎕(63% 글리세롤, 27% 닌하이드린용액(7.1 g/L in 0.5M citrate buffer pH 5.5))를 65℃에서 30분간 반응시킨 후, 570 nm의 파장에서 spectrophotometer로 흡광도를 측정하고 대조군인 KCCM11016P/pCR2.1-rpoD(WT) 균주의 흡광도와 비교해 10% 이상 증가된 흡광도를 보이는 약 935개의 변이균주 콜로니를 선별하였다. 그 외 콜로니들은 대조구 대비 유사하거나 감소한 흡광도를 나타내었다.About 25,000 colonies obtained in Example 2 were inoculated into 300 μl of selection medium each containing the following components, and cultured for about 24 hours at 32° C. and 1000 rpm in a 96-deep well plate. In order to analyze the production amount of L-lysine produced during culture, the ninhydrin method was used (J. Biol. Chem. 1948. 176:367?388). After the incubation was completed, 10 µl of the culture supernatant and 190 µl of the ninhardrin reaction solution (63% glycerol, 27% ninhydrin solution (7.1 g/L in 0.5M citrate buffer pH 5.5)) were reacted at 65°C for 30 minutes. Then, the absorbance was measured with a spectrophotometer at a wavelength of 570 nm, and about 935 mutant strain colonies showing an absorbance increased by more than 10% compared to the absorbance of the control strain KCCM11016P/pCR2.1-rpoD (WT) were selected. Other colonies showed similar or decreased absorbance compared to the control.

<선별배지 (pH 8.0)><Selection medium (pH 8.0)>

포도당 10 g, 5.5 g ammonium sulfate, MgSO4·7H2O 1.2 g, KH2PO4 0.8 g, K2HPO4 16.4 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)Glucose 10 g, 5.5 g ammonium sulfate, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 0.8 g, K 2 HPO 4 16.4 g, Biotin 100 μg, Thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, Nicotinamide 2000 ㎍ (based on 1 liter of distilled water)

상기에서 선별된 935종의 균주를 대상으로 상기의 방법을 반복수행하여 KCCM11016P/PCR2.1-rpoD(WT) 균주 대비 L-라이신 생산능이 15% 이상 향상된 변이균주 중 상위 231종을 선별하였다. The above method was repeated for the 935 strains selected above to select the top 231 strains among the mutant strains having improved L-lysine production capacity by 15% or more compared to the KCCM11016P/PCR2.1-rpoD (WT) strain.

실시예 4: KCCM11016P/pCR2.1-rpoD(mt) L-라이신 생산능 분석Example 4: KCCM11016P/pCR2.1-rpoD(mt) L-lysine production ability analysis

상기 실시예 3에서 선별한 231종의 균주들의 L-라이신 생산능을 다음과 같은 방법으로 배양하여 분석하였다.The L-lysine-producing ability of the 231 strains selected in Example 3 was cultured and analyzed in the following manner.

하기 성분이 포함된 종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 이후, 하기 성분이 포함된 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다. HPLC(고성능 액체크로마토그래피)를 이용하여 L-라이신의 농도를 분석하였다.Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium containing the following components, and cultured with shaking at 30° C. for 20 hours and 200 rpm. Thereafter, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium containing the following components, followed by shaking culture at 30° C. for 72 hours and 200 rpm. The concentration of L-lysine was analyzed using HPLC (high performance liquid chromatography).

<종배지 (pH 7.0)> <Seed medium (pH 7.0)>

포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg ( 1 liter of distilled water)

<생산배지 (pH 7.0)> <Production medium (pH 7.0)>

포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4 ·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).Glucose 100 g, (NH 4) 2 SO 4 40 g, soy protein 2.5 g, corn steep solids (Corn Steep Solids) 5 g, urea 3 g, KH 2 PO 4 1 g, MgSO 4 · 7H 2 O 0.5 g, Biotin 100 μg, thiamine hydrochloride 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3000 μg, CaCO 3 30 g (based on 1 liter of distilled water).

상기에서 선별된 231종의 변이균주 중 대조군 대비 L-라이신 농도가 재현성 있게 증가한 17종의 균주를 선별하여 상기 배양 및 분석을 반복수행 하였으며, 분석된 L-라이신의 농도는 하기 표 2와 같다.Among the 231 mutant strains selected above, 17 strains in which the concentration of L-lysine was reproducibly increased compared to the control were selected, and the culture and analysis were repeated, and the analyzed concentration of L-lysine is shown in Table 2 below.

균주Strain L-라이신(g/)L-lysine (g/) 배치 1Batch 1 배치 2Batch 2 배치 3Batch 3 평균Average 대조군Control KCCM11016P/pCR2.1-rpoD(WT)KCCM11016P/pCR2.1-rpoD(WT) 41.541.5 42.142.1 41.841.8 41.841.8 1One KCCM11016P/pCR2.1-rpoD(mt)-158KCCM11016P/pCR2.1-rpoD(mt)-158 45.745.7 45.245.2 48.148.1 46.346.3 22 KCCM11016P/pCR2.1-rpoD(mt)-1494KCCM11016P/pCR2.1-rpoD(mt)-1494 44.844.8 46.246.2 45.745.7 45.645.6 33 KCCM11016P/pCR2.1-rpoD(mt)-1846KCCM11016P/pCR2.1-rpoD(mt)-1846 46.846.8 45.945.9 47.147.1 46.646.6 44 KCCM11016P/pCR2.1-rpoD(mt)-2198KCCM11016P/pCR2.1-rpoD(mt)-2198 49.849.8 47.847.8 47.947.9 48.548.5 55 KCCM11016P/pCR2.1-rpoD(mt)-2513KCCM11016P/pCR2.1-rpoD(mt)-2513 45.245.2 47.347.3 45.645.6 46.046.0 66 KCCM11016P/pCR2.1-rpoD(mt)-3777KCCM11016P/pCR2.1-rpoD(mt)-3777 45.845.8 47.647.6 45.945.9 46.446.4 77 KCCM11016P/pCR2.1-rpoD(mt)-4065KCCM11016P/pCR2.1-rpoD(mt)-4065 50.750.7 49.849.8 49.549.5 50.050.0 88 KCCM11016P/pCR2.1-rpoD(mt)-5329KCCM11016P/pCR2.1-rpoD(mt)-5329 44.544.5 42.542.5 42.842.8 43.343.3 99 KCCM11016P/pCR2.1-rpoD(mt)-6589KCCM11016P/pCR2.1-rpoD(mt)-6589 41.841.8 42.342.3 41.841.8 42.042.0 1010 KCCM11016P/pCR2.1-rpoD(mt)-9823KCCM11016P/pCR2.1-rpoD(mt)-9823 47.347.3 46.846.8 47.047.0 47.047.0 1111 KCCM11016P/pCR2.1-rpoD(mt)-11267KCCM11016P/pCR2.1-rpoD(mt)-11267 45.545.5 45.345.3 45.145.1 45.345.3 1212 KCCM11016P/pCR2.1-rpoD(mt)-13306KCCM11016P/pCR2.1-rpoD(mt)-13306 48.548.5 46.546.5 46.646.6 47.247.2 1313 KCCM11016P/pCR2.1-rpoD(mt)-14535KCCM11016P/pCR2.1-rpoD(mt)-14535 48.248.2 49.349.3 47.547.5 48.348.3 1414 KCCM11016P/pCR2.1-rpoD(mt)-16323KCCM11016P/pCR2.1-rpoD(mt)-16323 44.244.2 44.644.6 45.845.8 44.944.9 1515 KCCM11016P/pCR2.1-rpoD(mt)-17935KCCM11016P/pCR2.1-rpoD(mt)-17935 46.546.5 47.247.2 44.544.5 46.146.1 1616 KCCM11016P/pCR2.1-rpoD(mt)-18904KCCM11016P/pCR2.1-rpoD(mt)-18904 42.342.3 41.541.5 42.642.6 42.142.1 1717 KCCM11016P/pCR2.1-rpoD(mt)-19803KCCM11016P/pCR2.1-rpoD(mt)-19803 47.247.2 45.345.3 46.346.3 46.346.3

