KR20130039467A - Method of inducing differentiation of mesenchymal stem cell derived from amnion isolated from human term placenta into neuron and hair cell - Google Patents

Abstract

PURPOSE: A nerve cell and a hair cell differentiated from amnion-derived mesenchymal stem cells are provided to treat hearing loss caused by damage of hair cells and to be used in regenerative medicine. CONSTITUTION: A method for differentiating amnion-derived mesenchymal stem cells into nerve cells and hair cells comprises a step of culturing the mesenchymal stem cell in a medium containing nerve growth factor AT 36-38 deg. C under the presence of 4-6% carbon dioxide for 5-15 days. The nerve growth factor is selected among GDNF(Grial-Derived Neurotrophin Factor), BDNF(Brain-Derived Neutrophin Factor), and neurotrophin-3(NT-3). The medium additionally contains 1-3 wt%(v/v) of B-27 supplement, 1-3 mM of L-glutamine, and 0.5-2 wt%(v/v) of penicillin-streptomycin. A composition for cell therapy for preventing or treating hearing loss contains the nerve cells and hair cells as active ingredients.

Description

Method of inducing differentiation of mesenchymal stem cell derived from amnion isolated from human term placenta into neuron and hair cell}

The present invention is a method for differentiating neurons and hair cells from the amnion derived mesenchymal stem cells of the placenta, and for the treatment of cells for the prevention or treatment of hearing loss comprising neurons and hair cells differentiated from the amnion derived mesenchymal stem cells as an active ingredient. It relates to a composition.

Recently, when cells are destroyed or damaged by disease, cell replacement therapy that supplies cells from the outside has been suggested as an effective treatment, especially stem cells capable of proliferation and differentiation into tissues requiring regeneration. cell) is in the spotlight.

In particular, biotechnology in the 21st century presents the possibility of new solutions to food, environment, and health problems as the final goal of human welfare. Recently, the use of stem cells has emerged as a new chapter in the treatment of intractable diseases. Previously, organ transplantation and gene therapy have been suggested for the treatment of intractable disease in humans.

As interest in stem cell research increased, pluripotent stem cells with the ability to form all organs through proliferation and differentiation were found to be capable of fundamentally solving long-term damage as well as treating most diseases. In addition, many scientists have suggested the possibility of applying stem cells to the treatment of almost all organ regeneration of the human body as well as treatment of Parkinson's disease, various cancers, diabetes and spinal cord injury.

Stem cells with such diverse functions are cells before the differentiation of each cell constituting the tissue, capable of infinite proliferation in the undifferentiated state, and have the potential to differentiate into cells of various tissues by specific differentiation stimulation. Say. Neural stem cells also have the ability to self-replicate and can differentiate into neurons or glia, such as astrocytes, oligodendrocytes or Schwann cells. It is an undifferentiated cell with differentiation ability, and neural stem cells are differentiated into neural cells, for example, neurons or glia, through the steps of neural progenitor cells or glia progenitor cells that produce specific nervous system cells.

Meanwhile, mesenchymal stem cells can be differentiated into bone, cartilage, adipose tissue, muscle, tendons, ligaments, and nerve tissues, and thus are attracting attention as cells suitable for cell therapy. Currently, bone marrow is the most representative tissue from which mesenchymal stem cells can be obtained. However, mesenchymal stem cells present in bone marrow have limited application range due to their limited differentiation and proliferative capacity. Due to limitations derived from bone marrow, several stages of procedure are required, and the procedure is complicated. It is usually accompanied by mental and physical suffering. In addition, for bone marrow transplantation, there is a problem in that a donor does not show a graft-versus-host response because the antigenic phenotypes are matched through histocompatibility antigen comparison.

Therefore, in recent years, it is known that a large amount of stem cells are present in cord blood, and research on cell treatment using cord blood is being actively conducted. In particular, many attempts have been made to treat blood-related diseases through umbilical cord blood transplantation, and umbilical cord blood banks that freeze umbilical cord blood and preserve it in a usable state for several years for autograft treatment are being activated in Korea.

In addition, recently, studies for separating mesenchymal stem cells from fetal tissues have been actively conducted. As a result, it has been found that there are abundant mesenchymal stem cells, but fetal tissues for the purpose of cell therapy ) Has limited use for cell therapy because of its ethical limitation. Although mesenchymal stem cells were also isolated from umbilical cord blood (UCB) as a source for fetal mesenchymal stem cells (fetal MSC), the number was very small and there was a problem that proliferation was not good. Therefore, it is necessary to develop a new method for separating and culturing stem cells that can be easily expanded and cultured as cell therapy.

