KR20230140802A - Composition for enhancing function of stem cells and uses thereof - Google Patents

Abstract

The present invention relates to a composition for enhancing the function of stem cells containing uric acid as an active ingredient and its use. Stem cells cultured in the composition have increased self-renewal and differentiation ability, inhibit aging, and exhibit neuroprotective effects.

Description

Composition for enhancing the function of stem cells and use thereof {COMPOSITION FOR ENHANCING FUNCTION OF STEM CELLS AND USES THEREOF}

The present invention relates to a composition for enhancing the function of stem cells containing uric acid as an active ingredient and its use.

Stem cells, unlike differentiated adult cells, are characterized by self-renewal ability and pluripotency. Self-replication ability means that the stem cell itself can reproduce itself infinitely into stem cells with the same characteristics without losing its own characteristic, pluripotency. Pluripotency means that stem cells can be reproduced in certain environments and conditions. This means that differentiation into cells of several different lineages can occur. Due to these characteristics of stem cells, stem cells are being studied as cell therapy.

Recently, the concept of stem cell therapy has been expanded to include adult stem cells that secrete biologically active molecules and exert beneficial effects on the surrounding environment (Non-Patent Documents 1 to 3). However, a major challenge for MSC-based therapies is to develop an in vitro culture system that mimics the microenvironment (niche) of natural MSCs while simultaneously proliferating the cells at clinical scale without compromising their quality and function (Non-Patent Documents 8 to 8). 10). To date, several studies have shown that modulating biological, biochemical, and/or biophysical factors can influence the fate, lineage-specific differentiation, function, and therapeutic potential of MSCs (non-patent Documents 9, 11 and 12). One method is cell priming. Many studies have demonstrated the effectiveness of MSC priming under hypoxia, cytokines, growth factors, pharmacological or other chemical agents, biomaterials, and various culture conditions (Non-Patent Documents 2, 8, and 13).

Meanwhile, Parkinson's disease (PD) is characterized by the gradual loss of dopaminergic neurons in the substantia nigra (SN) and the formation of proteinaceous fibrillar cytoplasmic inclusions mainly composed of aggregated α-synuclein. It is pathologically characterized by the presence of Lewy bodies, which are fibrillar cytoplasmic inclusions (Non-patent Documents 14 and 15).

The basis for managing Parkinson's disease is symptomatic treatment using drugs that increase dopamine concentration or directly stimulate dopamine receptors (Non-patent Document 16). Nevertheless, these symptomatic treatments do not affect the progression of Parkinson's disease and, moreover, are ineffective against some axial parkinsonian symptoms and various non-motor symptoms. Therefore, it is important to develop disease-modifying treatments for Parkinson's disease that reduce the rate of neurodegeneration or halt disease progression.

Previous studies have shown that mesenchymal stem cells (MSCs) help prevent Parkinson's disease by regulating neuroinflammation, inhibiting apoptosis, increasing neurogenesis and neural differentiation, enhancing autophagy, and regulating α-synuclein migration. It can act as a powerful regulator of the related neurodegenerative microenvironment (Non-patent Documents 4 to 7).

1. Caplan AI and Dennis JE. Mesenchymal stem cells as trophic mediators. J Cell Biochem 2006; 98(5): 1076-1084. 2. Madrigal M, Rao KS and Riordan NH. A review of therapeutic effects of mesenchymal stem cell secretions and induction of secretory modification by different culture methods. J Transl Med 2014; 12:260. 3. Parekkadan B and Milwid JM. Mesenchymal stem cells as therapeutics. Annu Rev Biomed Eng 2010; 12: 87-117. 4. Kim YJ, Park HJ, Lee G, et al. Neuroprotective effects of human mesenchymal stem cells on dopaminergic neurons through anti-inflammatory action. Glia 2009; 57(1): 13-23. 5. Park HJ, Shin JY, Kim HN, et al. Neuroprotective effects of mesenchymal stem cells through autophagy modulation in a parkinsonian model. Neurobiol Aging 2014; 35(8): 1920-1928. 6. Oh SH, Kim HN, Park HJ, et al. The cleavage effect of mesenchymal stem cell and its derived matrix metalloproteinase-2 on extracellular α-synuclein aggregates in parkinsonian models. Stem Cells Transl Med 2017; 6(3): 949-961. 7. Park HJ, Shin JY, Lee BR, et al. Mesenchymal stem cells augment neurogenesis in the subventricular zone and enhance differentiation of neural precursor cells into dopaminergic neurons in the substantia nigra of a parkinsonian model. Cell Transplant 2012; 21(8): 1629-1640. 8. Noronha NC, Mizukami A, Caliari-Oliveira C, et al. Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res Ther 2019; 10(1): 131. 9. Pittenger MF, Discher DE, Peault BM, et al. Mesenchymal stem cell perspective: cell biology to clinical progress. NPJ Regen Med 2019; 4:22. 10. Bunpetch V, Zhang ZY, Zhang X, et al. Strategies for MSC expansion and MSC-based microtissue for bone regeneration. Biomaterials 2019; 196: 67-79. 11. Chen YQ, Liu YS, Liu YA, et al. Bio-chemical and physical characterizations of mesenchymal stromal cells along the time course of directed differentiation. Sci Rep 2016; 6: 31547. 12. Song N, Scholtemeijer M and Shah K. Mesenchymal stem cell immunomodulation: mechanisms and therapeutic potential. Trends Pharmacol Sci 2020; 41: 653-664. 13. 16. Yin JQ, Zhu J and Ankrum JA. Manufacturing of primed mesenchymal stromal cells for therapy. Nat Biomed Eng 2019; 3(2): 90-104. 14. Poewe W, Seppi K, Tanner CM, et al. Parkinson's disease. Nat Rev Dis Primers 2017; 3:17013. 15. Goedert M, Spillantini MG, Del Tredici K, et al. 100 years of Lewy pathology. Nat Rev Neurol 2013; 9(1): 13-24. 16. Kalia LV and Lang AE. Parkinson's disease. Lancet 2015; 386(9996): 896-912.

Under this background, the present inventors worked to develop technology that can increase the function of stem cells, and completed the present invention by confirming a significant relationship between uric acid (UA) and the function of stem cells.

Therefore, the purpose of the present invention is to provide a composition for enhancing the function of stem cells containing uric acid and its use.

In order to achieve the above object, one aspect of the present invention provides a composition for enhancing the function of stem cells containing uric acid as an active ingredient.

As used herein, the term “stem cell” refers to an undifferentiated cell that has not yet differentiated, is capable of infinite proliferation through self-renewal, and is influenced by the environment in which the cell is located. It refers to pluripotent cells that have pluri-potency or multi-potency that can differentiate into all types of cells when appropriate signals are given as needed.

The stem cells may be autologous or allogeneic, and may be derived from any type of animal, including humans and non-human mammals, and are not limited thereto, whether the stem cells are derived from adults or embryos.