상기 선별된 17종 균주의 L-라이신 농도 분석 결과, 17종의 선별주 중 2종(KCCM11016P/pCR2.1-rpoD(mt)-6589, KCCM11016P/pCR2.1-rpoD(mt)-18904)을 제외한 15종 선별주의 L-라이신 생산능이 대조군 KCCM11016P/pCR2.1-rpoD(WT) 균주 대비 최대 20% 증가함을 확인하였다. As a result of analyzing the L-lysine concentration of the selected 17 strains, two of the 17 strains (KCCM11016P/pCR2.1-rpoD(mt)-6589, KCCM11016P/pCR2.1-rpoD(mt)-18904) were It was confirmed that the L-lysine production capacity of the 15 strains except the control strain increased by up to 20% compared to the control strain KCCM11016P/pCR2.1-rpoD (WT).

실시예 5: SigA 인공돌연변이 라이브러리 선별주의 Example 5: SigA artificial mutant library selection attention rpoD rpoD 유전자 변이 확인Genetic Variation Identification

상기 실시예 4에서 선별된 17종 중 대조군에 비해 L-라이신 생산능이 증가된 15종 균주들의 SigA에 도입된 변이를 확인하기 위하여, rpoD 변이체의 염기서열을 분석하였다. 염기서열을 결정하기 위해 프라이머 1(서열번호 3) 및 프라이머 3(서열번호 5)를 사용하여 PCR을 수행하였다. Compared to the control of the 17 kinds selected from the above Example 4 to determine the mutagenic SigA of the 15 strains with increased capability producing L- lysine, rpoD The base sequence of the variant was analyzed. PCR was performed using primer 1 (SEQ ID NO: 3) and primer 3 (SEQ ID NO: 5) to determine the nucleotide sequence.

프라이머 번호Primer number 염기 서열Base sequence 서열번호Sequence number 1One GTGGAGAGCAGCATGGTAGGTGGAGAGCAGCATGGTAG 33 33 AACAGCTATGACCATGAACAGCTATGACCATG 55

확보된 15종 균주 각각의 변이형 rpoD 유전자 단편들의 염기서열 분석을 통하여 미국 국립 보건원 유전자 은행(NIH GenBank)을 근거로 변이형 rpoD 유전자의 염기서열을 확인하였으며, 변이형 SigA의 아미노산 서열을 확인하였다. 선별된 15종 균주의 변이형 SigA 아미노산 서열 분석 결과는 하기 표 4와 같다. Through the nucleotide sequence analysis of the mutant rpoD gene fragments of each of the 15 strains obtained, the nucleotide sequence of the mutant rpoD gene was confirmed based on the National Institutes of Health Gene Bank (NIH GenBank), and the amino acid sequence of the mutant SigA was confirmed. . The results of analyzing the variant SigA amino acid sequence of the selected 15 strains are shown in Table 4 below.

균주Strain SigA 아미노산 변이SigA amino acid mutation KCCM11016P/pCR2.1-rpoD(mt)-158KCCM11016P/pCR2.1-rpoD(mt)-158 D136G, T281SD136G, T281S KCCM11016P/pCR2.1-rpoD(mt)-1494KCCM11016P/pCR2.1-rpoD(mt)-1494 L381RL381R KCCM11016P/pCR2.1-rpoD(mt)-1846KCCM11016P/pCR2.1-rpoD(mt)-1846 M230TM230T KCCM11016P/pCR2.1-rpoD(mt)-2198KCCM11016P/pCR2.1-rpoD(mt)-2198 M455VM455V KCCM11016P/pCR2.1-rpoD(mt)-2513KCCM11016P/pCR2.1-rpoD(mt)-2513 S488TS488T KCCM11016P/pCR2.1-rpoD(mt)-3777KCCM11016P/pCR2.1-rpoD(mt)-3777 R279LR279L KCCM11016P/pCR2.1-rpoD(mt)-4065KCCM11016P/pCR2.1-rpoD(mt)-4065 L447HL447H KCCM11016P/pCR2.1-rpoD(mt)-5329KCCM11016P/pCR2.1-rpoD(mt)-5329 A268SA268S KCCM11016P/pCR2.1-rpoD(mt)-9823KCCM11016P/pCR2.1-rpoD(mt)-9823 L451I, Q491RL451I, Q491R KCCM11016P/pCR2.1-rpoD(mt)-11267KCCM11016P/pCR2.1-rpoD(mt)-11267 Q429RQ429R KCCM11016P/pCR2.1-rpoD(mt)-13306KCCM11016P/pCR2.1-rpoD(mt)-13306 K90E, K105Y, D250G, I254LK90E, K105Y, D250G, I254L KCCM11016P/pCR2.1-rpoD(mt)-14535KCCM11016P/pCR2.1-rpoD(mt)-14535 I254NI254N KCCM11016P/pCR2.1-rpoD(mt)-16323KCCM11016P/pCR2.1-rpoD(mt)-16323 K483RK483R KCCM11016P/pCR2.1-rpoD(mt)-17935KCCM11016P/pCR2.1-rpoD(mt)-17935 K479RK479R KCCM11016P/pCR2.1-rpoD(mt)-19803KCCM11016P/pCR2.1-rpoD(mt)-19803 D238V, N263S, E358DD238V, N263S, E358D

그 결과, 적게는 1개의 아미노산부터 많게는 4개의 아미노산이 치환되었음을 확인하였다. 상기 표 4의 표기에서 숫자는 SigA의 아미노산 번호를 의미하고, 숫자 앞의 알파벳은 치환 전의 아미노산을, 숫자 뒤의 알파벳은 치환된 아미노산을 의미한다.As a result, it was confirmed that as few as 1 amino acid and as many as 4 amino acids were substituted. In the notation of Table 4, the number refers to the amino acid number of SigA, the alphabet before the number refers to the amino acid before substitution, and the alphabet after the number refers to the substituted amino acid.

실시예Example 6: 고농도 L- 6: high concentration L- 라이신Lysine 생산주를Producer 위한 for rpoDrpoD 변이 염색체 도입용 벡터 제작 Vector production for introducing mutant chromosomes

상기 실시예 4에서 확인된 SigA 변이 적용 효과를 확인하기 위하여 이를 염색체상에 도입할 수 있는 벡터를 제작하였다. In order to confirm the effect of applying the SigA mutation identified in Example 4, a vector capable of introducing it onto the chromosome was constructed.

보고된 염기서열에 근거하여 5' 말단에 EcoRⅠ 제한효소 부위를 삽입한 프라이머 4(서열번호 6)와 3' 말단에 SalⅠ 제한효소 부위를 삽입한 프라이머 5(서열번호 7)를 합성하였다. 이 프라이머 쌍을 이용하여, 상기 선별된 15종의 염색체를 각각 주형으로 PCR을 수행하여 15종의 변이형 rpoD(mt) 유전자 단편을 증폭하였다. PCR 조건은 94 ℃에서 5분간 변성 후, 94 ℃ 30초 변성, 56 ℃ 30초 어닐링, 72 ℃ 2분 중합을 30회 반복한 후, 72 ℃에서 7분간 중합반응을 수행하였다. Based on the reported nucleotide sequence, primer 4 (SEQ ID NO: 6) with an EcoRI restriction enzyme site inserted at the 5'end and Primer 5 (SEQ ID NO: 7) with a SalI restriction enzyme site inserted at the 3'end were synthesized. Using this primer pair, PCR was performed on each of the selected 15 chromosomes as a template to amplify 15 mutant rpoD(mt) gene fragments. PCR conditions were denatured at 94° C. for 5 minutes, then denatured at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 2 minutes were repeated 30 times, followed by polymerization at 72° C. for 7 minutes.