On the other hand, the loss of hearing, which is one of the human senses, causes personal disturbances in daily life and enormous losses in socio-economics. Hearing loss does not only cause hearing impairment, but if severe hearing loss occurs before language acquisition, it becomes a problem due to language impairment due to normal language development. In addition, as the senile population has increased exponentially, senile deafness has been increasing rapidly. Senile deafness is one of the three major senile diseases with hypertension and degenerative arthritis (Cruickshanks et al, 1998). 40% is known to be a disease (Gates et al, 1990), and most of the senile hearing loss are sensory and neural types caused by degenerative changes in auditory hair cells and spiral ganglions. Known as

In general, the inner ear in mammals is known to not regenerate sensory hair cells of already damaged or dead inner ear. Thus hearing impairment due to the death or weakening of sensory hair cells typically causes permanent hearing impairment. In addition, sensory neuronal deafness includes age-related loss (senile deafness), noise exposure, drug exposure (eg antibiotics and anti-cancer treatment), infection, genetic mutations (syndrome and non-syndrome), and autologous It can be caused by a number of factors including immune disease.

Currently, the use of external hearing aids and cochlear implants are being used as treatments for sensorineural hearing loss, both of which have somewhat limited therapeutic potential. In addition, recently, a method for regenerating sensory inner hair cells has been developed. International patent application PCT / US99 / 24829 discloses a method for stimulating regeneration of inner ear cells including sensory hair cells. However, the technique requires a very complex process and a long time, including the introduction of an endogenous cell nucleic acid molecule encoding a transcription factor to stimulate regeneration of the inner ear cell. Therefore, there is a need for a new technology that can effectively regenerate neurons and hair cells to treat hearing loss.

However, there have been no examples of differentiation and proliferation of neurons and hair cells from amnion derived stem cells of placenta for the treatment of hearing loss.

Therefore, the present inventors have been studying how to effectively treat hearing loss through regeneration of hair cells, and by confirming that neurons and hair cells, which are important in the treatment of hearing loss, can be differentiated from amnion derived mesenchymal stem cells of placenta. The invention was completed.

Therefore, an object of the present invention is to differentiate the amnion derived mesenchymal stem cells, including the step of culturing the amnion derived mesenchymal stem cells of the placental tissue in the medium (medium) containing nerve growth factors into neurons and hair cells (hair cells) To provide a way.

In addition, another object of the present invention is to provide a cell therapy composition for the prevention or treatment of deafness comprising neurons and hair cells differentiated from amnion derived mesenchymal stem cells as an active ingredient.

In order to achieve the object of the present invention as described above, the present invention comprises the step of culturing mesenchymal stem cells isolated from the amnion of the collected human placental tissue in a medium (medium) containing nerve growth factor, amnion derived mesenchymal It provides a method for differentiating stem cells into neurons and hair cells.

In one embodiment of the present invention, the neuronal growth factor is a glia-derived neurotprophin factor (GDNF), a brain-derived neutrophin factor (BDNF) and neurotrophin-3 ( Neurotrophin-3: NT-3) may be one or more selected from the group consisting of.

In one embodiment of the present invention, the glioblastoma-derived neurotprophin factor (GDNF), brain-derived neutrophin factor (BDNF) or neurotrophin-3 (Neurotrophin-3: NT-3) may be included in each concentration of 5ng / ml ~ 15ng / ml relative to the total volume of the medium (medium).

In one embodiment of the present invention, the culture may be performed at a temperature of 36 ~ 38 ℃ and 4 ~ 6% carbon dioxide conditions for 5 to 15 days.

In one embodiment of the present invention, the medium is 1 to 3% by weight (v / v) of B-27 supplement (v / v), 1 to 3 mM L-glutamine and penicillin-streptomycin 0.5 based on the total volume of the medium. It may further comprise ~ 2% by weight (v / v).

The present invention also provides a cell therapy composition for the prevention or treatment of hearing loss comprising neurons and hair cells differentiated from the amnion derived mesenchymal stem cells of the human placental tissue collected as an active ingredient.

In one embodiment of the present invention, the neurons and hair cells are derived from amnion-derived mesenchymal stem cells of placental tissue glioblastoma-derived neurotprophin factor (GDNF), brain-derived neutrophin factor: BDNF) and neurotrophin-3 (Neurotrophin-3: NT-3) may be differentiated by culturing in a medium containing one or more nerve growth factors selected from the group consisting of.

In one embodiment of the present invention, the glioblastoma-derived neurotprophin factor (GDNF), brain-derived neutrophin factor (BDNF) or neurotrophin-3 (Neurotrophin-3: NT-3) may be included in each concentration of 5ng / ml ~ 15ng / ml with respect to the total volume of the medium.

Neurons and hair cells differentiated from amniotic membrane-derived mesenchymal stem cells of human placental tissues according to the present invention have an effect that can be used in the field of cell replacement therapy and regenerative medicine for the treatment of hearing loss caused by damage of hair cells. Not only can it be used as a material for the development of new drugs for treatment, it can be widely used in the field of basic research related to the treatment of hearing loss.