The stem cells include induced pluripotent stem cells, embryonic stem cells, and adult stem cells, and may specifically be adult stem cells. The adult stem cells may be mesenchymal stem cells, human tissue-derived mesenchymal stromal cells, human tissue-derived mesenchymal stem cells, multipotent stem cells, or amniotic epithelial cells, but are not limited thereto. The adult stem cells may be stem cells derived from the umbilical cord, cord blood, synovium, bone marrow, fat, muscle, nerve, skin, amniotic membrane, and placenta, but are not limited thereto. According to one embodiment, the stem cells may be mesenchymal stem cells derived from human bone marrow.

As used herein, the term “adult stem cell” refers to stem cells that appear at the stage where each organ of the embryo is formed or at the adult stage as the developmental process progresses. The differentiation capacity of adult stem cells can generally be limited to cells that make up specific tissues, and these adult stem cells remain in most organs even after adulthood and play a role in replenishing cell loss that occurs normally or pathologically. In charge. This may mean cells with multipotency, as stem cells present in tissues are isolated and cultured in vitro. The adult stem cells may include adult stem cells from any origin, such as humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, etc.

As used herein, the term “mesenchymal stem cells” refers to undifferentiated stem cells isolated from human or mammalian tissues, and can be derived from various tissues. In particular, umbilical cord-derived mesenchymal stem cells, cord blood-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, fat-derived mesenchymal stem cells, muscle-derived mesenchymal stem cells, nerve-derived mesenchymal stem cells, and skin-derived mesenchymal stem cells. , amniotic membrane-derived mesenchymal stem cells, and placenta-derived mesenchymal stem cells, and techniques for isolating stem cells from each tissue are already known in the art.

As used herein, the term “induced pluripotent stem cells (iPSC)” refers to cells induced to have pluripotent differentiation ability through an artificial dedifferentiation process from differentiated cells, and is also called pluripotent stem cells. do. The artificial dedifferentiation process is carried out by virus-mediated or non-viral vectors using retroviruses and lentiviruses, by introduction of non-viral-mediated dedifferentiation factors using proteins and cell extracts, or by stem cell extracts, compounds, etc. Includes dedifferentiation process. Induced pluripotent stem cells have almost the same characteristics as embryonic stem cells, specifically showing similar cell shapes, similar gene and protein expression patterns, and pluripotency in vitro and in vivo. It forms a teratoma, forms a chimera mouse when inserted into a mouse blastocyst, and germline transmission of genes is possible. The induced pluripotent stem cells may include induced pluripotent stem cells from any origin, such as humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, and rabbits.

As used herein, the term "embryonic stem cell" refers to an inner cell mass extracted from a blastocyst stage embryo just before the fertilized egg implants in the mother's uterus and cultured in vitro. It refers to cells that are pluripotent or totipotent and have self-renewal ability that can differentiate into tissue cells. In a broad sense, they are embryoid bodies derived from embryonic stem cells. ) may also be included. The embryonic stem cells may include embryonic stem cells from any origin, such as humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, and rabbits.

In the above composition, "stem cell function" specifically refers to pluripotency, which has the ability to generate all cells, such as embryonic stem cells, and self-replication ability, which can create cells similar to oneself indefinitely. do. The term stem cell function may be used interchangeably with stem cell function.

As used herein, the term "stemness" is a term commonly used in the art to collectively refer to the integrated function of the molecular program that regulates and maintains the stem cell state and is capable of generating all cells. It is a general term for pluripotency, which is the ability to reproduce, and self-replication ability, which is the ability to create cells similar to oneself indefinitely. In other words, stem cell capacity can mean the ability to maintain the characteristics of stem cells.

As used herein, “uric acid” is the final enzymatic product of purine nucleoside degradation in humans and is known as an antioxidant that protects cells from oxidative damage. However, its function and activity are not known regarding the culture of stem cells, specifically maintaining and enhancing stem cell function.

The uric acid may be included in the composition at an appropriate concentration as long as it meets the purpose of strengthening stem cells. The uric acid is for example 10 to 400 μM, for example 10 to 350 μM, for example 10 to 300 μM, for example 10 to 250 μM, for example 10 to 200 μM, for example 50 to 400 μM. , for example, may be included in the composition at a concentration of 100 to 400 μM, for example, 150 to 400 μM.

The present inventors confirmed that stem cell function (stem cell function) was enhanced when stem cells were cultured for 24 or 48 hours in a medium containing uric acid at a concentration of 200 or 400 μM.

As used herein, the term “enhancing stem cell function” may include properties that promote glycolysis of stem cells, inhibit aging of stem cells, increase cell proliferation, or increase differentiation ability. Additionally, it may be a property of proliferating undifferentiated cells while maintaining their undifferentiated state, increasing the expression of genes important for maintaining stem cell function, or decreasing the expression of miR-137 and miR-145.

Genes important for maintaining stem cell function are genes that maintain stem cell function when expressed in stem cells, for example, OCT4 (octamer-binding transcription factor 4,), NANOG (Nanog Homeobox), and SOX2 (SRY (sex determining It may be region Y)-Box Transcription Factor 2), but is not limited thereto. If the expression of at least one of the above genes is increased, it can be determined that the functionality of the stem cell has increased.

The term “proliferation” refers to an increase in the number of cells and can be used in the same sense as growth. In addition, “undifferentiated proliferation” refers to the proliferation of stem cells into cells that have the same properties as the original cell, that is, pluripotency (can be used interchangeably with the term “pluripotency”) without being differentiated into specific cells. It means to do.

The composition for enhancing stem cell function of the present invention may be provided in the form of a medium composition containing uric acid in order to increase the function of stem cells. The uric acid can be used by adding it to a typical medium used for stem cell culture to achieve the effect related to enhancing stem cell function disclosed herein. According to one embodiment, it was confirmed that adding uric acid to the stem cell culture medium inhibits aging of stem cells, improves cell proliferation, and significantly increases the function of stem cells.

The medium composition may be a basic medium commonly used in cell culture with uric acid added. The basic medium is DMEM (Dulbecco's Modified Eagle's Medium), 80% knockout DMEM, MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM-F12, α-MEM (α-MEM) -Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AmnioMax Medium, and Chang's Medium MesemCult-XF Medium. In addition, Any medium used in the industry for culturing stem cells can be used without limitation.

Meanwhile, the composition for enhancing stem cell function of the present invention may additionally contain ingredients useful for cell culture as long as they do not affect the effect of uric acid.

Another aspect of the present invention provides a method for enhancing the function of stem cells, comprising treating the stem cells with uric acid.

In the method of enhancing the function of stem cells, “stem cells” and “uric acid” are as mentioned above.

The step of treating stem cells with uric acid may be culturing the stem cells in a medium containing uric acid, and the term “treatment” may be used interchangeably with “priming.”

As used herein, the term “media” refers to a culture medium capable of supporting the growth and survival of stem cells under in vitro culture conditions, and includes all media commonly used in the art suitable for cell culture. can do. Medium and culture conditions can be selected depending on the type of cell. The medium used for culture is cell culture minimal medium (CCMM), which generally contains carbon source, nitrogen source, and trace element components.