프라이머 번호Primer number 염기 서열Base sequence 서열번호Sequence number 44 AAGAATTCGTGGAGAGCAGCATGGTAGAAGAATTCGTGGAGAGCAGCATGGTAG 66 55 AAGTCGACCGCAGAGGAAAACAGTGGCAAGTCGACCGCAGAGGAAAACAGTGGC 77

PCR로 증폭된 15종의 유전자 단편을 제한효소 EcoRⅠ과 SalⅠ으로 처리하여 각각의 DNA 절편을 획득한 후, 이를 제한효소 EcoRⅠ 및 SalⅠ말단을 가지는 염색체 도입용 pDZ 벡터(대한민국 등록특허 제10-0924065호)에 연결한 후 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자가 삽입된 벡터로 형질전환된 콜로니를 선별한 후 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고 이 플라스미드의 SigA에 삽입된 변이에 따라 각각 pDZ-SigA(D136G, T281S), pDZ-SigA(L381R), pDZ-SigA(M230T), pDZ-SigA(M455V), pDZ-SigA(S488T), pDZ-SigA(R279L), pDZ-SigA(I254N), pDZ-SigA(A268S), pDZ-SigA(L451I, Q491R), pDZ-SigA(Q429R), pDZ-SigA(K90E, K105Y, D250G, I254L), pDZ-SigA(L447H), pDZ-SigA(K483R), pDZ-SigA(K479R), pDZ-SigA(D238V, N263S, E358D)으로 명명하였다. 또한 상기 변이체들에 대한 또다른 대조군으로써, L-라이신 생산성 증가에 효과가 있다고 기 보고된(국제공개특허 제WO2003-054179호) SigA 변이 A414V를 염색체상에 삽입하기 위한 벡터를 제작하기 위해 프라이머 6 내지 9(서열번호 8 내지 11)를 제작하였다. 코리네박테리움 글루타미쿰 ATCC13032 게놈 DNA를 주형으로 하여 프라이머 6 및 프라이머 9 쌍과 프라이머 7 및 프라이머 8 쌍으로 각각 PCR을 수행하였다. PCR 조건은 94 ℃에서 5분간 변성 후, 94 ℃ 30초 변성, 56 ℃ 30초 어닐링, 72 ℃ 1분 중합을 30회 반복한 후, 72 ℃에서 7분간 중합반응을 수행하였다.15 kinds of gene fragments amplified by PCR were treated with restriction enzymes EcoRI and SalI to obtain respective DNA fragments, and then the pDZ vector for chromosome introduction having restriction enzymes EcoRI and SalI ends (Korea Patent Registration No. 10-0924065 ), and then transformed into E. coli DH5α and plated on LB solid medium containing kanamycin (25mg/ℓ). After selecting a colony transformed with a vector into which the target gene was inserted through PCR, a plasmid was obtained using a commonly known plasmid extraction method, and pDZ-SigA (D136G, T281S) respectively according to the mutations inserted into the SigA of this plasmid. , pDZ-SigA(L381R), pDZ-SigA(M230T), pDZ-SigA(M455V), pDZ-SigA(S488T), pDZ-SigA(R279L), pDZ-SigA(I254N), pDZ-SigA(A268S), pDZ-SigA(L451I, Q491R), pDZ-SigA(Q429R), pDZ-SigA(K90E, K105Y, D250G, I254L), pDZ-SigA(L447H), pDZ-SigA(K483R), pDZ-SigA(K479R)) It was named pDZ-SigA (D238V, N263S, E358D). In addition, as another control for the mutants, primer 6 for constructing a vector for inserting the SigA mutant A414V onto the chromosome, previously reported to be effective in increasing L-lysine productivity (International Publication No. WO2003-054179) To 9 (SEQ ID NOs: 8 to 11) were prepared. Using Corynebacterium glutamicum ATCC13032 genomic DNA as a template, PCR was performed with primers 6 and 9 pairs, and primers 7 and 8 pairs, respectively. PCR conditions were denatured at 94° C. for 5 minutes, then denatured at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 1 minute were repeated 30 times, followed by polymerization at 72° C. for 7 minutes.

프라이머 번호Primer number 염기 서열Base sequence 서열번호Sequence number 66 GCAGGTCGACTCTAGACTCACCCCAGCCGTCAAGCGTGCAGGTCGACTCTAGACTCACCCCAGCCGTCAAGCGT 88 77 CCGGGGATCCTCTAGATCAAGGCGATGTCGGAAAATGCCGGGGATCCTCTAGATCAAGGCGATGTCGGAAAATG 99 88 AAGACTCCGAAGTCGTCGTCGCAGTAAGACTCCGAAGTCGTCGTCGCAGT 1010 99 ACTGCGACGACGACTTCGGAGTCTTACTGCGACGACGACTTCGGAGTCTT 1111

그 결과, 약 500bp 유전자 단편 2개를 획득하였으며, 증폭된 산물은 Infusion cloning kit(Invitrogen)을 사용하여 pDZ벡터에 접합하였고 제작된 벡터를 pDZ-SigA(A414V)으로 명명하였다.As a result, two approximately 500bp gene fragments were obtained, and the amplified product was conjugated to a pDZ vector using an Infusion cloning kit (Invitrogen), and the prepared vector was named pDZ-SigA (A414V).

실시예Example 7: 고농도 L- 7: high concentration L- 라이신Lysine 생산주를Producer 위하여 for SigASigA 변이형 폴리펩티드가 도입된 KCCM11016P 균주 제작 및 L-라이신 생산능 비교 Production of KCCM11016P strain into which variant polypeptide was introduced and comparison of L-lysine production ability

상기 실시예 6에서 제조한 신규변이 도입 벡터 15종 및 기 보고변이 도입 벡터 1종을 2단계 상동염색체 재조합에 의해 L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM11016P에 형질전환시켰다. 그 후 염색체 상의 SigA 변이가 도입된 균주를 염기서열 분석에 의하여 선별하였으며, 상기 SigA 변이가 도입된 균주를 KCCM11016P::SigA(D136G, T281S), KCCM11016P::SigA(L381R), KCCM11016P::SigA(M230T), KCCM11016P::SigA(M455V), KCCM11016P::SigA(S488T), KCCM11016P::SigA(R279L), KCCM11016P::SigA(I254N), KCCM11016P::SigA(A268S), KCCM11016P::SigA(L451I, Q491R), KCCM11016P::SigA(Q429R), KCCM11016P::SigA(K90E, K105Y, D250G, I254L), KCCM11016P::SigA(L447H), KCCM11016P::SigA(K483R), KCCM11016P::SigA(K479R), KCCM11016P::SigA(D238V, N263S, E358D), KCCM11016P::SigA(A414V)으로 명명하였다. The 15 new mutant introduced vectors and 1 type of the reported mutant introduced vector prepared in Example 6 were transformed into the L-lysine producing strain, Corynebacterium glutamicum KCCM11016P, by a two-step homologous chromosome recombination. Then, the strain into which the SigA mutation was introduced on the chromosome was selected by sequencing analysis, and the strain into which the SigA mutation was introduced was KCCM11016P::SigA(D136G, T281S), KCCM11016P::SigA(L381R), KCCM11016P::SigA( M230T), KCCM11016P::SigA(M455V), KCCM11016P::SigA(S488T), KCCM11016P::SigA(R279L), KCCM11016P::SigA(I254N), KCCM11016P::SigA(AL110268S), KCCM11016P::SigA(AL11016P::SigA(AL11016P), KCCM11016P: Q491R), KCCM11016P::SigA(Q429R), KCCM11016P::SigA(K90E, K105Y, D250G, I254L), KCCM11016P::SigA(L447H), KCCM11016P::SigA(K483R), KCCM11016P::SigA(K483R), KCCM11016P:: Named as ::SigA(D238V, N263S, E358D), KCCM11016P::SigA(A414V).