Figure 1 shows the results of confirming whether the cells isolated from the amnion of the placenta is mesenchymal stem cells through FACS analysis using specific markers on the cell surface.
Figure 2 shows the picture of observing the shape of the cells under a microscope while culturing the mononuclear cells from the amniotic membrane in accordance with an embodiment of the present invention, the passages.
Figure 3 is then cultured in a culture medium for differentiation of mesenchymal stem cells derived from the amniotic membrane in accordance with an embodiment of the present invention, the neural stem cell markers nestin, NCAM targeting the differentiated neuronal cell precursors that form a sphere , PSA-NCAM and hair cell marker myosin VIIa, neuronal marker NF, betaIII-tubulin, Glial cell markers using GFAP and S100 shows the expression of each marker.
Figure 4 shows the results of performing the double-label immunofluorescence using the markers of myosin VIIA and TRPA1 to determine whether the differentiation into hair cells.
Figure 5 shows the results of performing the double-label immunofluorescence using the markers of neuronal markers MAP2, NF, beta III-tubulin, GFAP and S100 to determine the differentiation of neurons.
Figure 6 shows the results of confirming the differentiation and expression of neurons, hair cells and neuronal cell precursors from the amniotic membrane-derived mesenchymal stem cells by the method according to the present invention by RT-PCR method.

The present invention differentiates the placental amnion derived mesenchymal stem cells into neurons and hair cells, comprising culturing the mesenchymal stem cells derived from the amnion of the placenta in a medium containing nerve growth factors. It is characterized by providing a method to make it.

The placenta is made for the fetus during pregnancy, and has a disc shape of 500g in weight, 15-20cm in diameter, and 2-3cm in thickness. One side of the placenta is in contact with the mother and the other is in contact with the fetus, and the space between the mother's blood contains the nourishment to the fetus. The placenta consists of three layers of amnion, chorion and decidual membrane. The amniotic membrane is a thin, transparent membrane that surrounds the fetus and contains amniotic fluid.

Meanwhile, in the present invention, stem cells were separated from the amnion of the placenta, and the conditions for differentiation of neurons and hair cells were established through culturing in a medium containing a specific growth factor.

In addition, the present inventors use the amnion-derived mesenchymal stem cells of the placenta for the purpose of treating a hearing impairment disease such as deafness to hair cells, which are nerve cells and inner ear sensory cells. Differentiation was attempted, and differentiation conditions were established to separate mesenchymal stem cells from the amnion of placental tissue, and when the mesenchymal stem cells were cultured in a medium containing nerve growth factor, it was confirmed that differentiation was induced into neurons and hair cells. there was.

Therefore, the present invention can provide a method for differentiating amnion-derived mesenchymal stem cells of placental tissue into neurons and hair cells, and more specifically, amnion-derived mesenchymal stem cells of human placental tissue. It can provide a method of differentiating amnion derived mesenchymal stem cells, including the step of culturing in a medium (medium) containing neurons and hair cells (hair cells).

In addition, the method of differentiating amnion derived mesenchymal stem cells according to the present invention into neurons and hair cells (hair cells), first, to separate the amnion from the placenta and to separate the mesenchymal stem cells from the separated amnion, and then the isolated mesenchyme Stem cells can be differentiated into neurons or hair cells by treating nerve growth factors in the culture medium in which the cells grow.

The method for obtaining mesenchymal stem cells from the amniotic membrane may be performed by first separating the amnion from the placental tissue and then obtaining the mesenchymal stem cells from the amniotic membrane. In an embodiment, the amniotic membrane is separated from a human placental tissue sample, washed with Hanks' balanced salt solution to remove blood, subjected to chemical degradation in 0.05% trypsin solution, and then collected with trypsinized solution, followed by EGF (epidermal). Cultured in a medium containing growth factor) to obtain amnion derived mesenchymal stem cell fluid isolated from human placenta. In addition, the obtained mesenchymal stem cells can be passaged repeatedly until the mesenchymal stem cells are sufficiently amplified.

Amniotic membrane-derived mesenchymal stem cells obtained by the above method can be differentiated into neurons or hair cells, respectively, by treating and culturing a nerve growth factor in a culture medium in which cells grow.

The culture medium may be used as long as the medium for animal cell culture used in general, but is not limited thereto, DMEM, alpha-DMEM, Eagle's basal mediu, RPMI 1640 medium, NPBM (Neural progenitor) cell basal medium (SClonetics).

In addition, nerve growth factors used in the present invention to differentiate from amnion-derived mesenchymal stem cells into neurons or hair cells, such as glia cell-derived neurot growth factor (GDNF), brain-derived neurotrophic factor (Brain- One or more selected from the group consisting of derived neutrophin factor (BDNF) and neurotrophin-3 (NT-3) may be used, and each neuronal growth factor is 5ng / ml ~ for the total volume of the culture medium. It may be included at a concentration of 15ng / ml.

In addition, the incubation may be carried out at a temperature of 37 ℃ and 5% carbon dioxide conditions for 5 to 15 days.

In addition, the medium is 1 to 3% by weight (v / v) of B-27 supplement (v / v), 1 to 3mM of L-glutamine, and 0.5 to 2% by weight of penicillin-streptomycin (B-27 supplement). v / v) may be further added.

On the other hand, among the nerve growth factors, brain-derived neutrophin factor (BDNF) is the most abundant distribution of neurotrophin (neurotrophin) in the brain to promote the growth of neurons, neurotransmission It is known to act to modulate the synthesis, metabolism, free and neuronal activity of substances.