Meanwhile, the medium may contain uric acid at an effective concentration. The "effective concentration" refers to an amount of uric acid sufficient to increase stem cell function. It is not active below the effective concentration, and can induce cell aging above the effective concentration, so uric acid should be used within the effective concentration. You can. The uric acid is for example 10 to 400 μM, for example 10 to 350 μM, for example 10 to 300 μM, for example 10 to 250 μM, for example 10 to 200 μM, for example 50 to 400 μM. , for example, may be included in the composition at a concentration of 100 to 400 μM, for example, 150 to 400 μM. If the concentration is outside the above range, the effect of increasing stem cell function may not appear.

In addition, the stem cell culture is for example 0.1 to 48 hours, for example 0.1 to 40 hours, for example 0.1 to 36 hours, for example 0.1 to 30 hours, for example 0.1 to 24 hours, for example It may be carried out for 5 to 48 hours, such as 10 to 48 hours, such as 15 to 48 hours, such as 20 to 48 hours. If it is outside the above time range, the effect of increasing stem cell function may not appear.

The method may include subculturing the stem cells, and may be accomplished by culturing the stem cells in a medium containing uric acid, subculturing them, and then culturing them again in a medium containing uric acid. Alternatively, the stem cells may be cultured in a medium containing uric acid, then subcultured, and then cultured in a basic medium. When culturing in basic medium after subculture, if it is necessary to enhance stem cell function, it can be replaced with medium containing uric acid.

Another aspect of the present invention provides stem cells with enhanced function obtained through the method for increasing stem cell function.

According to one embodiment, stem cell aging is suppressed in stem cells cultured in a medium containing uric acid, and cell proliferation ability is significantly increased while differentiation ability is maintained.

Another aspect provides a cell therapeutic composition comprising stem cells with enhanced stem cell function or a dilution thereof.

Stem cells obtained through a method of increasing stem cell function including the step of treating uric acid significantly increase stem cell function, thereby activating the stem cells to a state suitable for transplantation or improving their characteristics to be suitable for the human body. It can be included as an active ingredient in cell therapy, such as by modifying it.

As used herein, the term “cell therapy” refers to a medicine used for the purposes of treatment, diagnosis, and prevention from cells and tissues isolated from humans, cultured, and manufactured through special processes, to restore the function of cells or tissues. Use of living autologous, allogenic, or xenogenic cells for the purposes of treatment, diagnosis, and prevention through a series of actions such as in vitro proliferation, selection, or other methods to change the biological characteristics of the cells. refers to medicines that are Cell therapeutics can be broadly classified into somatic cell therapeutics and stem cell therapeutics depending on the degree of cell differentiation. According to one embodiment, the cell therapeutic composition may be a stem cell therapeutic agent containing stem cells treated with uric acid as an active ingredient.

As used herein, the term “stem cell therapy” is a type of cell therapy that manipulates cells outside the body and injects them back into the body for the purpose of treating, diagnosing, and preventing disease. Unlike existing general medicines aimed at relieving disease symptoms for an unspecified number of people, it refers to customized bio medicines that fundamentally treat diseases by injecting manipulated and cultured stem cells into patients. The stem cell therapeutics include embryonic stem cell therapeutics produced in the early development stage of the embryo depending on the origin of the cell, adult stem cell therapeutics that exist limitedly in various tissues of adults, and reverse differentiation of general somatic cells into an early undifferentiated state. It is divided into differentiated stem cell therapy, or organoid-based cell therapy derived from embryonic stem cells, adult stem cells, and pluripotent stem cells. Depending on the treatment method, it can be classified into autologous stem cell therapy that transplants the patient's own stem cells, allogeneic stem cell therapy that transplants another person's stem cells, and xenogeneic stem cell therapy that uses animal stem cells. The stem cell treatment is able to restore the function or tissue of damaged cells by directly injecting cells into the patient, so it is not toxic to the human body and regenerates and maintains the body's original functions, providing a fundamental treatment method that surgery or drug therapy cannot provide. can be presented. The stem cell treatment is used to treat various cell damage diseases such as cerebral infarction, myocardial infarction, degenerative arthritis, and fractures through the 3R strategy of Regeneration and Rejuvenation, Replacement, and Repair of damaged tissues and cells. It can be utilized.

The stem cells with increased stem cell function may preferably be in the form of a cell composition containing one or more diluents to protect and maintain the cells and facilitate their use when injected, injected, or transplanted into the desired tissue. The diluent may include a buffer solution such as physiological saline, Phosphate Buffered Saline (PBS), or Hank's balanced salt solution (HBSS), or plasma or blood components.

The cell therapy composition may be administered to mammals, including humans, through various routes. The administration method may be any commonly used method. For example, during clinical administration, it may be administered directly to the disease site as well as parenteral administration in the form of intramuscular or intravenous injection, and may be administered orally, transdermally, subcutaneously, or intravenously. Alternatively, it may be administered through a route such as muscle.

The administered dose of the cell therapy composition may vary depending on the individual's age, weight, gender, dosage form, health condition, and disease severity, and is administered in divided doses once or several times a day at regular time intervals according to the judgment of a doctor or pharmacist. You may. For example, in the case of humans, a typical dosage of cell therapy may be 10 ⁴ to 10 ¹⁰ cells/body, preferably 10 ⁶ to 10 ⁸ cells/body, and may be administered once or in several divided doses. The above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences.

The cell therapy composition may exhibit a preventive or therapeutic effect on neurological diseases. The neurological disease may include degenerative neurological diseases, such as Parkinson's disease, dementia, Alzheimer's disease, Huntington's disease, amyotrophic axonal sclerosis, stroke, memory decline, myasthenia gravis, progressive supranuclear palsy, multiple system atrophy, and essential tremor. , cortico-basal dystrophy, diffuse Lewy body disease, and Pick's disease.

According to one embodiment, stem cells whose stem cell function is enhanced by treatment with uric acid can restore damaged motor skills in an animal model of Parkinson's disease.

As used herein, the term “treatment” refers to any action that suppresses, alleviates, or beneficially changes the clinical situation related to the disease. Treatment may also mean increased survival compared to expected survival without treatment. Treatment may include preventive measures in addition to therapeutic measures.

The cell therapy composition may be formulated to further include a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not significantly irritate living organisms and does not inhibit the biological activity and properties of the administered ingredient. Pharmaceutically acceptable carriers for pharmaceutical compositions to which the cell therapy composition can be applied include, without limitation, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, etc., as long as they are known in the art. You can use it.

The cell therapy composition can be prepared according to commonly used techniques in the form of various formulations. Cell therapy compositions can be administered through any route as long as they can induce movement to the disease site. In some cases, loading the stem cells into a vehicle equipped with a means to direct them to the lesion may be considered. Accordingly, the cell therapy compositions may be administered topically (including buccal, sublingual, dermal, and intraocular administration), parenteral (including subcutaneous, intradermal, intramuscular, instillation, intravenous, intraarterial, intraarticular, and intracerebrospinal fluid), or transdermal. It can be administered through various routes, including administration, and is preferably administered directly to the affected area.

