KR20230125971A - Specific primer set for detecting Xanthomonas cucurbitae and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for specifically detecting Xanthomonas cucurbitae and its use, since the primer set of the present invention can quickly and accurately detect Xanthomonas cucurbitae, a quarantine bacterium, It will be able to effectively prevent the introduction of Xanthomonas cucurbitae into the country.

Description

Primer set for detecting Xanthomonas cucurbitae specifically and uses thereof {Specific primer set for detecting Xanthomonas cucurbitae and uses thereof}

The present invention relates to a primer set for specifically detecting Xanthomonas cucurbita and its use.

Plant quarantine is to prevent pests that have entered or settled in a certain area from spreading to other areas, inspection of target plants, prohibition or restriction of movement, and disinfection of plants with pathogens and pests (spraying chemicals, fumigation, submersion, etc.) It refers to taking measures such as disposal (incineration, crushing, landfill, etc.). Just as each country on the planet has its own unique animals and plants, the distribution of pests and diseases varies from region to region. The reason why pests live only in certain areas is because the climate and environment of the new settlement area are not suitable for survival, but most pests are difficult to move on their own even if there are many other areas that are good to live.

The movement of pests is generally carried out by burrowing or burying in host plants and their products, moving by burying themselves in packaging materials, containers, and transportation means such as aircraft, ships, and automobiles, and by self-dispersion and There are cases where they are burrowed in or buried in the body of a vector insect or bird, or moved by wind, water, or air currents.

However, in recent years, with the rapid increase in international trade due to the development of means of transportation and industry, and the frequent travel of travelers, many types of pests and diseases are rapidly moving far away due to artificial factors. There are many cases in which new pests, once invaded from abroad, cause greater damage than in the country of origin when the climatic and environmental conditions are suitable and the host plants are abundant. Therefore, in order to achieve stabilization of agricultural and forestry production by preventing national disasters that may occur when new pests and diseases are introduced, and to protect the ecosystem to beautify nature and make human life comfortable, various diseases and pests The need for plant quarantine is becoming more important. The fundamental reason why countries around the world are gradually strengthening plant quarantine as a policy at the government level is that the cost and inconvenience required to prevent the invasion of new pests is higher than the cost and damages spent to control the invading pests. Because it is very economical.

Xanthomonas cucurbitae is a seed-borne pathogen that causes bacterial leaf spots in Cucurbitaceae plants. Infection with Xanthomonas cucurbita can cause yellowish brown and dark brown, small, sunken circular spots on fruits, and if Xanthomonas cucurbita penetrates the flesh, it can cause severe fruit decay during cultivation or storage.

On the other hand, Korean Patent Publication No. 2015-0005877 Santo Monas Campestris Campestris ( X. campestris pv. campestris ) and Santo Monas cucurbita ( X. cucurbitae ) through a base difference, from the genus Santo Monas (Xanthomonas) 'Santhomonas cucurbita identification method' is disclosed, but the 'primer set for specifically detecting Xanthomonas cucurbita and its use' based on the Acyltransferase family protein gene of Xanthomonas cucurbita of the present invention has been described. does not exist.

The present invention has been derived from the above needs, and the present inventors have prepared primers based on the nucleotide sequence of the Acyltransferase family protein gene of Xanthomonas cucurbitae , and the prepared primer set reacts to similar strains The present invention was completed by confirming that it was possible to specifically detect Pseudomonas cucurbita, without doing so.

In order to solve the above object, the present invention provides a primer set for specifically detecting Xanthomonas cucurbitae , including the oligonucleotide primer set of SEQ ID NOs: 9 and 10.

In addition, the present invention is the oligonucleotide primer set; And it provides a kit for specifically detecting Xanthomonas cucurbitae, including a reagent for performing an amplification reaction.

In addition, the present invention comprises the steps of isolating genomic DNA from plant samples; Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the oligonucleotide primer set according to the present invention; And detecting the product of the amplification step; it provides a method for specifically detecting Pseudomonas cucurbita, including.

Since the primer set of the present invention can quickly and accurately detect X. cucurbitae , a quarantine bacterium, it will be able to effectively prevent the introduction of X. cucurbitae into Korea.

Figure 1 shows the position of candidate primers for detecting Xanthomonas cucurbitae ( Xanthomonas cucurbitae ) Acyltransferase family protein sequence alignment results and Xanthomonas cucurbitae.
Figure 2 shows the verification results of six candidate primer sets using samples of a Xanthomonas cucurbita strain (lane 1; positive control) and similar strains (lanes 2 to 22; Table 3). N: Negative control.
Figure 3 is a candidate primer set no. This is the verification result of 5. N: Negative control.
Figure 4 is a candidate primer set no. This is the verification result of 5. N: Negative control.
5 is a candidate primer set no. through an end-point test. 5 is the detection limit analysis result. N: Negative control.

In order to achieve the object of the present invention, the present invention provides a primer set for specifically detecting Xanthomonas cucurbitae , including the oligonucleotide primer set of SEQ ID NOs: 9 and 10.

In the primer set of the present invention, the oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; And oligonucleotide primer sets of SEQ ID NOs: 5 and 6; may further include one or more oligonucleotide primer sets selected from the group consisting of.

According to the sequence length of each primer, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more in the sequence of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 9 and 10 oligonucleotides consisting of segments of contiguous nucleotides. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may include oligonucleotides consisting of segments of at least 16, at least 17, at least 18, at least 19 contiguous nucleotides within the sequence of SEQ ID NO: 1 . In addition, the primers may also include added, deleted or substituted sequences of the nucleotide sequences of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 9 and 10.

The oligonucleotide primers of SEQ ID NOs: 1, 3, 5, and 9 of the present invention are forward primers, and the oligonucleotide primers of SEQ ID NOs: 2, 4, 6, and 10 are reverse primers.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow for the synthesis of extension products to begin. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use of the primer, such as temperature and ionic strength.

In this specification, oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioates, alkylphosphorothioates, or peptide nucleic acids, or an intercalating agent.

The present invention also provides the oligonucleotide primer set; And it provides a kit for specifically detecting Xanthomonas cucurbitae, including a reagent for performing an amplification reaction.

In the kit of the present invention, reagents for performing the amplification reaction may include DNA polymerase, dNTPs, and buffers, but are not limited thereto.

The kit for specifically detecting Xanthomonas cucurbita of the present invention may further include a user guide describing optimal reaction conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also

isolating genomic DNA from the plant sample;

Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the oligonucleotide primer set according to the present invention; and

Detecting the product of the amplification step; provides a method for specifically detecting Pseudomonas cucurbita, including.

The method of the present invention includes isolating genomic DNA from a plant sample. A method known in the art may be used as a method for isolating genomic DNA from the sample, and for example, a CTAB method or a Wizard prep kit (Promega) may be used. A target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set according to an embodiment of the present invention. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method according to an embodiment of the present invention, the plant sample may be, but is not limited to, leaves, seedlings, stems, fruit trees or seeds of plants, and the plants may preferably be Cucurbitaceae plants, Most preferably, it may be pumpkin (pumpkin, squash), gourd, cucumber, watermelon, melon, etc., but there is no restriction on the type of plant as long as it is a plant that can be infected with Xanthomonas cucurbita.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling material may be a material that emits fluorescence, phosphorescence or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence can be labeled with a detectable fluorescent labeling material. In addition, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution during PCR, radioactive is incorporated into the amplification product as the amplification product is synthesized, and the amplification product can be radioactively labeled.

In one embodiment of the present invention, the method for specifically detecting the Xanthomonas cucurbita includes detecting the amplification product, and the detection of the amplification product is DNA chip, gel electrophoresis, capillary electrophoresis , but may be performed through radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. For capillary electrophoresis, for example, an ABi Sequencer can be used. In addition, gel electrophoresis can be performed, and for gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method is performed by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product, and then using a radioactivity measurement instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Primer set design for detecting Xanthomonas cucurbita

After downloading the genome sequence of the genus strain Xanthomonas from RefSeq (NCBI Reference Sequence Database), the genome sequence of Xanthomonas cucurbitae ATCC 23378 (Accession No. NZ_CP033326.1; Assembly. GCF_009883735.1) By comparison, 319 candidate genes with a size of 500 bp containing gene regions specific to Xanthomonas cucurbita were obtained, and among the candidate genes, the nucleotide sequence of the gene is a region with gene ID information, excluding the corresponding strain Two candidate genes having specificity to other strains of the genus Xanthomonas were selected. It was confirmed that the above two genes were both acyltransferase family protein genes, and a candidate primer set for specific detection of Xanthomonas cucurbita was prepared by targeting the acyltransferase family protein gene (Table 1 and FIG. 1).