상기 실시예 4과 동일한 방법으로 배양하여, 이로부터 L-라이신의 농도를 분석하였고, 그 결과는 하기 표 7과 같다.Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 7 below.

균주Strain L-라이신(g/)L-lysine (g/) 배치 1Batch 1 배치 2Batch 2 배치 3Batch 3 평균Average 대조군Control KCCM11016PKCCM11016P 42.842.8 41.641.6 43.143.1 42.542.5 1One KCCM11016P::SigA(D136G, T281S)KCCM11016P::SigA(D136G, T281S) 46.246.2 45.845.8 45.245.2 45.745.7 22 KCCM11016P::SigA(L381R)KCCM11016P::SigA(L381R) 45.245.2 45.845.8 46.746.7 45.945.9 33 KCCM11016P::SigA(M230T)KCCM11016P::SigA(M230T) 41.841.8 42.142.1 41.941.9 41.941.9 44 KCCM11016P::SigA(M455V)KCCM11016P::SigA(M455V) 50.150.1 48.148.1 49.249.2 49.149.1 55 KCCM11016P::SigA(S488T), KCCM11016P::SigA(S488T), 45.145.1 44.944.9 45.845.8 45.345.3 66 KCCM11016P::SigA(R279L)KCCM11016P::SigA(R279L) 42.542.5 43.243.2 40.940.9 42.242.2 77 KCCM11016P::SigA(L447H)KCCM11016P::SigA(L447H) 51.251.2 49.949.9 50.850.8 50.650.6 88 KCCM11016P::SigA(A268S)KCCM11016P::SigA(A268S) 43.243.2 44.144.1 45.545.5 44.344.3 99 KCCM11016P::SigA(L451I, Q491R)KCCM11016P::SigA(L451I, Q491R) 47.547.5 47.147.1 49.849.8 48.148.1 1010 KCCM11016P::SigA(Q429R)KCCM11016P::SigA(Q429R) 44.944.9 45.245.2 45.145.1 45.145.1 1111 KCCM11016P::SigA(K90E, K105Y, D250G, I254L)KCCM11016P::SigA(K90E, K105Y, D250G, I254L) 31.531.5 28.628.6 40.540.5 33.533.5 1212 KCCM11016P::SigA (I254N)KCCM11016P::SigA (I254N) 49.149.1 48.548.5 47.847.8 48.548.5 1313 KCCM11016P::SigA(K483R)KCCM11016P::SigA(K483R) 45.145.1 44.144.1 45.645.6 44.944.9 1414 KCCM11016P::SigA(K479R)KCCM11016P::SigA(K479R) 44.744.7 45.645.6 45.845.8 45.445.4 1515 KCCM11016P::SigA(D238V,N263S,E358D)KCCM11016P::SigA(D238V,N263S,E358D) 21.521.5 22.922.9 19.219.2 21.221.2 대조군Control KCCM11016P::SigA(A414V)KCCM11016P::SigA(A414V) 43.243.2 4444 43.543.5 43.643.6

그 결과, 2종의 신규 변이 도입주(KCCM11016P::SigA(M230T), KCCM11016P::SigA(R279L))는 모균주 대비 동등한 L-라이신 생산능을 나타내었으며, 다른 2종의 신규 변이 도입주(KCCM11016P::SigA(K90E, K105Y, D250G, I254L), KCCM11016P::SigA(D238V, N263S, E358D))는 성장속도가 현저히 느려지고 L-라이신 생산량이 크게 감소하였다. 그러나 나머지 신규 변이주 11종은 모균주 대비 L-라이신 생산능이 최대 19% 증가하였으며, 기 보고변이(SigA(A414V)) 도입주 KCCM11016P::SigA(A414V)에 비해서도 L-라이신 생산능이 16% 증가된 것을 확인하였다. 이에, 본 발명자들은 상기 L-라이신 생산능이 향상된 균주인 KCCM11016P::SigA(L447H)를 코리네박테리움 글루타미쿰 "CA01-2277"이라 명명하였고, 2013년 11월 22일자로 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 기탁하여 수탁번호 KCCM11479P 를 부여받았다.As a result, two new mutant strains (KCCM11016P::SigA(M230T), KCCM11016P::SigA(R279L)) showed equivalent L-lysine production ability compared to the parent strain, and the other two new mutant strains ( KCCM11016P::SigA (K90E, K105Y, D250G, I254L), KCCM11016P::SigA (D238V, N263S, E358D)) significantly slowed the growth rate and significantly reduced the L-lysine production. However, the remaining 11 new mutant strains showed a maximum 19% increase in L-lysine production capacity compared to the parent strain, and the L-lysine production capacity increased 16% compared to the previously reported variant (SigA(A414V)) KCCM11016P::SigA(A414V). Confirmed. Accordingly, the present inventors named the strain KCCM11016P::SigA(L447H), the strain with improved L-lysine production ability, as Corynebacterium glutamicum "CA01-2277", and as of November 22, 2013, an international deposit under the Budapest Treaty. It was deposited with the Korean Microorganism Conservation Center (KCCM), an institution, and was given the accession number KCCM11479P.

이와 같은 결과는 신규한 11종의 SigA 변이형 폴리펩티드가 L-라이신 생산능이 우수함을 시사하는 것이다.These results suggest that 11 novel SigA variant polypeptides have excellent L-lysine production ability.

실시예Example 8: 고농도 L- 8: high concentration L- 라이신Lysine 생산주를Producer 위하여 for SigASigA 변이형 폴리펩티드가 도입된 Into which the variant polypeptide has been introduced KFCC10750KFCC10750 균주 제작 및 L- Strain production and L- 라이신Lysine 생산능Productivity 비교 compare

코리네박테리움 글루타미쿰에 속하는 다른 균주들에서 상기 실시예 7에서 선별된 SigA 변이 11종의 도입효과를 확인하기 위해, 상기 실시예 7과 같은 방법으로 L-라이신 생산균주인 코리네박테리움 글루타미쿰 KFCC10750(KCCM11347P. 대한민국등록특허 제10-0073610호) 11종의 SigA 변이가 각각 도입된 균주들을 제작하고 KFCC10750::SigA(D136G, T281S), KFCC10750::SigA(L381R), KFCC10750::SigA(M455V), KFCC10750::SigA(S488T), KFCC10750::SigA(I254N), KFCC10750::SigA(A268S), KFCC10750::SigA(L451I, Q491R), KFCC10750::SigA(Q429R), KFCC10750::SigA(L447H), KFCC10750::SigA(K483R), KFCC10750::SigA(K479R)으로 명명하였다. 또한, 기보고 된 변이 SigA(A414V)를 도입한 균주도 제작하였으며, 이를 KFCC10750::SigA(A414V)으로 명명하였다. In order to confirm the effect of introducing 11 strains of SigA selected in Example 7 in other strains belonging to Corynebacterium glutamicum, Corynebacterium, a strain producing L-lysine, was carried out in the same manner as in Example 7 above. Glutamicum KFCC10750 (KCCM11347P. Republic of Korea Patent No. 10-0073610) 11 strains of SigA mutations were respectively introduced, and KFCC10750::SigA(D136G, T281S), KFCC10750::SigA(L381R), KFCC10750:: SigA(M455V), KFCC10750::SigA(S488T), KFCC10750::SigA(I254N), KFCC10750::SigA(A268S), KFCC10750::SigA(L451I, Q491R), KFCC10750::SigA(Q429R), KFCC10750::SigA(Q429R), KFCC10750:: It was named SigA(L447H), KFCC10750::SigA(K483R), KFCC10750::SigA(K479R). In addition, a strain into which the previously reported mutant SigA (A414V) was introduced was also produced, and it was named as KFCC10750::SigA (A414V).