In addition, the glia-derived neurotprophin factor (GDNF) and neurotrophin-3 (NT-3) act to promote the growth of glial cells, glial cells and neurons. Known.

Meanwhile, the inventors examined whether the mesenchymal stem cells isolated from the amnion of human placental tissues were differentiated into neurons and hair cells by culturing in a medium containing a specific growth factor according to the method of the present invention described above. It was confirmed that neural cell precursors, neurons and hair cells differentiate well from stem cells, and that the number of differentiated neurons and hair cells increased as the incubation time increased (see FIG. 1).

More specifically, according to an embodiment of the present invention, by inducing the differentiation of neurons and hair cells by culturing amnion-derived mesenchymal stem cells in a medium containing nerve growth factors of GDNF, BDNF and NT-3, the nerve Cells were first stained with Brud5 to identify specific proliferation in order to confirm the differentiation of cells and hair cells, and then GFAP (Glial Fibrillary) as a glial cell marker to identify each distinctly differentiated cell. Acidic protein), S-100 and Myelin basic protein (MBP), beta III-tubulin, neuronal filament (NF) and microtubul-associated protein2 (MAP2) as neural cell markers, and nestin as a neuronal marker Fluorescence immunoassay using double staining was performed using myosin ⅦA and TRPA1 as markers of hair cells. Then, microscopic examination of each of the stained cells revealed that the neural cell precursors differentiated from the amnion-derived mesenchymal stem cells were gradually spherical in shape as they induced differentiation into neural progenitor cells. Cells were found to express the specific markers of neural stem cells, such as nestin (nestin), neural cell adhesion molecule (NCAM), polysalilated neural cell adhesion molecul (PSA-NCAM) (see Figure 3), markers of hair cells Myosin Ⅶ and TRPA were also expressed (see FIG. 4), and neuronal markers NF and ßIII-tubulin and Glial cell markers GFAP and S100 were also expressed (see FIG. 5).

In addition, according to another embodiment of the present invention, after inducing differentiation of neurons and hair cells from the amniotic membrane-derived mesenchymal stem cells in a medium containing nerve growth factors of GDNF, BDNF and NT-3, recognizes each specific cell RT-PCR was performed using primers capable of amplifying genes corresponding to markers to investigate the differentiation and expression levels of neurons and hair cells.

As a result, the genes of nestin (nestin), which is a marker of stem cells, were expressed, and gene expression was also confirmed in the inner ear development markers BMP4 and BMP7, and markers of hair cells, Myosin ⅦA and TRPA1. And neuronal markers ßIII-tubulin, MAP2, S-100 and GFAP genes were also expressed (see Figure 6).

Therefore, the present inventors, through the above results, when the amnion-derived mesenchymal stem cells are cultured in a medium containing a nerve growth factor, that is, a medium containing GDNF, BDNF or NT-3, the nerve from the amnion-derived mesenchymal stem cells It was found that cells and hair cells can be differentiated.

Furthermore, the present inventors induced the differentiation of neuronal cell precursors from amnion derived mesenchymal stem cells. Specifically, differentiation into the neuronal cell precursor was induced by differentiation of amnion-derived mesenchymal stem cells by adding EGF, which is an epithelial growth factor, and bFGF, which is a stromal fibroblast growth factor, to the culture medium.

Epidermal growth factor (EGF), a growth factor used to induce differentiation of neuronal cell precursors from amnion-derived mesenchymal stem cells, is derived from submaxillary glands and brunner's gland. It is known to enhance the differentiation of mesenchymal stem cells and glial cells. In addition, bFGF, a stromal fibroblast growth factor that can be obtained in most of the human body, is known to promote wound healing and cell differentiation.

According to one embodiment of the present invention, 10ng / ml EGF and 20ng / ml bFGF are added to DMEM medium used as a conventional animal cell medium, followed by culturing, and then differentiated neural cell precursors are nested neural markers. Immunofluorescence analysis using nestin) revealed that most of the nestin was expressed and stained. Also, primers capable of amplifying the genes of the neural stem cell markers nestin, BMP4 and BMP7 were obtained. Through RT-PCT experiments used, it was confirmed that all of the marker genes were expressed in differentiated neuronal cell precursors.

Therefore, through the above results, the present inventors were found that when the amnion-derived mesenchymal stem cells are cultured in the medium to which EGF or bFGF is added, they are differentiated into neural cell precursors, whereas GDNF, BDNF or NT-3 are When cultured in the added medium was found to differentiate into neurons and hair cells.

On the other hand, deafness is the most common disease in the world, and in the elderly after 65 years, about 30% suffer from such difficulties in everyday life. When such deafness occurs, peripheral sensory nerve cells, hair cells, are lost due to the blockage of the afferent path, and the auditory nerve cells and cochlear ganglion cells are also lost over time. In order to improve or treat hearing loss, the current method is to wear hearing aids to patients with hearing loss or to help patients through cochlear implant surgery.However, the development of neuronal cells of cochlear ganglion among cochlear implant patients In the case of deterioration or deterioration due to prolonged hearing loss, even if cochlear implantation is performed, there is a limit to the full recovery of hearing.