The cell therapy composition may be administered in a pharmaceutically effective amount. As used herein, the term “effective amount” means the amount necessary to delay or completely stop the onset or progression of the specific disease to be treated.

The appropriate total daily usage amount can be determined by the treating physician within the scope of sound medical judgment. For the purpose of the cell therapy composition, the specific therapeutically effective amount for a specific patient is determined by the type and degree of response to be achieved, the specific composition, including whether other agents are used as the case may be, the patient's age, weight, and general health condition. It may be desirable to apply it differently depending on various factors including gender and diet, administration time, administration route and secretion rate of the composition, treatment period, drugs used or used simultaneously with the specific composition, and similar factors well known in the medical field. there is.

Among the terms or elements mentioned in the stem cell or cell therapeutic composition containing the same, those mentioned in the description of the composition for enhancing stem cell function or the method for enhancing stem cell function of the stem cell are the same as those mentioned in the composition or enhancing method previously. It is understood to be the same as mentioned in the explanation.

Using the composition of the present invention, the function of stem cells can be strengthened, and stem cells with enhanced function have excellent neuroprotective effects and can be used to treat neurodegenerative diseases.

Figure 1 shows the results of confirming the expression levels of glycolysis enzymes in mesenchymal stem cells (MSCs) primed with uric acid.
Figure 2 shows the results of confirming the expression levels of glycolysis enzymes in mesenchymal stem cells (MSCs) primed with uric acid.
Figure 3 shows the results of confirming the expression levels of glycolysis enzymes in mesenchymal stem cells (MSC) primed with uric acid.
Figure 4 shows the results of confirming the expression of positive and negative MSC markers in mesenchymal stem cells (MSC) primed with uric acid.
Figure 5 shows the results of confirming the degree of cell proliferation (A), the expression level of the cellular senescence marker p16 (B), and the replicative senescence marker p21 (C) in mesenchymal stem cells (MSC) primed with uric acid.
Figure 6 shows the results of confirming the expression levels of transcription factors responsible for regulating stem cell function in mesenchymal stem cells (MSCs) primed with uric acid.
Figure 7 shows the results of confirming the mRNA levels of genes involved in osteogenesis, adipogenesis, and chondrogenesis after culturing mesenchymal stem cells (MSCs) primed with uric acid without differentiation medium.
Figure 8 shows the results of mesenchymal stem cells (MSC) primed with uric acid, cultured without differentiation medium, and then stained with Alizarin Red S, Oil Red O, and Alcian Blue.
Figure 9 shows the results of confirming the mRNA levels of genes involved in osteogenesis, adipogenesis, and chondrogenesis after culturing mesenchymal stem cells (MSCs) primed with uric acid in differentiation medium.
Figure 10 shows the results of mesenchymal stem cells (MSC) primed with uric acid, cultured in differentiation medium, and then stained with Alizarin Red S, Oil Red O, and Alcian Blue.
Figure 11 shows the results of priming mesenchymal stem cells (MSCs) with uric acid, removing the uric acid-containing medium, and confirming the expression levels of transcription factors responsible for regulating stem cell function.
Figure 12 shows the results of confirming the expression levels of miR-137 and miR-145 in mesenchymal stem cells (MSCs) primed with uric acid.
Figure 13 shows the results of confirming the cell survival rate after co-culturing SH-SY5Y cells treated with neurotoxin and mesenchymal stem cells (MSCs) primed with uric acid.
Figure 14 shows the results of confirming the level of reactive oxygen species (ROS) production after co-culturing SH-SY5Y cells treated with neurotoxin and mesenchymal stem cells (MSCs) primed with uric acid.
Figure 15 shows the results of confirming the level of lactate dehydrogenase (LDH) release after co-culturing SH-SY5Y cells treated with neurotoxin and mesenchymal stem cells (MSCs) primed with uric acid.
Figure 16 shows the results of confirming the expression levels of cleaved caspase-3, cytochrome c, and Bax, which are apoptosis markers, after co-culturing SH-SY5Y cells treated with neurotoxin and mesenchymal stem cells (MSCs) primed with uric acid. am.
Figure 17 shows the results of confirming the expression of positive and negative MSC markers in bone marrow-derived mesenchymal stem cells (BM-MSCs) isolated from a hyperuricemia animal model.
Figure 18 shows the results of confirming the blood uric acid level (A) and the degree of proliferation of BM-MSCs (B) in a hyperuricemia animal model.
Figure 19 shows the results of confirming the expression levels of p16 and p21 in BM-MSCs isolated from a hyperuricemia animal model.
Figure 20 shows the results of confirming the expression levels of transcription factors responsible for regulating stem cell function in BM-MSCs isolated from a hyperuricemia animal model.
Figure 21 shows the results of confirming the mRNA levels of genes involved in osteogenesis, adipogenesis, and chondrogenesis in BM-MSCs isolated from a hyperuricemia animal model.
Figure 22 shows the results of culturing BM-MSCs isolated from a hyperuricemia animal model in differentiation medium and staining them with Alizarin Red S, Oil Red O, and Alcian Blue.
Figure 23 shows the results of confirming the expression levels of miR-137 and miR-145 in BM-MSCs isolated from a hyperuricemia animal model.
Figure 24 shows the results of confirming the number of TH (tyrosine hydroxylase) positive neurons in the brain substantia nigra after administering MSCs primed under various conditions to MPTP-treated Parkinson's disease mice.
Figure 25 shows the results of confirming the levels of cleaved caspase-3, cytochrome c, and Bax in brain tissue after administering MSCs primed under various conditions to MPTP-treated Parkinson's disease mice.
Figure 26 shows the results of confirming the level of inflammatory cytokines after administering MSCs primed under various conditions to MPTP-treated Parkinson's disease mice.
Figure 27 shows the results of confirming the degree of motor ability recovery after administering MSCs primed under various conditions to MPTP-treated Parkinson's disease mice.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are for illustrative purposes of one or more specific examples and the scope of the present invention is not limited to these examples.

Reagents and experimental methods

1. MSC and SH-SY5Y culture

Frozen vials of passage 2 human mesenchymal stem cells (MSCs) were provided by Severance Hospital Cell Therapy Center (Seoul, Korea). The human MSCs were cultured in low-glucose DMEM (Dulbecco's Modified Eagle Medium) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin.

SH-SY5Y cells, a human neuroblastoma cell line with dopaminergic neuron properties, were purchased from the Korean Cell Line Bank (Seoul, Korea). SH-SY5Y cells were cultured in high-glucose DMEM supplemented with 10% FBS and 1% penicillin.

Both human MSC and SH-SY5Y cells were cultured in a humidified incubator at 37°C and 5% CO ₂ conditions.