상기 실시예 4과 동일한 방법으로 배양하여, 이로부터 L-라이신의 농도를 분석하였고, 그 결과는 하기 표 8과 같다.Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 8 below.

균주Strain L-라이신(g/)L-lysine (g/) 배치 1Batch 1 배치 2Batch 2 배치 3Batch 3 평균Average 대조군Control KFCC10750KFCC10750 38.838.8 38.138.1 37.937.9 38.338.3 1One KFCC10750::SigA(D136G, T281S)KFCC10750::SigA(D136G, T281S) 41.141.1 41.241.2 40.940.9 41.141.1 22 KFCC10750::SigA(L381R)KFCC10750::SigA(L381R) 42.142.1 41.841.8 41.141.1 41.741.7 33 KFCC10750::SigA(M455V)KFCC10750::SigA(M455V) 43.243.2 43.843.8 44.244.2 43.743.7 44 KFCC10750::SigA(S488T)KFCC10750::SigA(S488T) 42.142.1 40.840.8 41.941.9 41.641.6 55 KFCC10750::SigA (L447H)KFCC10750::SigA (L447H) 44.544.5 45.145.1 44.944.9 44.844.8 66 KFCC10750::SigA(A268S)KFCC10750::SigA(A268S) 39.939.9 41.141.1 39.739.7 40.240.2 77 KFCC10750::SigA(L451I, Q491R)KFCC10750::SigA(L451I, Q491R) 42.942.9 44.144.1 43.843.8 43.643.6 88 KFCC10750::SigA(Q429R)KFCC10750::SigA(Q429R) 40.240.2 41.241.2 42.142.1 41.241.2 99 KFCC10750::SigA(I254N)KFCC10750::SigA(I254N) 44.944.9 44.544.5 43.843.8 44.444.4 1010 KFCC10750::SigA(K483R)KFCC10750::SigA(K483R) 40.540.5 4141 40.940.9 40.840.8 1111 KFCC10750::SigA(K479R)KFCC10750::SigA(K479R) 39.939.9 41.541.5 41.141.1 40.840.8 대조군Control KFCC10750::SigA(A414V)KFCC10750::SigA(A414V) 39.639.6 39.139.1 39.539.5 39.439.4

그 결과, 신규 변이 도입주 11종은 모균주 대비 L-라이신 생산능이 최대 17% 증가하였으며, 기 보고변이(SigAA414V) 도입주 KFCC10750::SigA(A414V)에 비해서도 L-라이신 생산능이 약 14% 증가된 것을 확인하였다. As a result, 11 new mutant introduced strains increased L-lysine production capacity by up to 17% compared to the parent strain, and L-lysine production capacity increased about 14% compared to the previously reported mutant (SigAA414V) KFCC10750::SigA(A414V). It was confirmed.

실시예 9: 고농도 L- 라이신 생산주를 위하여 SigA 변이형 폴리펩티드가 도입된 KCCM10770P 균주 제작 및 L- 라이신 생산능 Example 9: high concentration L- lysine The main production strain producing KCCM10770P SigA variant polypeptide is introduced to the lysine and L- Production performance comparison

코리네박테리움 글루타미쿰에 속하는 다른 균주들에서 상기 실시예 7에서 선별된 SigA 변이 11종의 효과를 확인하기 위해 상기 실시예 7와 같은 방법으로 L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM10770P(대한민국등록특허 제10-0924065호)에 SigA 변이가 도입된 균주를 제작하고 KCCM10770P::SigA(D136G, T281S), KCCM10770P::SigA(L381R), KCCM10770P::SigA(M455V), KCCM10770P::SigA(S488T), KCCM10770P::SigA(I254N), KCCM10770P::SigA(A268S), KCCM10770P::SigA(L451I, Q491R), KCCM10770P::SigA(Q429R), KCCM10770P::SigA(L447H), KCCM10770P::SigA(K483R), KCCM10770P::SigA(K479R)으로 명명하였다. 또한, 기보고 된 변이 SigA(A414V)를 도입한 균주도 제작하였으며, KCCM10770P::SigA(A414V)으로 명명하였다. In order to confirm the effect of the 11 SigA mutations selected in Example 7 in other strains belonging to Corynebacterium glutamicum, the L-lysine producing strain, Corynebacterium glutami, was carried out in the same manner as in Example 7 above. KCCM10770P (Korean Registered Patent No. 10-0924065) to prepare a strain in which the SigA mutation was introduced, and KCCM10770P::SigA(D136G, T281S), KCCM10770P::SigA(L381R), KCCM10770P::SigA(M455V), KCCM10770P: :SigA(S488T), KCCM10770P::SigA(I254N), KCCM10770P::SigA(A268S), KCCM10770P::SigA(L451I, Q491R), KCCM10770P::SigA(Q429R), KCCM1047770P::SigA(L47770P::SigA(L451I)) It was named :SigA(K483R), KCCM10770P::SigA(K479R). In addition, a strain into which the previously reported mutant SigA (A414V) was introduced was also produced, and was named as KCCM10770P::SigA (A414V).

상기 실시예 4과 동일한 방법으로 배양하여, 이로부터 L-라이신의 농도를 분석하였고, 그 결과는 하기 표 9와 같다.Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 9 below.

균주Strain L-라이신(g/)L-lysine (g/) 배치 1Batch 1 배치 2Batch 2 배치 3Batch 3 평균Average 대조군Control KCCM10770PKCCM10770P 47.547.5 48.148.1 47.947.9 47.847.8 1One KCCM10770P::SigA(D136G, T281S)KCCM10770P::SigA(D136G, T281S) 51.151.1 51.651.6 52.152.1 51.651.6 22 KCCM10770P::SigA(L381R)KCCM10770P::SigA(L381R) 52.652.6 50.950.9 52.152.1 51.951.9 33 KCCM10770P::SigA(M455V)KCCM10770P::SigA(M455V) 55.155.1 54.354.3 54.854.8 54.754.7 44 KCCM10770P::SigA(S488T)KCCM10770P::SigA(S488T) 52.152.1 52.452.4 51.951.9 52.152.1 55 KCCM10770P::SigA(L447H)KCCM10770P::SigA(L447H) 56.956.9 57.657.6 57.157.1 57.257.2 66 KCCM10770P::SigA(A268S)KCCM10770P::SigA(A268S) 50.550.5 50.150.1 49.949.9 50.250.2 77 KCCM10770P::SigA(L451I, Q491R)KCCM10770P::SigA(L451I, Q491R) 55.355.3 54.954.9 54.154.1 54.854.8 88 KCCM10770P::SigA(Q429R)KCCM10770P::SigA(Q429R) 52.452.4 52.352.3 50.950.9 51.951.9 99 KCCM10770P::SigA (I254N)KCCM10770P::SigA (I254N) 55.955.9 55.455.4 54.154.1 55.155.1 1010 KCCM10770P::SigA(K483R)KCCM10770P::SigA(K483R) 51.951.9 51.351.3 51.551.5 51.651.6 1111 KCCM10770P::SigA(K479R)KCCM10770P::SigA(K479R) 5151 51.751.7 52.152.1 51.651.6 대조군Control KCCM10770P::SigA(A414V)KCCM10770P::SigA(A414V) 48.948.9 49.549.5 50.150.1 49.549.5

그 결과, 신규 변이 도입주 11종은 모균주 대비 L-라이신 생산능이 최대 20% 증가하였으며, 기 보고변이(SigAA414V) 도입주 KCCM10770P::SigA(A414V)에 비해서도 L-라이신 생산능이 약 16% 증가된 것을 확인하였다. As a result, 11 new mutant introduced strains showed a maximum 20% increase in L-lysine production capacity compared to the parent strain, and about 16% increased L-lysine production capacity compared to the previously reported mutant (SigAA414V) KCCM10770P::SigA(A414V) It was confirmed.