Therefore, in order to overcome this limitation, the concept of nerve cell therapy for hearing recovery is emerging. Especially, if hair cells, which are peripheral sensory nerve cells that cause hearing loss, can be reproduced, the hearing loss can be treated more fundamentally.

The method of differentiating amnion-derived mesenchymal stem cells according to the present invention into neurons and hair cells has an effect of differentiating and regenerating hair cells, which are auditory sensory cells that cause hearing loss, and thus can prevent or treat hearing loss.

Therefore, the present invention can provide a composition for the prevention or treatment of hearing loss comprising neurons and hair cells differentiated from amnion derived mesenchymal stem cells as an active ingredient.

In addition, the composition of the present invention can be used as a pharmaceutical composition for the prevention or treatment of hearing loss.

In the present invention, the "deafness" refers to a state in which hearing is degraded or lost due to impairment of the hearing organ, and may include both a syndrome and a nonsyndromic form. The syndrome can be further subdivided into three types, namely 1) prenegative hearing loss due to middle and outer ear defects with or without sensory nerve components associated with hearing impairment, and 2) sensory nerve components associated with hearing impairment. Middle-to-near hearing loss with or without middle ear defects, and 3) sensorineural hearing loss due to cochlear or retrocochlear defects. In addition, the non-syndrome refers to hereditary deafness and can be classified into DFN, DFNA and DFNB according to their genetic pattern, which means X chromosome-associated, autosomal dominant and autosomal recessive delivery modalities, respectively.

The composition for the prevention or treatment of hearing loss according to the present invention includes neurons and hair cells differentiated from a pharmaceutically effective amount of amniotic membrane-derived mesenchymal stem cells alone or includes one or more pharmaceutically acceptable carriers, excipients or diluents. can do. The pharmaceutically effective amount in the above means an amount sufficient to prevent, ameliorate and treat hearing loss.

The pharmaceutically effective amount of neurons and hair cells differentiated from amnion derived mesenchymal stem cells according to the present invention is 0.5 to 100 mg / day / kg body weight, preferably 0.5 ~ 5 mg / day / kg body weight. However, the pharmaceutically effective amount may be appropriately changed depending on the degree of symptoms of hearing loss, the age, weight, health condition, sex, route of administration and duration of treatment of the patient.

The pharmaceutical composition according to the present invention may further comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" as used herein refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like, water for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols And may further contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995). The pharmaceutical composition according to the present invention, together with a pharmaceutically acceptable carrier as described above, may be formulated into a suitable form according to a method known in the art. That is, the pharmaceutical composition of the present invention can be prepared in various parenteral or oral administration forms according to known methods, and isotonic aqueous solutions or suspensions are preferred for injection formulations typical of parenteral administration formulations. Injectable formulations may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving in saline or buffer. In addition, formulations for oral administration include, but are not limited to, powders, granules, tablets, pills, and capsules.

Pharmaceutical compositions formulated in such a manner can be administered in a effective amount via several routes, including oral, transdermal, subcutaneous, intravenous or intramuscular. As used herein, the term 'effective amount' refers to an amount exhibiting a prophylactic or therapeutic effect when administered to a patient. The dosage of the pharmaceutical composition according to the present invention may be appropriately selected depending on the route of administration, subject to administration, age, gender weight, individual difference and disease state. Preferably, the pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the degree of disease, preferably 1 to 10,000 g / weight kg / day, more preferably 10 to 1000 mg / weight kg The effective dose of / day may be repeated several times a day. In addition, the composition for the prevention or treatment of hearing loss according to the present invention may be administered in parallel with a known compound having the effect of preventing, improving or treating hearing loss.

Therefore, the present invention can provide a medicament for the prevention and treatment of hearing loss, comprising a composition containing neurons and hair cells differentiated from amnion derived mesenchymal stem cells as an active ingredient.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

< Example  1>

Isolation and Culture of Human Placental Amnion Stem Cells

The following experiments performed in the present invention were performed in accordance with the approval of IRB (Regulation KC08CIMI0344 of Clinical Research Management). Washed with Hanks' balanced salt soultion to remove. Then, to separate stem cells from the amniotic membrane, the amniotic membrane was washed twice with PBS and then chopped. Then 10 ml of 0.25% trypsin EDTA was added and then stirred in a water bath at 37 ° C. and 100 rpm. After 4 hours of stirring, 10 ml of alpa-MEM containing 10% FBS was added to inhibit the enzyme activity. Thereafter, centrifugation was performed while maintaining 4 ° C. at 1200 rpm using a centrifuge. The supernatant was removed, and 10 ml of alpa-MEM containing 10% FBS was added to the pellet and pipetted 20 times. After inserting a 100 μm strainer into a 50 ml tube, the pellet solution was permeated, and the solution permeated to the bottom was centrifuged while maintaining 4 ° C. at 1000 rpm. The obtained cells (ie, mononuclear cells) were dispensed in a 100 mm dish. Incubated.