Acyltransferase family protein of Xanthomonas cucurbitae The gene is located at 1,518,099 to 1,520,207 bp of NCBI Reference Sequence NZ_CP033326.1.

A set of candidate primers for the detection of Xanthomonas cucurbita No. Name Sequence (5'→3') (SEQ ID NO) Mer GC% Tm Product size (bp) One XC-F1 CAGCCCTATACCTCGCTCAG (1) 20 60 59.9 231 XC-R1 CAGCATTTCGCTGTAGGACA (2) 20 50 60.1 2 XC-F2 ATCAGGCCCTGGTATTGTTG (3) 20 50 59.8 231 XC-R2 CTATCGGGTTATCCGCTTGA (4) 20 50 60.1 3 XC-F3 GGTGATGTGCTGTTCCTTCC (5) 20 55 58.8 385 XC-R3 ATAGCAGCGGTAGTGGATCC (6) 20 55 59.0 4 XC-F4 TCCGGGTGATTGGTATGCAT (7) 20 50 59.2 366 XC-R4 GGAAGGAACAGCACATCACC (8) 20 55 58.8 5 XC-F5 TCCTCGCGGTGATTGTGTAT (9) 20 50 59.2 374 XC-R5 CGACCAGGTTTGCGTGTATT (10) 20 50 58.9 6 XC-F6 GTGATTTCCGGGTTTTGTCGT (11) 20 50 58.8 351 XC-R6 GCACAGAAACATCCACGGAA (12) 20 50 58.8

Example 2. Verification of primer sets for detecting Xanthomonas cucurbita

PCR was performed to verify the 6 candidate primer sets prepared in Example 1 above. Total DNA samples were extracted using the DNeasy Plant Mini kit (Qiagen, Germany), and PCR was performed using RT-PCR Premix (PLUTOS, Korea; hereinafter company P) or GoTaq ^® Master Mixes RTPCR Premix (Promega, Korea; hereinafter company G) was performed according to the manufacturer's method. PCR conditions are shown in Table 2 below.

PCR conditions pre-denaturation denaturation annealing extension cycle final-extension 95℃, 3min 95℃, 30sec 60℃, 30sec 72℃, 1min 35 72℃, 5min

2-1. Confirmation of Xanthomonas cucurbita species specificity

Verification of candidate primers was performed using the Xanthomonas cucurbita strain and the similar strains in Table 3. As a result of PCR using the PCR premix of P Company under the conditions of Table 2, primer set no. Bands of the expected size were strongly expressed in 1, 2, 3 and 5, but primer set no. In 4 and 6, it was confirmed that bands of different sizes as well as bands of the expected size were strongly expressed (FIG. 2). Through this, the primer set no. 1, 2, 3 and 5 were finally selected as primer sets capable of specifically detecting Xanthomonas cucurbita.

List of similar strains No. Strain strain number One Xanthomonas cucurbitae ATCC 23398 2 Xanthomonas campestris KCTC 2862 3 Xanthmonas arboricloa pv. corylina KACC 19313 4 Xanthomonas campestris pv. malvacearum KACC 12874 5 Xanthomonas campestris pv. armoraciae KACC 12960 6 Xanthomonas campestris pv. dieffenbachiae KACC 10460 7 Xanthomonas campestris pv. glycinae KACC 10481 8 Xanthomonas campestris pv. poinsettiicola KACC 12894 9 Xanthomonas axonopodis pv. glycines KACC 11147 10 Xanthomonas axonopodis pv. phaseoli KACC 12966 11 Xanthomonas oryzae pv. oryzae KACC 10331 12 Xanthomonas campestris pv. campestris KCTC 22159/ATCC 33913 13 Xanthomonas hortorum pv. carotae In-house strains (national pests) 14 Pseudomonas syringae pv. pisi KACC 11620 15 Pseudomonas syringae pv. tomato LMG 5509 16 Pseudomonas syringae pv. maculicola CBNU 1558 17 Pseudomonas putida KCTC 1639 18 Pseudomonas reactams ATCC 14340 19 Pseudomonas savatanoi pv. phaseolocola KACC 10447 20 Pseudomonas sesamicola KCTC 22519 21 Pseudomonas stutzeri KCTC 1066 22 Pseudomonas viridiflava LMG 2353

Additionally, primer set no. As a result of performing PCR on the Xanthomonas cucurbita strain, saprophyte and similar strains (Table 4 and Table 5) using 5, a band of the expected size was strongly expressed only in the Xanthomonas cucurbita sample. It was confirmed that it was (FIGS. 3 and 4).

List of similar strains No. Strain strain number One Xanthomonas cucurbitae ATCC 23398 2 Xanthomonas axonopodispv.citri KCTC 2856 3 Xanthomonas axonopodispv. begoniae APQA 4 Xanthomonas hortorum pv. carotae NWB SC244 5 Xanthomonas campestris pv. campestris KACC 10913 6 Pseudomonas agarici APQA 7 Xanthomonas arboricola NWB SC208 8 Xanthomonas euvesicatoria LMG 667 9 Xanthomonas vesicatoria KACC 12961 10 Xanthomonas perforans KACC 16356 11 Pseudomonas syringae pv. syringae NWB SC127 12 Pseudomonas syringae pv. tomato Y1 13 Acidovorax citrulli NWB SC107 14 Acidovorax avenae NWB SC018 15 Acidovorax konjaci KACC 10652 16 Pseudomonas viridiflava LMG 2353 17 Pseudomonas putida NWB SC213 18 Xanthomonas hortorum pv. pelargonii APQA 19 Xanthomonas pisi APQA

List of saprophytes and similar strains No. Strain strain number One Xanthomonas cucurbitae ATCC 23398 2 Curtobacterium pusillum APQA 3 Curtobacterium citreum APQA 4 Agrobacterium larrymoorei APQA 5 Stenotrophomonas maltophilia APQA 6 Microbacterium testaceum APQA 7 Agrobacterium sp. APQA 8 Chryseobacterium profundimaris APQA 9 Acidovorax oryzae APQA 10 Pantoea ananatis APQA 11 Pseudomonas putida APQA 12 Xanthomonas saccari APQA 13 Stenotrophomonas maltophilia APQA 14 Enterobacter cloacae APQA 15 Cronobacter dublinensis APQA 16 Kosakonia sp. APQA 17 Bacillus marisflavi APQA 18 Pseudomonas sp. APQA

2-2. Detection limit analysis of primer sets through end-point testing

Final selected primer set no. No. 1, 2, 3 and 5. To confirm the detection limit of 5, the total DNA template ^was divided into 10 (lane 1), 1, 10 ^-1 , 10 ^-2 , 10 ^-3 , 10 ^-4 , 10 -5 , 10 ^-6 , 10 ^-7 , 10 Sensitivity analysis was performed using G's PCR premix at different concentrations of ^-8 ng (lane 10).

As a result, primer set no. 5 was confirmed to be detectable up to a DNA concentration of 10 ^-1 ng (FIG. 5). Through this, the primer set no. It was found that 5 is a marker with excellent sensitivity to Xanthomonas cucurbita.

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Specific primer set for detecting Xanthomonas cucurbitae and uses its <130> PN21485 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 1 cagccctata cctcgctcag 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 cagcatttcg ctgtaggaca 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 atcaggccct ggtattgttg 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 ctatcgggtt atccgcttga 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 ggtgatgtgc tgttccttcc 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 atagcagcgg tagtggatcc 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 7 tccgggtgat tggtatgcat 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 8 ggaaggaaca gcacatcacc 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 9 tcctcgcggt gattgtgtat 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 10 cgaccaggtt tgcgtgtatt 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 11 gtgatttccg ggtttgtcgt 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 12 gcacagaaac atccacggaa 20

Claims (6)

A primer set for specifically detecting Xanthomonas cucurbitae , comprising the oligonucleotide primer sets of SEQ ID NOs: 9 and 10. According to claim 1, wherein the oligonucleotide primer set of SEQ ID NO: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; And an oligonucleotide primer set of SEQ ID NOs: 5 and 6; a primer set for specifically detecting Xanthomonas cucurbite, further comprising one or more oligonucleotide primer sets selected from the group consisting of. The oligonucleotide primer set of claim 1 or claim 2; And a kit for specifically detecting Xanthomonas cucurbitae , comprising reagents for performing an amplification reaction. The kit according to claim 3, wherein reagents for performing the amplification reaction include DNA polymerase, dTNPs, and a buffer. isolating genomic DNA from the plant sample;
Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the oligonucleotide primer set of claim 1 or claim 2; and
Detecting the product of the amplification step; including, Xanthomonas cucurbitae ( Xanthomonas cucurbitae ) A method for specifically detecting. The method of claim 5, wherein the detection of the amplification product is performed through a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.