실시예Example 10: 고농도 L- 10: high concentration L- 라이신Lysine 생산주를Producer 위하여 for SigASigA 변이형 폴리펩티드가 도입된 CJ3P 균주 제작 및 L-라이신 생산능 비교 Production of CJ3P strains with variant polypeptides and comparison of L-lysine production capacity

코리네박테리움 글루타미쿰에 속하는 다른 균주들에서의 효과도 확인하기 위해 상기 실시예 7와 같은 방법으로 L-라이신 생산균주인 코리네박테리움 글루타미쿰 CJ3P(Binder et al. Genome Biology 2012, 13:R40)에 SigA 변이가 도입된 균주를 제작하고 CJ3P::SigA(D136G, T281S), CJ3P::SigA(L381R), CJ3P::SigA(M455V), CJ3P::SigA(S488T), CJ3P::SigA(I254N), CJ3P::SigA(A268S), CJ3P::SigA(L451I, Q491R), CJ3P::SigA(Q429R), CJ3P::SigA(L447H), CJ3P::SigA(K483R), CJ3P::SigA(K479R)으로 명명하였다. 또한, 기보고 된 변이 SigA(A414V)를 도입한 균주도 제작하였으며, CJ3P::SigA(A414V)으로 명명하였다. CJ3P 균주는 공지된 기술을 바탕으로 야생주에 3종의 변이를 도입하여 L-라이신 생산능을 갖게된 코리네박테리움 글루타미쿰 균주이다. Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012; 13:R40) was prepared and a strain in which the SigA mutation was introduced was prepared and CJ3P::SigA(D136G, T281S), CJ3P::SigA(L381R), CJ3P::SigA(M455V), CJ3P::SigA(S488T), CJ3P: :SigA(I254N), CJ3P::SigA(A268S), CJ3P::SigA(L451I, Q491R), CJ3P::SigA(Q429R), CJ3P::SigA(L447H), CJ3P::SigA(K483R), CJ3P: : Named as SigA (K479R). In addition, a strain into which the previously reported mutant SigA (A414V) was introduced was also produced, and was named CJ3P::SigA (A414V). CJ3P strain is a Corynebacterium glutamicum strain that has the ability to produce L-lysine by introducing three kinds of mutations into wild strains based on known techniques.

상기 실시예 4과 동일한 방법으로 배양하여, 이로부터 L-라이신의 농도를 분석하였고, 그 결과는 하기 표 10과 같다.Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 10 below.

균주Strain L-라이신(g/)L-lysine (g/) 배치 1Batch 1 배치 2Batch 2 배치 3Batch 3 평균Average 대조군Control CJ3PCJ3P 8.28.2 8.38.3 8.08.0 8.28.2 1One CJ3P::SigA(D136G, T281S)CJ3P::SigA(D136G, T281S) 9.09.0 8.88.8 8.98.9 8.98.9 22 CJ3P::SigA(L381R)CJ3P::SigA(L381R) 8.78.7 8.98.9 8.58.5 8.78.7 33 CJ3P::SigA(M455V)CJ3P::SigA(M455V) 9.39.3 9.59.5 9.19.1 9.39.3 44 CJ3P::SigA(S488T)CJ3P::SigA(S488T) 9.09.0 9.19.1 8.88.8 9.09.0 55 CJ3P::SigA(L447H)CJ3P::SigA(L447H) 9.89.8 10.110.1 9.59.5 9.89.8 66 CJ3P::SigA(A268S)CJ3P::SigA(A268S) 8.58.5 8.78.7 8.98.9 8.78.7 77 CJ3P::SigA(L451I, Q491R)CJ3P::SigA(L451I, Q491R) 9.19.1 9.09.0 8.88.8 9.09.0 88 CJ3P::SigA(Q429R)CJ3P::SigA(Q429R) 8.98.9 8.88.8 9.09.0 8.98.9 99 CJ3P::SigA (I254N)CJ3P::SigA (I254N) 9.19.1 9.79.7 9.59.5 9.49.4 1010 CJ3P::SigA(K483R)CJ3P::SigA(K483R) 8.88.8 9.19.1 8.58.5 8.88.8 1111 CJ3P::SigA(K479R)CJ3P::SigA(K479R) 8.68.6 8.98.9 8.88.8 8.88.8 대조군Control CJ3P::SigA(A414V)CJ3P::SigA(A414V) 8.58.5 8.48.4 8.68.6 8.58.5

그 결과, 신규 변이 도입주 11종은 모균주 대비 L-라이신 생산능이 최대 20% 증가하였으며 기보고변이(SigAA414V) 도입주 CJ3P::SigA(A414V)에 비해서도 L-라이신 생산능이 약 15% 증가된 것을 확인하였다. As a result, 11 new mutant introduced strains increased L-lysine production capacity by up to 20% compared to the parent strain, and L-lysine production capacity increased about 15% compared to CJ3P::SigA(A414V), the previously reported mutant (SigAA414V). Confirmed.

상기 결과를 종합해보건대, 본 발명에서 신규 확보된 11종의 SigA 활성을 갖는 변이형 폴리펩티드(SigA(D136G, T281S), SigA(L381R), SigA(M455V), SigA(S488T), SigA(I254N), SigA(A268S), SigA(L451I, Q491R), SigA(Q429R), SigA(L447H), SigA(K483R), SigA(K479R))들이 다양한 코리네박테리움 속 미생물에서 각각 L-라이신 생산능 증가에 우수한 효과가 있고, 이는 기 보고된 변이 SigA(A414V)보다 L-라이신 생산능 증대 효과가 뛰어남을 시사하는 것이다.According to the above results, 11 kinds of variant polypeptides having SigA activity newly secured in the present invention (SigA(D136G, T281S), SigA(L381R), SigA(M455V), SigA(S488T), SigA(I254N) , SigA(A268S), SigA(L451I, Q491R), SigA(Q429R), SigA(L447H), SigA(K483R), SigA(K479R)) in various Corynebacterium microorganisms, respectively, to increase L-lysine production capacity. There is an excellent effect, which suggests that the L-lysine production capacity enhancement effect is superior to the previously reported mutant SigA (A414V).

이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 예들은 모든 면에서 예시적인 것이며, 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위의 의미 및 범위, 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, the examples described above are illustrative in all respects, and should be understood as non-limiting. The scope of the present invention should be construed as including the meaning and scope of the claims to be described later rather than the detailed description, and all changes or modified forms derived from the equivalent concept within the scope of the present invention.