Then, the cultured cells were cultured in a culture medium containing epidermal growth factor (EGF) for culturing the obtained stem cells, and cells in the culture medium were cultured using trypsin for subculture and differentiation after 2 days of culture. Cell separation was performed again to obtain adult stem cells derived from the amniotic membrane passaged three times.

< Example  2>

Derived from amnion Adult stem cells  Confirm

In order to confirm that the cells derived from placental amnion obtained in Example 1 were adult stem cells, a cell surface maker of stem cells was used. For this purpose, CD34, CD73, CD90, CD14, CD105, CD19 and histocompatibility antigen HLA markers were confirmed by flow cytometry and microscopic observation. First, the cells passaged three times in Example 1 were counted and dispensed into the test tube at 1 × 10 cells / ml, washed three times with washing buffer (0.2% BSA, 0.1% NAN₃, 0.5 mM EDTA), and then fluorescein CD34, CD73, CD90, CD14, CD105, CD19 antibodies conjugated with Isothicyanate (FITC) and Phycoerythrin (PE) were treated for 1 hour, washed three times with wash buffer, and then flow cytometer (FACS Caliber, Becton Dickson, San Diego, Calif.) Equipment.

As a result, in order to confirm that the cells isolated from placental amnion were mesenchymal stem cells, they were identified by attaching specific markers on the cell surface. In contrast, CD73, CD91, and CD105, which are antigens of mesenchymal stem cells, were found to be positive (see FIG. 1). In addition, the HLA surface marker, which is a histocompatibility antigen, was almost 100% negative, indicating that the mesenchymal stem cells derived from the amnion of the placenta have no problem in immunological aspects.

In addition, as a result of observing the cell shape according to the increase in the number of passages in the passage culture of mononuclear cells isolated from the amniotic membrane, as shown in Figure 2, as the number of passages is increased, the shape of the cells becomes longer and fibrous It was confirmed that the cells change in the form (fibroblast like cell).

< Example  3>

Differentiation of stem cells derived from human amnion into neural cell precursors, hair cells, and neurons

The mesenchymal stem cells derived from the amnion isolated and cultured in Example 1 were differentiated into neural cell precursors, hair cells, and neurons in the following manner.

<3-1> Differentiation into Nervous System Cell Precursors

In order to differentiate the amnion-derived mesenchymal stem cells into neural cell precursors, differentiation of the mesenchymal stem cells into the culture medium of the mesenchymal stem cells was induced by differentiation into neural cell precursors. / Ml of EGF (Invitrogen) and 10ng / ㎖ bFGF (basic fibroblast growth factor (Invitrogen)) were treated, incubated for 14 days in a medium containing the above factors, 10ng / ㎖ bFGF at 3 days intervals culture It was added three times to bake. The composition of the medium for differentiation from amnion derived mesenchymal stem cells to neural cell precursors is shown in Table 1 below.

<3-2> Differentiation into Hair Cells and Neurons

In order to differentiate the amnion-derived mesenchymal stem cells into the differentiation of hair cells and neurons, the composition was induced differently from the neuronal cell precursor culture medium used in Example <3-1>. The basal medium was used in the neuronal culture medium (neurobasal medium) used in the art, the neuronal growth factors such as GDNF (glial cell derived neurotrophic factor, Invitrogen), brain-derived neurotrophic factor (BDNF) brain derived neurotrophic factor (Invitrogen) and neurotrophin-3 (NT-3; neurotrophin 3, Invitrogen) were used for the growth of neuronal cells. As shown in Table 1 below.

Neuronal cell precursors and culture medium for differentiation into hair cells and neurons Neural System Precursor Culture Medium
(Total volume: 50) Hair and neuronal cell culture medium
(Total volume: 50) DMEM: F12 (1: 1) Neurobasal medium B-27 supplement 1 B-27 supplement 1 L-Glutamine 2mM L-Glutamine 2mM EGF 10ng / GDNF 10 ng / bFGF 20ng / BDNF 10ng / Penicilin-Streptomycin 1% NT3 10ng / Penicilin-Streptomycin 1%

< Example  4>

Immunofluorescence staining  Expression Analysis of Neuronal Cell Precursors, Hair Cells, and Neurons

Neuronal cell precursors obtained by differentiating mesenchymal stem cells from amnion-derived mesenchymal stem cells according to the method of Example 3 were subjected to immunofluorescence staining on days 7 and 14, respectively, of differentiated cells. Cell precursors, hair cells, and neurons were identified. First, BrdU is labeled on cells for 24 hours using BrdU (5-Bromo-2'-deoxy-uridine Labeling and Detection Kit, Roche, Indianapolis, IN), which is known as a marker for proliferating cells to identify specific proliferation. labeling). At this time, PBS solution containing 3% BSA (Bovine Serum Albumin, Ogilvie ST Essendon, Australia) was used as the washing buffer, and the labeled cells were washed three times. After 4 minutes paraformaldehyde was fixed for 20 minutes, 0.5% Triton X-100 (Promega Corporation, Medison, WI) was treated for 20 minutes at room temperature. Then, the primary antibody anti-BrdU working solution (1:10) was treated for 12 hours or more and washed again three times with PBS containing 3% BSA. Thereafter, the mixture was treated with an anti-mouse-Ig-Fluorescein working solution (1:10) for 1 hour at room temperature. Next, blocking with 5% normal goat serum and GFAP (Glial Fibrillary Acidic Protein, Abcam, Cambridge, UK), S-100 (Abcam) and myelin basic protein (MBP), ßIII-tubulin (Abcam), NF (Neurofilamen, Abcam) and MAP2 (Microtubul-Associated Protein2, Abcam) as markers of neurons, nestin as markers of neuronal species As markers of (Abcam) and hair cells, double staining was performed using myosin) A (Abcam) and TRPA1 (Tahoe Regional Planning Agency, Abcam). At this time, the primary antibodies to double staining were all reacted overnight, washed three times with PBS containing 3% BSA. Alexa 555, a secondary antibody, was treated at room temperature for 1 hour at a ratio of 1: 100, and then expression was confirmed. In addition, the staining of the nucleus was mounted (mounting) with DAPI conjugated mounting medium (Vectashild, Burlingame, CA). Expression was confirmed by each cell using a fluorescent microscope (Olympus, Japan), it was counted by the number of cells expressed per total number of cells, the results are shown in Figs.

As a result, in the case of neural cell precursors, they gradually became spherical in shape as they induced differentiation into neural progenitor cells, and the spherical cells were specific markers of neural stem cells, nestin and neural cell. Adhesion molecule), PSA-NCAM (polysialilated neural cell adhesion molecul) was confirmed that the expression (see Fig. 3), hair cells markers myosin Ⅶ and TRPA was also expressed (see Fig. 4), neurons The cell markers NF and ßIII-tubulin and the Glial cell markers GFAP and S100 were also expressed (see FIG. 5).

Therefore, it can be seen from the above results that the amnion-derived mesenchymal stem cells according to the present invention are well differentiated into neural cell precursors, hair cells, and neurons.

< Example  5>

RT - PCR Expression of Neural System Precursors, Hair Cells and Neurons

In Example 3, cells differentiated into neural cell precursors, hair cells, and neurons through RT-PCR were differentiated over time with respect to neural cell precursors and hair cells and neurons differentiated from amnion-derived mesenchymal stem cells. It was confirmed whether the degree increased. In other words, RNA was extracted from each of cells 10 days after differentiation and subjected to polymerase chain reaction (PCR) through reverse transcription. To this end, first, differentiated and cultured cells were isolated RNA using AXYGEN RNA mini-extraction kit (Axygen Scientific, Inc, Union City, CA), the isolated RNA was prepared using RT premix kit (Intron Biotechnology, Sungnam, Korea) CDNA was synthesized from each RNA by reverse transcription for 60 minutes at 42 ° C and 5 minutes at 95 ° C. The synthesized cDNA was quantified at 100ng, and then GFAP, S100, MAP2, NF, ßIII-tubulin, nestin, BMP4 (Bone Morphology Protein 4), BMP7, myosin ⅦA using RT-PCR premix (Bioneer, Deajeon, Korea) Denature the DNA at 94 ° C for 5 minutes using primers that can amplify the gene of TRPA1, react for 30 seconds at the annealing temperature of each gene, and then synthesize the DNA at 72 ° C for 5 minutes. (polymerization) and extension were performed. The primers used at this time are listed in Table 2 below, and the house keeping gene GAPDH (GlycerAldehyde-3-Phosphate DeHydrogenase) was used as a control in each reaction. Then, the expression of each gene was confirmed by electrophoresis using 2% agarose gel. Since the expressed gene was confirmed amplified DNA using an image analysis system (Bio-Rad, Herculesus, CA).

Primer Sequence and PCR Conditions gene The sequence (5'-3 ') Annealing
Temperature (℃) size
( bp ) SEQ ID NO: GAPDH F ctactggcgctgcaaaggctgt 54 357 One R gccatgaggtccaccaccctgt 2 Nestin F aacaggaccaagagacattg 56 211 3 R tttactgcctctacgctctc 4 S-100 F ctttaaatgcgttcctcatc 51 156 5 R ttctgatggagttgcttttt 6 GFAP F tttctaaaggcctcttcctt 56 192 7 R ctgggtacattttgtgtgtg 8 BMP4 F agtgaaaactctgcttttcg 53 217 9 R ccagtctcgtgtccagtagt 10 BMP7 F caacgtcatcctgaagaaat 50.9 217 11 R atatgctgctcatgttttct 12 ßⅢ-Tubulin F aagttttggagagggaaatc 54.5 188 13 R agggaggtagagttggaaag 14 Myosin a F tacatcgacatccacttcaa 54.5 154 15 R tctgatcctcactcataccc 16 MAP2 F atttatcaggggagagtggt 53 177 17 R cctgatttgtcaccagagat 18 TRPA1 F ctccatctggcagcaaagaa 56.5 210 19 R tgcagtgttcccgtcttcat 20 NF F caaagaagaggggaagccac 55 258 21 R tttcatctgctgggctcaag 22

As a result, the genes of nestin (nestin), which is a marker of stem cells, were expressed, and gene expression was also confirmed in the inner ear development markers BMP4 and BMP7, and markers of hair cells, Myosin ⅦA and TRPA1. And neuronal markers ßIII-tubulin, MAP2, S-100 and GFAP genes were also expressed (see Figure 6).

Therefore, the present inventors have found that neural cell precursors, hair cells, and neurons are well differentiated from the amnion-derived mesenchymal stem cells, and that the degree of differentiation increases with time.

So far I looked at the center of the preferred embodiment for the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Catholic University <120> Method of inducing differentiation of mesenchymal stem cell          derived from amnion isolated from human term placenta into neuron          and hair cell <130> np11-1180 <160> 22 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-F <400> 1 ctactggcgc tgcaaaggct gt 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-R <400> 2 gccatgaggt ccaccaccct gt 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NESTIN-F <400> 3 aacaggacca agagacattg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NESTIN-R <400> 4 tttactgcct ctacgctctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S100-F <400> 5 ctttaaatgc gttcctcatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S100-R <400> 6 ttctgatgga gttgcttttt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GFAP-F <400> 7 tttctaaagg cctcttcctt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GFAP-R <400> 8 ctgggtacat tttgtgtgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP4-F <400> 9 agtgaaaact ctgcttttcg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP4-R <400> 10 ccagtctcgt gtccagtagt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP7-F <400> 11 caacgtcatc ctgaagaaat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP7-R <400> 12 atatgctgct catgttttct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> betaIII tubulin-F <400> 13 aagttttgga gagggaaatc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> betaIII-tubulin-R <400> 14 agggaggtag agttggaaag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myosin VIIA-F <400> 15 tacatcgaca tccacttcaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myosinVIIA-R <400> 16 tctgatcctc actcataccc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAP2-F <400> 17 atttatcagg ggagagtggt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAP2-R <400> 18 cctgatttgt caccagagat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRPA1-F <400> 19 ctccatctgg cagcaaagaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRPA1-R <400> 20 tgcagtgttc ccgtcttcat 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NF-F <400> 21 caaagaagag gggaagccac 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NF-R <400> 22 tttcatctgc tgggctcaag 20

Claims (8)

A method of differentiating amnion derived mesenchymal stem cells into neurons and hair cells, comprising culturing the mesenchymal stem cells isolated from the amniotic membrane of human placental tissue in a medium containing nerve growth factors. The method of claim 1,
The neuronal growth factors include GDNF, brain-derived neutrophin factor (BDNF), and neurotrophin-3 (NT-3) as a neuron-derived neurotprophin factor (GDNF). A method for differentiating amnion derived mesenchymal stem cells into neurons and hair cells, characterized in that at least one selected from the group consisting of. The method of claim 2,
The glia cell-derived neurotprophin factor (GDNF), brain-derived neutrophin factor (BDNF) or neurotrophin-3 (Neurotrophin-3: NT-3) is a medium (medium) A method for differentiating amnion-derived mesenchymal stem cells into neurons and hair cells, wherein the amnion derived mesenchymal stem cells are each contained at a concentration of 5 ng / ml to 15 ng / ml relative to the total volume. The method of claim 1,
The culture is a method of differentiating amnion derived mesenchymal stem cells into neurons and hair cells (hair cells), characterized in that carried out at a temperature of 36 ~ 38 ℃ and 4 ~ 6% carbon dioxide conditions for 5 to 15 days. The method of claim 1,
The medium contains 1-3 wt% (v / v) of B-27 supplement, 1-3 mM of L-glutamine and 0.5-2 wt% (v / v) of penicillin-streptomycin based on the total volume of the medium. A method of differentiating amnion derived mesenchymal stem cells into neurons and hair cells, characterized in that it further comprises hair cells. Cell therapy composition for the prevention or treatment of hearing loss comprising neurons and hair cells differentiated from amnion derived mesenchymal stem cells of human placental tissue as an active ingredient. The method according to claim 6,
The neurons and hair cells are derived from the amnion-derived mesenchymal stem cells of the placenta, and are derived from glioblastoma-derived neurotprophin factor (GDNF), brain-derived neutrophin factor (BDNF), and neurotropin-3. (Neurotrophin-3: NT-3) Cell therapy composition for the prevention or treatment of hearing loss, characterized in that differentiated by culturing in a medium containing one or more nerve growth factors selected from the group consisting of. The method of claim 7, wherein
The glia cell-derived neurotprophin factor (GDNF), brain-derived neutrophin factor (BDNF) or neurotrophin-3 (Neurotrophin-3: NT-3) is the total volume of the medium. Cell therapy composition for the prevention or treatment of hearing loss, characterized in that it comprises a concentration of 5ng / ml ~ 15ng / ml for each.

Images