MSC priming was performed as follows. Human MSCs were plated at a density of ^1x104 cells/cm2 and treated with uric acid (UA) at a concentration of 200 μM or 400 μM for 24 hours and 48 hours, respectively. Hereinafter, MSCs primed with UA are referred to as “UA-primed MSCs.”

SH-SY5Y cells were plated at a density of 2x10 ⁴ cells/cm2 and treated with 100 μM MPP ⁺ (1-methyl-4-phenylpyridinium ion) for 24 hours. Afterwards, they were cocultured with MSCs or UA-primed MSCs for 24 hours.

2. Mouse

All animal testing procedures are governed by the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals, and the Rodent Animal Care and Use Committee (IACUC) of Yonsei University Health System. The experiment was conducted in accordance with guidelines and policies. Male C57BL/6 mice (purchased from Orient Bio) were acclimatized in an environmentally controlled room with a constant 12/12 h light/dark cycle for 1 week before drug administration.

3. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) experiment

Cell viability was measured using CellTiter 96 ^® Aqueous One Solution Cell Proliferation Assay (Promega; USA) according to the manufacturer's protocol. Absorbance was measured at 490 nm with a SpectraMax 340PC384 microplate reader (Molecular Devices), and the results were analyzed with Softmax Pro software (Molecular Devices).

4. MSC differentiation and immunostaining

Osteogenic differentiation was performed as follows. MSCs were plated at a density of 5x10 ³ cells/cm 2 and incubated in complete medium with ascorbic acid (50 μg/ml; Sigma), sodium β-glycerophosphate (10 mM; Sigma), and Differentiation was induced by adding dexamethasone (10 ^-8 M; Sigma). Two weeks later, the plates were washed with phosphate-buffered saline (PBS, HyClone), fixed with 4% paraformaldehyde, and stained with 1% Alizarin Red S (ARS; Sigma).

Adipogenic differentiation was performed as follows. MSCs were plated at a density of 5x10 ³ cells/cm 2 and differentiation was induced by adding dexamethasone (10 ^-7 M) and insulin (6 ng/ml; Gibco) to complete medium. After 3 weeks, the plates were washed with phosphate-buffered saline, fixed with 4% paraformaldehyde, and stained with Oil Red O (ORO; Sigma).

Chondrogenic differentiation was performed as follows. MSCs were plated at a density of 5x10 ³ cells/cm 2 and differentiation was induced by adding ascorbic acid (50 μg/ml) and TGFβ-3 (1 ng/ml; R&D system) to complete medium. Two weeks later, the plate was washed with phosphate-buffered saline, fixed with 4% paraformaldehyde, and stained with 0.05% alcian blue (AB; Sigma).

5. RT-PCR (quantitative real-time polymerase chain reaction)

Total RNA was extracted from MSCs with TRIzol reagent (Invitrogen) according to the manufacturer's protocol. For each experiment, an equal amount of RNA (1 μg) was reverse transcribed using High capacity cDNA reverse transcription kits (Thermo fisher). Afterwards, RT-PCR was performed using AccuPower® 2X GreenStar ^TM qPCR MasterMix (Bioneer) using cDNA as a template.

For miRNA quantification, reverse transcription was performed with the Mir-X miRNA First-Strand Synthesis Kit (Clontech Laboratories), and RT-PCR was performed using the Mir- did. All RT-PCR was performed using the RT-PCR StepOnePlus system (Applied Biosystems). Data were normalized to GAPDH or U6 and analyzed by the 2 ^-ΔΔC T method.

6. Western blotting

Cells and brain tissue were dissolved in RIPA buffer supplemented with protease inhibitor cocktail (Sigma). The lysate was centrifuged (14,000xg) for 20 minutes at 4°C, the supernatant was transferred to a new tube, and the protein was quantified. 10 μg of protein was separated by SDS-gel electrophoresis and transferred to a hydrophobic PVDF membrane (GE Healthcare). The PVDF membrane was blocked with a skim milk solution and reacted with the designated primary antibody at 4°C overnight. The membrane was then washed with PBST and reacted with fluorescently coupled goat anti-mouse or rabbit antibody at room temperature (RT) for 2 hours. Blots were visualized with ImageQuant LAS 4000 min (GE Healthcare), and Western blot quantification was performed with ImageJ. The primary antibodies used are listed in Table 1.

antibody Rabbit monoclonal anti-p16 Abcam Ab51243 Rabbit monoclonal anti-p21 Abcam Ab109199 Mouse monoclonal anti-OCT4 Santa Cruz Sc-5279 Rabbit polyclonal anti-NANOG Abcam Ab106465 Rabbit polyclonal anti-SOX2 Abcam Ab97959 Rabbit monoclonal anti-caspase-3 Cell Signaling 9665 Rabbit polyclonal anti-cleaved caspase-3 Cell Signaling 9661 Mouse monoclonal anti-actin Santa Cruz Sc-47778 Rabbit monoclonal anti-cytochrome c Cell Signaling 4280S Mouse monoclonal anti-bax Santa Cruz Sc-7480 Mouse monoclonal anti-bcl-2 Santa Cruz Sc-7382 Rat anti-CD44 Invitrogen 12-0441-82 Rat anti-CD34 Invitrogen 11-0341-82 Rat anti-CD45 Invitrogen 11-0451-82 Rat anti-CD105 Invitrogen MA5-17945 Mouse anti-CD105 Invitrogen 25-1057-41 Mouse anti-CD34 Invitrogen CD34-581-18 Mouse anti-CD45 Invitrogen 12-0459-42 Mouse monoclonal anti-TH Sigma T2928

7. ROS detection and immunostaining

Intracellular ROS (reactive oxygen species) levels were measured using DCFDA (2',7'-dichlorodihydrofluorescein diacetate) cellular ROS detection assay kit (Abcam) according to the manufacturer's protocol. The degree of generation of fluorescent oxidized DCF was measured at 520 nm using a SpectraMax 340PC384 microplate reader, and the results were analyzed using Softmax Pro software.

For immunostaining, cells were washed twice with PBS and fixed with 10% methanol diluted in PBS for 30 minutes. Cell nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI; Invitrogen), and immunostained cells were analyzed with a Zeiss LSM 780 confocal microscope system (Zeiss).

8. L-lactate measurement

Lactate levels in cells were measured using a colorimetric L-lactate assay kit (Abcam) according to the manufacturer's protocol. Absorbance was measured at 450 nm with a SpectraMax 340PC384 microplate reader, and the results were analyzed with Softmax Pro software.

9. LDH (lactate dehydrogenase) cytotoxicity assay

LDH release was measured with an LDH cytotoxicity detection kit (Takara Bio, Cat. #MK401) according to the manufacturer's protocol. 100 μl of cell supernatant and 100 μl of reaction mix were mixed in a 69-well plate and reacted at room temperature for 30 minutes. Afterwards, the absorbance was measured at 490 nm using a SpectraMax 340PC384 microplate reader, and the results were analyzed using Softmax Pro software.

10. UA enhancement therapy

To model hyperuricemia, mice were administered potassium oxonate (PO; Sigma; intraperitoneal injection [ip], 250 mg/kg, daily) or inosine 5'-monophosphate disodium salt hydrate (IMP; Sigma; ip 500 mg/kg) was injected. Mice were then randomly divided into three groups (n=12 per group): (a) control group, (b) PO-treated group, and (c) PO and IMP-treated group. All mice were sacrificed after 4 weeks.

11. Serum urate measurement

Blood samples collected from the vena cava were centrifuged at 4000xg for 20 min at 4°C to collect serum samples (approximately 20 μl). The amount of serum urate was measured in 3.3 μl of serum samples using the Amplex Red Uric acid/Uricase assay kit (Molecular Probes) according to the manufacturer's protocol.

12. Mouse BM-MSC isolation and culture

The joint of the mouse was cut to separate the femur, and the residual soft tissue was removed by careful rubbing. Femurs were then collected in culture dishes containing DMEM medium supplemented with 10% FBS and 1% P/S placed on ice. The femur was washed twice with PBS to flush out blood cells and residual soft tissue. With a 1 ml syringe attached to a 27-gauge needle, 1 ml of complete DMEM medium supplemented with 10% FBS and 1% P/S was withdrawn, and the needle was then inserted into the bone cavity. Medium was injected to allow the bone marrow to slowly escape from the bone cavity, and the bone cavity was washed twice again until the bone became pale.

All bone fragments were removed from the culture dish with forceps, leaving solid lumps in the medium, and the culture dish was cultured in an incubator at 37°C and 5% CO ₂ for 5 days.

13. Animal testing

To evaluate the effect of UA-primed MSCs in an animal model of Parkinson's disease (PD), mice were treated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine). -1,2,3,6-tetrahydropyridine (MPTP; Sigma; intraperitoneal injection (i.p.), 30 mg/kg) was administered daily for 14 days. MPTP is well known to impair the nigrostriatal dopaminergic pathway, and this impairment is seen in PD patients.

Afterwards, the mice were randomly divided into five experimental groups (n=5 per group). (a) Control group, (b) MPTP administration group, (c) MPTP and mouse control MSC administration group, (d) MPTP and PO+IMP-primed mouse MSC administration group, and (e) MPTP and UA-primed human MSC administration group. Mice in the MSC-administered experimental group were injected with MSCs or UA-primed MSCs (1x10 ⁶ cells per 200 μl) through the tail vein 3 days after the final MPTP injection. All mice were sacrificed 4 weeks after MSC injection.

14. Brain sample preparation

All mice were anesthetized with chloral hydrate (Fluka; i.p., 0.4 g/kg) and then perfused with 4% paraformaldehyde dissolved in 0.1 M phosphate buffer. The brain was separated and embedded in paraffin, and coronal sections were cut to a thickness of 20 μm and placed on slides.

15. FACS (fluorescence activated cell sorting)

Human and mouse MSC were characterized by FACS as follows.

The cell suspension was washed twice with PBS containing 0.1% BSA. 2x10 ⁶ cells/ml were incubated with primary antibody at 4°C for 1 hour and washed twice with PBS containing 0.1% BSA. Cells were identified by cytometric analysis using an LSR II flow cytometer (Beckman coulter) with BD FACSDiva software. The antibodies used are as listed in Table 1.

16. Immunohistochemical staining

Deparaffinized brain sections were washed with PBS and incubated in 0.2% Triton X-100 for 15 min at room temperature. Afterwards, the brain slices were blocked with 0.5% BSA for 30 minutes and washed three times with 0.25% BSA. Brain sections were reacted with primary mouse anti-tyrosine hydroxylase (TH) antibody overnight at 4°C, and antibody signals were detected with 0.05% diaminobenzidine (DAB; Vector Laboratories). Immunostained cells were analyzed by bright field microscopy (Olympus).

17. Rotarod experiment

Mice were tested on a Rotarod apparatus (MEDAssociates) to assess motor function, coordination, and balance.

The day before the training session, mice were acclimatized to the apparatus for 15 min. During training trials, mice were trained to run on a rotarod at 20 rpm for 10 min without falling, twice a day for 3 consecutive days.

In test trials, mice were placed on a rotarod at a speed of 30 rpm, and the rotarod speed was increased from 5 to 40 rpm (maximum cutoff time: 700 s). The time it took for the mouse to fall off the rotarod was recorded.

18. Stereological cell counts

The number of TH-stained dopaminergic neurons was counted in the substantia nigra of every fourth section throughout the substantia nigra pars compacta of the brain. Afterwards, the number of cells stained with TH was calculated at high power starting from a random point. To avoid double counting of abnormally shaped neurons, TH-stained cells were counted when the nucleus was optimally visualized in only one focal plane. The total number of TH-stained neurons in the substantia nigra pars compacta of the brain was calculated according to the formula disclosed in a previous paper ( Neurobiol Aging 1993; 14(4): 275-285).

19. Statistical analysis

Group means were compared using Tukey's post hoc test analysis for multiple groups. Differences were considered statistically significant at p<0.05, and all statistical analyzes were performed with commercially available software (SPSS Inc., version 12.0). All experiments were independently repeated 3-4 times.

Experiment result

1. Stimulation of glycolysis

To determine whether uric acid affects the glycolysis process in MSCs, the expression levels of rate-limiting enzymes were analyzed by quantitative RT-PCR. Glucose metabolism consists of interconnected pathways, with a major link between glycolysis and the pentose phosphate pathway (PPP).

As a result, compared to control MSC, UA-primed MSC showed hexokinase 2 (HK2), 6-phosphofructo-2-kinase/fructose-2,6-bisphosphate 3 (6-phosphofructo-2) -kinase/fructose-2,6-biphosphatase 3, PFKFB3), pyruvate kinase muscle isozyme (PKM), fructose-bisphosphate aldolase (ALDOA), and lactate dehydrogenase (lactate) The mRNA levels of glycolysis enzymes such as dehydrogenase (LDH) were increased (Figures 1A to 1C/Figures 3A and 3B).

The mRNA levels of HK1 were similar between UA-primed MSCs and control MSCs (Figure 2A). The mRNA levels of PPP enzymes such as glucose 6-phosphate dehydrogenase (G6PD), 6-phosphogluconate dehydrogenase (PGD), and transketolase (TKT) are also UA. -There was no significant difference between primed and control MSCs (Figures 2B-2D).

Additionally, the concentration of L-lactic acid, the final product of glycolysis, was confirmed. L-lactic acid concentration increased in UA-primed MSCs compared to control MSCs, indicating that aerobic glycolysis was triggered by UA (Figure 3C).

The results of this example show that UA priming (treatment) can promote glycolysis by upregulating glycolytic enzymes in MSCs.

2. Strengthening the stem cell function of MSCs

We confirmed whether upregulation of glycolysis enhances stemness in UA-primed MSCs.

Stem cell properties of MSCs include self-replicating ability, high proliferation rate, as well as multipotency into bone cells, adipocytes, and chondrocytes. Both control MSCs and UA-primed MSCs expressed the positive MSC markers CD44 and CD105, but not the negative MSC markers CD34 and CD45 (Figure 4).

Next, MTS analysis was performed to confirm whether UA priming promotes proliferation of MSCs. As a result, compared to control MSCs, UA-primed MSCs showed a significant increase in cell density in a time-dependent manner regardless of UA concentration (Figure 5A).

Afterwards, the expression levels of p16 and p21 were analyzed to evaluate the effect of UA priming on the senescence of MSCs. Expression levels of p16 increase after aging, whereas p21 expression increases rapidly in cells reaching replicative senescence.

As a result of the experiment, the expression levels of p16 and p21 did not increase in UA-primed MSCs treated with 200 μM UA for 24 hours. However, the expression level of p16 increased in UA-primed MSCs treated with 400 μM UA for 24 hours, or 200 μM or 400 μM UA for 48 hours. The expression level of p21 also showed a similar tendency to increase depending on UA concentration and culture time (Figure 5B). These results suggest that UA affects cellular senescence at high concentrations and after long incubation times.

Next, the mRNA and protein levels of OCT4 (octamer-binding transcription factor 4,), NANOG (Nanog Homeobox), and SOX2 (SRY (sex determining region Y)-Box Transcription Factor 2), which are transcription factors responsible for regulating stem cell function, were examined. Confirmed.

As a result, the expression level of OCT4 significantly increased 24 hours after UA treatment, regardless of the treatment concentration, but decreased after 48 hours. The expression level of NANOG also significantly increased after 24 hours of UA treatment and decreased after 48 hours of culture, regardless of the treatment concentration. The expression level of SOX2 increased after 24 hours of culture regardless of UA concentration, but decreased significantly after 48 hours of culture (Figure 6). This suggests that UA enhances stem cell capacity under conditions of short culture times and relatively low UA concentrations.

Next, the mRNA levels of differentiation-related genes were measured to confirm whether the increase in stem cell capacity by UA priming increases the differentiation ability of MSCs. Differentiation-related genes include RUNX2 (RNNS family transcription factor 2) and ALP (alkaline phosphatase), which are involved in osteogenesis, and PPARG (Peroxisome Proliferator Activated Receptor Gamma) and RHOA (Ras homolog family), which are involved in adipogenesis. member A), and HAT1 (histone acetyltransferase 1) and BMP4 (bone morphogenetic protein 4) genes involved in chondrogenesis were identified.

MSCs were treated with UA at a concentration of 200 μM or 400 μM and cultured for 24 and 48 hours, respectively, without differentiation medium. After checking the expression levels of each gene, there was no significant difference between control MSCs and UA-primed MSCs (Figure 7). In addition, MSCs were stained with Alizarin Red S, Oil Red O, and Alcian Blue to confirm osteogenic, adipogenic, and chondrogenic abilities. As a result of cell staining, it was confirmed that UA treatment did not affect the differentiation ability of MSCs toward a specific lineage (Figure 8).

Additionally, MSCs were treated with UA at a concentration of 200 μM or 400 μM for 24 and 48 hours, respectively, and then cultured in osteogenic or chondrogenic differentiation medium for 2 weeks and adipogenic differentiation medium for 3 weeks. Compared with control MSCs, the expression levels of genes related to adipogenesis, osteogenesis, and chondrogenesis were increased in UA-primed MSCs (Figure 9). In addition, cell staining results showed that the differentiation capacity for osteogenesis, adipogenesis, and chondrogenesis was significantly increased in UA-primed MSCs after induction with differentiation medium (FIG. 10).

Meanwhile, UA-containing medium was removed 24 hours after UA treatment, and it was confirmed whether the pluripotency of MSCs continued. As a result, the expression levels of OCT4, NANOG, and SOX2, which were significantly increased 24 hours after UA treatment, were significantly decreased after UA removal (FIG. 11). These results suggest that UA enhances stem cell capacity through strict aging control depending on treatment concentration and culture time.

3. Changes in MiR-137 expression

Based on known miRNAs that regulate self-replication in stem cells, we screened for miRNAs that affect the enhancement of stem cell function by UA priming. The types of miRNAs and primer sequences used for screening are listed in Table 2.

miRNAs Sequence (5' →3') hsa-miR-137 ACGGGUAUUCUUGGGUGGAUAAU hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU hsa-let-7-a UGAGGUAGGUAGGUUGUAUAGUU hsa-miR-200a CAUCUUACCGGACAGUGGCUGGA hsa-miR-372 CCUCAAAUGUGGAGCACUAUUCU hsa-miR-184 UGGACGGAGAACUGAUAAGGGU hsa-miR-296 AGGGCCCCCCCUCAAUCC UGU hsa-miR-214 ACAGCAGGCACAGACAGGCAGU hsa-miR-183 GUGAAUUACCGAAGGGCCUAAA hsa-miR-203a AGUGGUUCUUAACAGUUCAACAGUU hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG hsa-miR-126 CAUUAUUACUUUUGGUACGCG hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG hsa-miR-129 CUUUUUGCGGUCUGGGCUUGC hsa-miR-371a ACUCAAACUGUGGGGGCACU hsa-miR-1246 AAUGGAUUUUUGGAGCAGG hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU hsa-miR-590 GAGCUUAUUCAUAAAAGUGCAG hsa-miR-324 CGCAUCCCCUAGGGCAUUGGUG mmu-miR-137 ACGGGUAUUCUUGGGUGGAUAAU mmu-miR-145 GUCCAGUUUUCCCAGGAAUCCCU

Screening results showed that the expression levels of miR-137 and miR-145 were decreased in UA-primed MSCs compared to control MSCs. Additionally, the mRNA level of miR-137 was significantly reduced in UA-primed MSCs compared to the mRNA level of miR-145 (Figure 12). The expression levels of other miRNAs did not differ between UA-primed MSCs and control MSCs. These results suggest that miR-137 is a candidate regulator of UA-related MSC priming.

4. Neuroprotection effect of UA-primed MSCs

To investigate the effect of UA-primed MSCs on cell viability, SH-SY5Y cells were treated with MPP ⁺ for 24 h. Cells were then co-cultured with control MSCs, UA-primed MSCs, or UA-primed MSCs washed out after 24 h of UA treatment.

MPP ⁺ treatment significantly reduced cell viability compared to the control group. However, when MPP ⁺ treated cells were co-cultured with control MSCs, UA-primed MSCs, or UA-primed MSCs (wash out) in a Transwell chamber, cell survival increased compared to the MPP ⁺ treatment group. Additionally, cell viability was significantly increased in the experimental group cultured with UA-primed MSC compared to the experimental group cultured with control MSC or UA-primed MSC (wash out) (FIG. 13). These results indicate that UA-primed MSCs have a cytoprotective effect.

Additionally, MPP ⁺ treatment significantly increased ROS levels compared to the control group. However, co-culture of MPP ⁺ treated cells with control MSCs, UA-primed MSCs, or UA-primed MSCs (wash out) reduced ROS production compared to the MPP ⁺ treated group (Figure 14).

Additionally, MPP ⁺ treatment significantly increased LDH release compared to the control group, whereas co-culture of MPP ⁺ treated cells with control MSCs, UA-primed MSCs, or UA-primed MSCs (wash out) did not significantly increase LDH release compared to the MPP ⁺ treatment group. In comparison, LDH release was significantly reduced (Figure 15). The regulatory effect on ROS and LDH production was more pronounced in UA-primed MSCs compared to control MSCs or UA-primed MSCs (wash out).

Meanwhile, as a result of apoptosis analysis, co-culture of MPP ⁺ treated cells with UA-primed MSCs significantly reduced the expression of cleaved caspase-3, cytochrome c, and Bax. Additionally, co-culture of MPP ⁺ treated cells with UA-primed MSCs appeared to increase Bcl-2 expression compared to co-culture with control MSCs or UA-primed MSCs (wash out) (Figure 16).

These results demonstrate that UA-primed MSCs inhibit apoptosis and increase neuronal survival in neurotoxin-treated cells.

5. Enhancement of stem cell function of mouse BM-MSCs

To confirm whether uric acid increases the self-replication and differentiation ability of mouse BM-MSC (bone marrow-derived MSC), a hyperuricemia model was created, and BM-MSC were isolated and analyzed.

As a result of FACS analysis, MSCs isolated from control mice and mice administered PO and IMP expressed positive MSC markers CD44 and CD105, but did not express negative MSC markers CD34 and CD45 (FIG. 17).

Serum UA levels were significantly higher in mice administered PO and IMP and mice administered PO alone compared to control mice, and were higher in mice administered PO and IMP than in mice administered PO alone (Figure 18A).

MTS analysis showed that the MSC proliferation rate was significantly higher in mice administered PO and IMP than in mice administered control or PO alone (Figure 18B).

In addition, the expression levels of p16, p21, OCT4, NANOG, and SOX2 were examined to determine whether PO or IMP administration regulates aging and stem cell ability of MSCs.

There was no significant difference in the expression levels of p16 and p21 in the control group, mice administered PO alone, and mice administered PO and IMP (Figure 19). However, the expression levels of OCT4, NANOG, and SOX2 were significantly increased in mice administered PO and IMP compared with mice administered control or PO alone. Additionally, the expression levels of these stem cell capacity-related genes were significantly increased in mice administered PO alone compared to control mice (FIG. 20).

Similarly, mRNA levels of genes related to osteogenesis (RUNX2, ALP), adipogenesis (PPARG, RHOA), and chondrogenesis (HAT1, BMP4) were increased in mice administered PO and IMP compared to mice administered control or PO alone. (Figure 21).

Immunostaining results showed that the differentiation capacity for osteogenesis, adipogenesis, and chondrogenesis was significantly increased in mice administered PO and IMP compared to mice administered control or PO alone (FIG. 22).

Additionally, the expression levels of miR-137 and miR-145 were relatively decreased in mice administered PO and IMP compared to mice administered control or PO alone (FIG. 23).

The results of this experiment suggest that enhancing the UA level in mice (increasing the concentration in the body) leads to an improvement in the proliferation rate of MSCs and enhancement of stem cell function.

6. Neuroprotective effect of UA-primed MSCs

To confirm the neuroprotective effect of MSC priming, MSCs primed under various conditions were administered to MPTP-treated Parkinson's disease mice and then dopaminergic neurons in the substantia nigra were compared.

Immunohistochemical analysis showed that the number of TH-positive neurons was significantly reduced in MPTP-treated mice compared to control mice. All types of MSC treatment increased the survival of tyrosine TH-positive neurons compared to MPTP-treated groups. The number of TH positive neurons in the UA-primed mouse or human MSC administered group increased compared to the MPTP administered group or the mouse control MSC administered group (FIG. 24).

Additionally, the UA-primed mouse or human MSC administration group significantly reduced the expression level of cleaved caspase-3 compared to the MPTP treatment or mouse control MSC administration group. Meanwhile, UA-primed human MSCs were shown to have stronger neuroprotective capacity compared to UA-primed mouse MSCs, and UA-primed human MSC administration significantly reduced the expression level of cleaved caspase-3 ( Fig. 25)).

Additionally, the levels of inflammatory cytokines were measured to evaluate the immunomodulatory effect of UA-primed MSCs.

The levels of pro-inflammatory cytokines such as interleukin (IL)-1A, IL-17A, and interferon gamma (IFNγ) were increased in MPTP-treated mice compared to the control group, while the levels of pro-inflammatory cytokines in all MSC-treated mice were increased compared to MPTP-treated mice. This decreased significantly. Similarly, in all MSC-administered groups, the levels of anti-inflammatory cytokines such as IL-4, IL-10, and IL-11 were significantly increased compared to MPTP-administered mice (Figure 26).

The cytokine modulating effect was more pronounced in the UA-primed mouse or human MSC group than in the mouse control MSC group. As a result, UA-primed mouse or human MSC administration further restored impaired motor coordination and balance in the rotarod test compared to the control MSC group. Additionally, the UA-primed human MSC administered group showed a higher ability to recover impaired motor coordination compared to the UA-primed mouse MSC administered group (FIG. 27).

Claims (13)

A composition for enhancing the function of stem cells containing uric acid as an active ingredient. The composition for enhancing the function of stem cells according to claim 1, wherein the stem cells are selected from the group consisting of induced pluripotent stem cells, adult stem cells, and embryonic stem cells. The composition for enhancing the function of stem cells according to claim 2, wherein the adult stem cells are mesenchymal stem cells. The composition for enhancing the function of stem cells according to claim 1, wherein the stem cells are of autologous, allogeneic, or xenogeneic origin. The composition for enhancing the function of stem cells according to claim 1, wherein the uric acid is contained at a concentration of 10 to 400 μM. The method of claim 1, wherein the stem cell ability promotes glycolysis, inhibits cell aging of stem cells, increases cell proliferation ability, increases differentiation ability, increases expression of stem cell ability-related genes, decreases expression of miR-137, and expression of miR-145. A composition for enhancing the function of stem cells, which is enhanced by one or more characteristics selected from the group consisting of reduction. A method of enhancing the function of stem cells comprising treating the stem cells with uric acid. The method of claim 7, wherein the uric acid is treated at a concentration of 10 to 1,000 μM. The method of claim 7, wherein the step of treating the stem cells with uric acid is performed for 0.1 to 48 hours. The method of claim 7, wherein the step of treating the stem cells with uric acid includes subculturing the stem cells. A composition for cell therapy comprising the stem cells according to claim 7 as an active ingredient. The composition for cell therapy according to claim 11, wherein the composition is used to improve or treat degenerative brain diseases. The composition for cell therapy according to claim 11, wherein the degenerative brain disease is selected from the group consisting of Parkinson's disease, dementia, Alzheimer's disease, and Lewy body disease.