한국미생물보존센터(국외)Korea Microorganism Conservation Center (overseas) KCCM11479PKCCM11479P 2013112220131122

<110> CJ CheilJedang Corporation <120> A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same <130> PA131284-KR-D2 <160> 22 <170> KopatentIn 2.0 <210> 1 <211> 1497 <212> DNA <213> Corynebacterium glutamicum <400> 1 gtggagagca gcatggtaga aaacaacgta gcaaaaaaga cggtcgctaa aaagaccgca 60 cgcaagaccg cacgcaaagc agccccgcgc gtggcaaccc cattgggagt cgcatctgag 120 tctcccattt cggccacccc tgcgcgcagc atcgatggaa cctcaacccc tgttgaagct 180 gctgacacca tagagaccac cgcccctgca gcgaaggctc ctgcggccaa ggctcccgct 240 aaaaaggttg ccaagaagac agctcgcaag gcacctgcga aaaagactgt cgccaagaaa 300 gccacaaccg ccaaggctgc acctgcaact gccaaggacg aaaacgcacc tgttgatgac 360 gacgaggaga acctcgctca ggatgaacag gacttcgacg gcgatgactt cgtagacggc 420 atcgaagacg aagaagatga agacggcgtc gaagccctcg gtgaagaaag cgaagacgac 480 gaagaggacg gctcatccgt ttgggatgaa gacgaatccg caaccctgcg tcaggcacgt 540 aaagatgccg agctcaccgc ttccgccgac tctgttcgcg cttacctgaa gcaaatcggt 600 aaagttgccc tgctgaacgc tgaacaggaa gtctccctgg caaagcgcat cgaagcaggc 660 ctttacgcca cccaccgcat ggaggaaatg gaagaagctt tcgcagccgg tgacaaggac 720 gcgaaactca ccccagccgt caagcgtgac ctccgcgcca tcgctcgtga cggccgcaag 780 gcgaaaaacc acctcctgga agccaacctt cgtctggttg tctccctggc aaagcgctac 840 accggccgtg gcatggcatt cctggacctc atccaggaag gcaacctcgg tctgattcgt 900 gccgtagaga agttcgacta ctccaagggc tacaagttct ccacctacgc aacctggtgg 960 atccgtcagg caatcacccg cgccatggcc gaccaagcac gaaccatccg tatcccagtc 1020 cacatggttg aagtgatcaa caaacttggt cgcatccaac gtgaactcct tcaggaactc 1080 ggccgcgaac caaccccaca ggaactgtcc aaagaaatgg acatctccga ggaaaaggta 1140 ctggaaatcc agcagtacgc ccgcgaacca atctccctgg accaaaccat cggcgacgaa 1200 ggcgacagcc agctcggcga cttcatcgaa gactccgaag ccgtcgtcgc agtcgacgcc 1260 gtctcattca ccctgctgca agaccagcta caggacgtcc tagagaccct ctccgaacgt 1320 gaagccggcg tggttaaact ccgcttcgga ctcaccgacg gaatgccacg cactttagac 1380 gaaatcggcc aagtttacgg tgtcacccgt gagcgcatcc gccagattga gtccaagacc 1440 atgtctaagc tgcgccaccc atcacgctcc caggtccttc gcgactacct ggactaa 1497 <210> 2 <211> 498 <212> PRT <213> Corynebacterium glutamicum <400> 2 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 1 <400> 3 gtggagagca gcatggtag 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 2 <400> 4 cgcagaggaa aacagtggc 19 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Primer 3 <400> 5 aacagctatg accatg 16 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 4 <400> 6 aagaattcgt ggagagcagc atggtag 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 5 <400> 7 aagtcgaccg cagaggaaaa cagtggc 27 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer 6 <400> 8 gcaggtcgac tctagactca ccccagccgt caagcgt 37 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer 7 <400> 9 ccggggatcc tctagatcaa ggcgatgtcg gaaaatg 37 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 8 <400> 10 aagactccga agtcgtcgtc gcagt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 9 <400> 11 actgcgacga cgacttcgga gtctt 25 <210> 12 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 12 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Gly Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Ser Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 13 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 13 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Arg Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 14 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 14 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Val Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 15 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 15 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Thr Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 16 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 16 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys His Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 17 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 17 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ser Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 18 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 18 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Ile Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Arg Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 19 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 19 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Arg Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 20 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 20 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Asn Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 21 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 21 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Arg Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 22 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 22 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Arg Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <110> CJ CheilJedang Corporation <120> A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same <130> PA131284-KR-D2 <160> 22 <170> KopatentIn 2.0 <210> 1 <211> 1497 <212> DNA <213> Corynebacterium glutamicum <400> 1 gtggagagca gcatggtaga aaacaacgta gcaaaaaaga cggtcgctaa aaagaccgca 60 cgcaagaccg cacgcaaagc agccccgcgc gtggcaaccc cattgggagt cgcatctgag 120 tctcccattt cggccacccc tgcgcgcagc atcgatggaa cctcaacccc tgttgaagct 180 gctgacacca tagagaccac cgcccctgca gcgaaggctc ctgcggccaa ggctcccgct 240 aaaaaggttg ccaagaagac agctcgcaag gcacctgcga aaaagactgt cgccaagaaa 300 gccacaaccg ccaaggctgc acctgcaact gccaaggacg aaaacgcacc tgttgatgac 360 gacgaggaga acctcgctca ggatgaacag gacttcgacg gcgatgactt cgtagacggc 420 atcgaagacg aagaagatga agacggcgtc gaagccctcg gtgaagaaag cgaagacgac 480 gaagaggacg gctcatccgt ttgggatgaa gacgaatccg caaccctgcg tcaggcacgt 540 aaagatgccg agctcaccgc ttccgccgac tctgttcgcg cttacctgaa gcaaatcggt 600 aaagttgccc tgctgaacgc tgaacaggaa gtctccctgg caaagcgcat cgaagcaggc 660 ctttacgcca cccaccgcat ggaggaaatg gaagaagctt tcgcagccgg tgacaaggac 720 gcgaaactca ccccagccgt caagcgtgac ctccgcgcca tcgctcgtga cggccgcaag 780 gcgaaaaacc acctcctgga agccaacctt cgtctggttg tctccctggc aaagcgctac 840 accggccgtg gcatggcatt cctggacctc atccaggaag gcaacctcgg tctgattcgt 900 gccgtagaga agttcgacta ctccaagggc tacaagttct ccacctacgc aacctggtgg 960 atccgtcagg caatcacccg cgccatggcc gaccaagcac gaaccatccg tatcccagtc 1020 cacatggttg aagtgatcaa caaacttggt cgcatccaac gtgaactcct tcaggaactc 1080 ggccgcgaac caaccccaca ggaactgtcc aaagaaatgg acatctccga ggaaaaggta 1140 ctggaaatcc agcagtacgc ccgcgaacca atctccctgg accaaaccat cggcgacgaa 1200 ggcgacagcc agctcggcga cttcatcgaa gactccgaag ccgtcgtcgc agtcgacgcc 1260 gtctcattca ccctgctgca agaccagcta caggacgtcc tagagaccct ctccgaacgt 1320 gaagccggcg tggttaaact ccgcttcgga ctcaccgacg gaatgccacg cactttagac 1380 gaaatcggcc aagtttacgg tgtcacccgt gagcgcatcc gccagattga gtccaagacc 1440 atgtctaagc tgcgccaccc atcacgctcc caggtccttc gcgactacct ggactaa 1497 <210> 2 <211> 498 <212> PRT <213> Corynebacterium glutamicum <400> 2 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 1 <400> 3 gtggagagca gcatggtag 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 2 <400> 4 cgcagaggaa aacagtggc 19 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Primer 3 <400> 5 aacagctatg accatg 16 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 4 <400> 6 aagaattcgt ggagagcagc atggtag 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 5 <400> 7 aagtcgaccg cagaggaaaa cagtggc 27 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer 6 <400> 8 gcaggtcgac tctagactca ccccagccgt caagcgt 37 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer 7 <400> 9 ccggggatcc tctagatcaa ggcgatgtcg gaaaatg 37 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 8 <400> 10 aagactccga agtcgtcgtc gcagt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 9 <400> 11 actgcgacga cgacttcgga gtctt 25 <210> 12 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 12 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Gly Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Ser Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 13 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 13 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Arg Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 14 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 14 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Val Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 15 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 15 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Thr Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 16 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 16 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys His Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 17 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 17 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ser Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 18 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 18 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Ile Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Arg Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 19 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 19 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Arg Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 20 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 20 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Asn Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 21 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 21 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Arg Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 22 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 22 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Arg Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp

Claims (11)

서열번호 2의 아미노산 서열로 이루어진 폴리펩티드에서 시작 메치오닌을 1번째 아미노산으로 하여 이로부터 479번째 아미노산이 알지닌으로 치환된, RNA 중합효소 시그마인자 A 활성을 가지는 변이형 폴리펩티드.
A mutant polypeptide having an RNA polymerase sigma factor A activity in which a start methionine is substituted as a first amino acid and a 479th amino acid thereof is substituted with an arginine in a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.
제1항에 있어서, 상기 변이형 폴리펩티드는 추가적으로 하기 아미노산 치환 중 1 이상의 아미노산 치환을 가지는 변이형 폴리펩티드;
136번째 아미노산이 글리신으로 치환; 254번째 아미노산이 아스파라진으로 치환; 268번째 아미노산이 세린으로 치환; 281번째 아미노산이 세린으로 치환; 381번째 아미노산이 알지닌으로 치환; 429번째 아미노산이 알지닌으로 치환; 451번째 아미노산이 이소류신으로 치환; 483번째 아미노산이 알지닌으로 치환; 488번째 아미노산이 쓰레오닌으로 치환; 및 491번째 아미노산이 알지닌으로 치환.
2. The polypeptide of claim 1, wherein the variant polypeptide further comprises one or more amino acid substitutions among the following amino acid substitutions:
The 136th amino acid is replaced by glycine; The 254th amino acid is substituted with asparagine; The 268th amino acid is replaced by serine; The 281st amino acid is replaced by serine; The 381st amino acid is replaced by an arginine; The 429th amino acid is replaced by an arginine; The 451th amino acid is substituted with isoleucine; The 483th amino acid is substituted with an arginine; Replace the 488th amino acid with threonine; And the 491th amino acid is substituted with an arginine.
삭제delete 제1항에 있어서, 상기 변이형 폴리펩티드는 서열번호 22의 아미노산 서열인 변이형 폴리펩티드.
The mutant polypeptide of claim 1, wherein the mutant polypeptide is the amino acid sequence of SEQ ID NO: 22.
제1항 또는 제2항의 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드.
9. A polynucleotide encoding a variant polypeptide of any of claims 1 or 2.
제5항의 폴리뉴클레오티드를 포함하는 숙주 세포.
A host cell comprising the polynucleotide of claim 5.
서열번호 2의 아미노산 서열로 이루어진 폴리펩티드에서 시작 메치오닌을 1번째 아미노산으로 하여 이로부터 479번째 아미노산이 알지닌으로 치환된, RNA 중합효소 시그마인자 A 활성을 가지는 변이형 폴리펩티드를 포함하도록 형질전환된 L-라이신 생산능이 향상된 코리네박테리움 속 미생물.
In a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, the starting methionine is substituted as the first amino acid and the 479th amino acid thereof is substituted with an arginine, and the transformed L- Microorganisms of the genus Corynebacterium with improved lysine production ability.
제7항에 있어서, 상기 변이형 폴리펩티드는 추가적으로 하기 아미노산 치환 중 1 이상의 아미노산 치환을 가지는, L-라이신 생산능이 향상된 코리네박테리움 속 미생물;
136번째 아미노산이 글리신으로 치환; 254번째 아미노산이 아스파라진으로 치환; 268번째 아미노산이 세린으로 치환; 281번째 아미노산이 세린으로 치환; 381번째 아미노산이 알지닌으로 치환; 429번째 아미노산이 알지닌으로 치환; 451번째 아미노산이 이소류신으로 치환; 483번째 아미노산이 알지닌으로 치환; 488번째 아미노산이 쓰레오닌으로 치환; 및 491번째 아미노산이 알지닌으로 치환.
8. The method of claim 7, wherein the mutant polypeptide further comprises one or more amino acid substitutions among the following amino acid substitutions: Corynebacterium sp. Microorganism having enhanced L-lysine production ability;
The 136th amino acid is replaced by glycine; The 254th amino acid is substituted with asparagine; The 268th amino acid is replaced by serine; The 281st amino acid is replaced by serine; The 381st amino acid is replaced by an arginine; The 429th amino acid is replaced by an arginine; The 451th amino acid is substituted with isoleucine; The 483th amino acid is substituted with an arginine; Replace the 488th amino acid with threonine; And the 491th amino acid is substituted with an arginine.
삭제delete 제7항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인 L-라이신 생산능이 향상된 코리네박테리움 속 미생물.
8. The microorganism of the genus Corynebacterium according to claim 7, wherein the microorganism is Corynebacterium glutamicum .
제7항, 제8항 및 제10항 중 어느 한 항에 따른 미생물을 배지에서 배양하는 단계; 및 상기 배양된 미생물 또는 배양 배지로부터 L-라이신을 회수하는 단계를 포함하는, L-라이신을 생산하는 방법.Culturing the microorganism according to any one of claims 7, 8 and 10 in a medium; And recovering L-lysine from the cultured microorganism or culture medium.
KR1020160123477A 2016-09-26 2016-09-26 A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same KR101768390B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160123477A KR101768390B1 (en) 2016-09-26 2016-09-26 A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160123477A KR101768390B1 (en) 2016-09-26 2016-09-26 A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020140119137A Division KR101755767B1 (en) 2014-09-05 2014-09-05 A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same

Publications (2)

Publication Number Publication Date
KR20160118172A KR20160118172A (en) 2016-10-11
KR101768390B1 true KR101768390B1 (en) 2017-08-16

Family

ID=57161847

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160123477A KR101768390B1 (en) 2016-09-26 2016-09-26 A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same

Country Status (1)

Country Link
KR (1) KR101768390B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112023022523A2 (en) * 2021-04-29 2024-01-02 Cj Cheiljedang Corp PROMOTER, CORYNEBACTERIUM GLUTAMICUM VARIANT AND METHOD FOR L-LYSINE PRODUCTION

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003054179A1 (en) * 2001-12-20 2003-07-03 Degussa Ag Alleles of the siga gene from coryneform bacteria

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003054179A1 (en) * 2001-12-20 2003-07-03 Degussa Ag Alleles of the siga gene from coryneform bacteria

Also Published As

Publication number Publication date
KR20160118172A (en) 2016-10-11

Similar Documents

Publication Publication Date Title
KR101592140B1 (en) Corynebacterium sp. having xylose availability and process for preparing L-lysine employing the same
KR101865998B1 (en) Microorganism having l-threonine-producing capability and method of producing l-threonine using the same
KR101594156B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR101776375B1 (en) Pyruvate dehydrogenase variants, a microorganism comprising the same and a method for producing L-amino acid using the same
KR101835935B1 (en) A microorganism of genus corynebacterium having an ability to produce L-arginine and a method for producing L-arginine using the same
KR101640711B1 (en) A gluconate repressor variant, a microorganism comprising the same and a method for producing L-lysine using the microorganism
KR101689451B1 (en) Recombinant microorganisms of escherichia with l-threonine productivity and method of producing l-threonine using the same
KR20140102393A (en) Recombinant microorganisms of escherichia with l-threonine productivity and method of producing l-threonine using the same
KR101768390B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR101760219B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR101768391B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
US11312982B2 (en) Microorganism with improved L-threonine producing capability, and method for producing L-threonine by using the same
KR101755767B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
JP2024515389A (en) Corynebacterium glutamicum mutant with improved L-lysine production ability and method for producing L-lysine using the same
KR20220126610A (en) Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same
KR20220149219A (en) Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same
KR20220148694A (en) Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same
CN116004501A (en) NADP-ferredoxin reductase mutant and application thereof in production of glutamic acid
KR20240000169A (en) L-Histidine Export Protein and Method of Producing L-Histidine Using the Same
KR20210143591A (en) Novel polypeptide and a method of producing L-leucine using the same
KR20150040837A (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant