KR102615992B1 - Specific primer set for detecting Xanthomonas arboricola pv. corylina and uses thereof - Google Patents

Abstract

The present invention relates to Xanthomonas arboricola pv. Corylina ( Because Corilina can be detected quickly and accurately, Xanthomonas arboricola pv. It will be possible to effectively prevent the introduction of Corilina into the country.

Description

Xanthomonas arboricola pv. Primer set for specifically detecting Corilina and use thereof {Specific primer set for detecting Xanthomonas arboricola pv. corylina and uses thereof}

The present invention relates to a primer set for specifically detecting Xanthomonas arboricola and its use.

Plant quarantine involves inspection of target plants, prohibition or restriction of movement, and disinfection of plants attached to germs and pests (chemical spraying, fumigation, submersion, etc.) in order to prevent pests that have entered or settled in a certain area from spreading to other areas. ·This refers to taking measures such as disposal (incineration, crushing, landfill, etc.). Just as each country on Earth has its own unique animals and plants, the distribution of pests and diseases also differs depending on the region. The reason pests only live in certain areas is because the climate and environment of the new area they are settling in is not suitable for survival, but it is also because most pests have difficulty moving on their own even if there are many other good areas to live in.

The movement of pests is generally carried out by lurking or being buried in host plants and their products, by being buried in packaging materials, containers, and means of transportation such as aircraft, ships, and automobiles, and by self-dispersal. There are cases where it lurks in the body of vector insects or birds, or when it moves by being buried in the body, or when it moves by wind, water, air currents, etc.

However, recently, with the development of transportation and industry, the volume of international trade has increased rapidly and the coming and going of travelers has become more frequent, and many types of pests and diseases are being quickly transported over long distances by artificial factors. There are many examples of new pests that invade from foreign countries causing greater damage than in their country of origin when the climate and environmental conditions are suitable and host plants are abundant. Therefore, in order to stabilize agricultural and forestry production by preventing national disasters that may occur when new pests and diseases are introduced, and to protect the ecosystem to make nature beautiful and human life comfortable, various pests and diseases are prevented. The need for plant quarantine is becoming important. The fundamental reason why countries around the world are gradually strengthening plant quarantine at the government level is that the cost and inconvenience required to prevent the invasion of new pests is compared to the cost and damage incurred to control the invaded pests. Because it is very economical.

Xanthomonas arboricola is a host-specific pathogen, pv. Corylina ( corylina ), pv. juglandis , pv. Poinsetticola ( poinsettiicola ) , pv. populi and pv. It is classified as pruni , and among these, Xanthomonas arboricola pv. Xanthomonas campestris pv. corylina causes bacterial blight of hazelnuts ( Corylus heterophylla Fisch. Ex Trautv). Xanthomonas arboricola pv. When infected by Corilina, symptoms may appear on the seeds or leaves of hazelnuts. The leaves may show yellow-green to dark green lesions or chlorosis on the thin layer of the leaves, and immature leaves and fruits may show premature growth. may fall on

Meanwhile, Korean Patent Publication No. 2012-0053792 discloses 'a pair of PCR primers for detecting microorganisms of the genus Xanthomonas and a method of detecting microorganisms of the genus Xanthomonas using the same', and Korean Patent No. 1490614 discloses 'Xanthomonas arboricola juglan'. A primer set for detecting Dys and a method for detecting Xanthomonas arboricola juglandis using the same are disclosed, but the Xanthomonas arboricola pv. There has been no description of primer sets and their uses for specifically detecting Corilina.

The present invention has been derived from the above-mentioned needs, and the present inventors have developed Xanthomonas arboricola pv. Primers were prepared based on the base sequence of the Fic family protein gene of Xanthomonas arboricola pv. corylina , and the prepared primer set did not react with similar strains and did not react with similar strains of Xanthomonas arboricola pv. The present invention was completed by confirming that Corilina can be specifically detected.

In order to solve the above problem, the present invention provides a method for producing a oligonucleotide primer set of SEQ ID NOs: 7 and 2, including Xanthomonas arboricola pv. A primer set for specifically detecting Corylina ( X. arboricola pv. corylina ) is provided.

In addition, the present invention provides the oligonucleotide primer set; and a reagent for performing an amplification reaction. A kit for specifically detecting Corilina is provided.

Additionally, the present invention includes the steps of isolating genomic DNA from a plant sample; Using the isolated genomic DNA as a template, performing an amplification reaction using the oligonucleotide primer set according to the present invention to amplify the target sequence; And detecting the product of the amplification step; Xanthomonas arboricola pv. A method for specifically detecting Corilina is provided.

The primer set of the present invention is a quarantine bacterium, Xanthomonas arboricola pv. Because Corylina ( X. arboricola pv. corylina ) can be detected quickly and accurately, X. arboricola pv. It will be possible to effectively prevent the introduction of Corilina into the country.

Figure 1 shows Xanthomonas arboricola pv. Corylina ( Xanthomonas arboricola pv. corylina ) sequence alignment results and Xanthomonas arboricola pv. The positions of candidate primers for Corilina detection are shown.
Figure 2 shows Xanthomonas arboricola pv. This is the verification result of 7 candidate primer sets using samples of Corilina strain (lane 1; positive control) and similar strains (lanes 2 to 22; Table 4). N: Negative control group.
Figure 3 shows Xanthomonas arboricola pv. Candidate primer set no. 1 using Corilina strain (lane 1) and similar strain (lanes 2 to 22; Table 4) samples. This is the verification result of 6. N: Negative control group.
Figure 4 shows Xanthomonas arboricola pv. Candidate primer set no. 1 using samples of Corilina strain (lane 1) and saprophyte and similar strains (lanes 2 to 18; Table 5). This is the verification result of 6. N: Negative control group.
Figure 5 shows Xanthomonas arboricola pv. The candidate primer set no. This is the verification result of 6. Lane 2: pv. pruni , lane 3: pv. Poinsetticola ( poinsettiicola ) , lane 4: pv. juglandis , lane 5. pv. Populi ( populi ). N: Negative control group.
Figure 6 shows candidate primer set no. This is the verification result of 6. P: positive control, lanes 1 to 6: Xanthomonas arboricola pv. Sample of hazelnut leaves infected with Corilina strain, N: negative control.
Figure 7 shows candidate primer set no. through end-point testing. This is the detection limit analysis result of 6. N: Negative control group.

In order to achieve the object of the present invention, the present invention is Xanthomonas arboricola pv. A primer set for specifically detecting Corylina ( X. arboricola pv. corylina ) is provided.

The primer may include an oligonucleotide consisting of a segment of 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive nucleotides in the sequences of SEQ ID NOs. 2 and 7, depending on the sequence length of each primer. there is. For example, the primer (20 oligonucleotides) of SEQ ID NO: 2 may include an oligonucleotide consisting of a segment of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides within the sequence of SEQ ID NO: 2. . In addition, the primer may also include sequences in which the base sequences of SEQ ID NOs: 2 and 7 are added, deleted, or substituted.

The oligonucleotide primer of SEQ ID NO: 7 of the present invention is a forward primer, and the oligonucleotide primer of SEQ ID NO: 2 is a reverse primer.

In the present invention, “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow for initiation of synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target desired as well as the conditions under which the primer is used, such as temperature and ionic strength.

In the present specification, oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids, Alternatively, it may include an intercalating agent.

The present invention also provides the oligonucleotide primer set; and Xanthomonas arboricola pv containing reagents for performing an amplification reaction. A kit for specifically detecting Corilina is provided.

In the kit of the present invention, reagents for performing the amplification reaction may include, but are not limited to, DNA polymerase, dNTPs, and buffer.

Xanthomonas arboricola pv of the present invention. A kit for specifically detecting Corilina may also further include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare PCR buffer, and the suggested reaction conditions. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

isolating genomic DNA from a plant sample;

Using the isolated genomic DNA as a template, performing an amplification reaction using the oligonucleotide primer set according to the present invention to amplify the target sequence; and

Detecting the product of the amplification step; Xanthomonas arboricola pv. A method for specifically detecting Corilina is provided.

The method of the present invention includes isolating genomic DNA from a plant sample. Methods for isolating genomic DNA from the sample can be methods known in the art. For example, the CTAB method can be used, or the Wizard prep kit (Promega) can be used. The target sequence can be amplified by using the isolated genomic DNA as a template and performing an amplification reaction using a primer set according to an embodiment of the present invention. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There are strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using polymerase. These PCR methods are well known in the art, and commercially available kits can also be used.

In the method according to one embodiment of the present invention, the plant sample may be a leaf, seedling, stem, fruit tree, or seed of a plant, but is not limited thereto, and the plant may preferably be a hazelnut, but Xanthomonas arboricola pv . There is no limit to the types of plants that can be infected with Corilina.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable label. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying a target sequence, if the 5'-end of the primer is labeled with Cy-5 or Cy-3 and PCR is performed, the target sequence can be labeled with a detectable fluorescent labeling substance. In addition, labeling using a radioactive material may cause radioactivity to be incorporated into the amplification product as the amplification product is synthesized by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution during PCR, thereby causing the amplification product to be radioactively labeled.

In one embodiment of the present invention, the Xanthomonas arboricola pv. A method for specifically detecting Corilina includes the step of detecting the amplification product, and the detection of the amplification product may be performed using a DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement. may, but is not limited to this. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can be performed using, for example, the ABi Sequencer. Additionally, gel electrophoresis can be performed, and gel electrophoresis can use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, the fluorescence measurement method is to perform PCR by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorometer. can do. In addition, the radioactivity measurement method involves adding a radioisotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then using a radioactivity measurement device, such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Xanthomonas arboricola pv. Design of a primer set to detect Corilina

After downloading the genome sequence of the Xanthomonas genus strain from RefSeq (NCBI Reference Sequence Database), Xanthomonas arboricola pv. Compared to the genome sequence of X. arboricola pv. corylina NCCB 100457 (Accession No. GCF_000355635.2), Xanthomonas arboricola pv. We secured 128 candidate genes with a size of 500 bp that are specific to Corilina and include a gene region. Among the candidate genes, the nucleotide sequence of the gene is a region with gene ID information, and it can be used in other Xanthomonas genera excluding the strain. Two candidate genes with strain specificity were selected. It was confirmed that both of the above two genes were Fic family protein genes, and by targeting the Fic family protein gene, Xanthomonas arboricola pv. A set of candidate primers for specific detection of Corrillina was created (Table 1 and Figure 1).

Xanthomonas arboricola pv. The Corilina Fic family protein genes are 2,460~2,921 bp in NZ_MDEA01000073.1, 630~1,091 bp in NZ_APMC02000251.1, 726~1,187 bp in NZ_MDSJ01000034.1, and 2,076,162~2 in NZ_CP062164.1. It is located at ,076,567 bp.

Xanthomonas arboricola pv. Candidate primer set for detection of Corilina No. Name Sequence(5'→3') (SEQ ID NO) Mer GC% Tm Product size(bp) One XAC-F1 CCTAGACGTCTCTTCCATTGC (1) 20 55 55.3 167 XAC-R1 AAGGCTGCTCGGATTCATA (2) 20 45 54 2 XAC-F2 CAGAAAAGCAGGGCCATAAC (3) 20 50 54.1 155 XAC-R2 GCAATGGAAGGACGTCTAGG (4) 20 55 55.3 3 XAC-F3 CTTCACCACCCCCTATCTCC (5) 20 60 56.8 210 XAC-R1 AAGGCTGCTCGGATTCATA (2) 20 45 54 4 XAC-F4 AGCAGGGCCATAACTTCTTG (6) 20 50 59.34 296 XAC-R1 AAGGCTGCTCGGATTCATA (2) 20 45 59.81 5 XAC-F2 CAGAAAAGCAGGGCCATAAC (3) 20 50 59.71 301 XAC-R1 AAGGCTGCTCGGATTCATA (2) 20 50 59.43 6 XAC-F6 ATTGCCTCGCAACTATCTCC (7) 20 50 59.30 388 XAC-R1 AAGGCTGCTCGGATTCATA (2) 20 45 59.81 7 XAC-F3 CTTCACCACCCCCTATCTCC (5) 20 60 60.70 210 XAC-R1 AAGGCTGCTCGGATTCATA (2) 20 45 59.81

Example 2. Xanthomonas arboricola pv. Validation of primer sets for detecting Corilina

PCR was performed to verify the seven candidate primer sets produced in Example 1. Total DNA samples were extracted using the DNeasy Plant Mini kit (Qiagen, Germany), and PCR was performed using RT-PCR Premix (PLUTOS, Korea; hereinafter referred to as P) and AccuPower RT-PCR PreMix & Master Mix (Bioneer, Korea; hereinafter referred to as B). Company), GoTaq ^® Master Mixes RTPCR Premix (Promega, Korea; hereinafter referred to as G Company) was used according to the manufacturer's method. PCR conditions are shown in Tables 2 and 3 below.

PCR conditions pre-denaturation denaturation annealing extension cycle final-extension 95℃, 3min 95℃, 30 seconds 60℃, 30 seconds 72°C, 1 min 35 72℃, 5min

Change PCR conditions pre-denaturation denaturation annealing extension cycle final-extension 95℃, 3min 95℃, 30 seconds 60℃, 30 seconds 72°C, 1 min 35 72℃, 5min 62℃, 30 seconds 64℃, 30 seconds

2-1. Xanthomonas arboricola pv. Confirmation of Corilina species specificity

Xanthomonas arboricola pv. Verification of candidate primers was performed using the Corilina strain and similar strains in Table 4. As a result of performing PCR under the conditions in Table 2 using Company P's PCR premix, primer set no. Bands of the expected size were strongly expressed in 6 and 7, but primer set no. In 1 to 5, non-specific reactions other than the expected size were confirmed, and primer set no. 6 and 7 were selected (Figure 2).

Additionally, another PCR premix product (G company) and primer set no. As a result of performing PCR under the conditions in Table 3 using 6, Xanthomonas arboricola pv. A band of the expected size was strongly expressed only in the Corilina sample, and the highest specificity was confirmed at the annealing temperature of 64°C (Figure 3).

List of similar strains No. Strain strain number One Xanthmonas arboricloa pv. corylina KACC 19313 2 Xanthomonas campestris pv. malvacearum KACC 12874 3 Xanthomonas campestris pv. armoraciae KACC 12960 4 Xanthomonas campestris pv. dieffenbachiae KACC 10460 5 Xanthomonas campestris pv. glycinae KACC 10481 6 Xanthomonas campestris pv. poinsettiicola KACC 12894 7 Xanthomonas axonopodis pv. glycines KACC 11147 8 Xanthomonas axonopodis pv. phaseoli KACC 12966 9 Xanthomonas oryzae pv. oryzae KACC 10331 10 Xanthomonas campestris pv. campestris KCTC 22159/ATCC 33913 11 Xanthomonas hortorum pv. carotae Own strain (national pest control) 12 Pseudomonas syringae pv. atrofaciens KACC 11626 13 Pseudomonas syringae pv. pisi KACC 11620 14 Pseudomonas syringae pv. tomato LMG 5509 15 Pseudomonas syringae pv. maculicola CBNU 1558 16 Pseudomonas agarici ATCC 25941 17 Pseudomonas putida KCTC 1639 18 Pseudomonas reactams ATCC 14340 19 Pseudomonas savatanoi pv. phaseolocola KACC 10447 20 Pseudomonas sesamicola KCTC 22519 21 Pseudomonas stutzeri KCTC 1066 22 Pseudomonas viridiflava LMG 2353

In addition, G company's PCR premix and primer set no. 6 using Xanthomonas arboricola pv. As a result of performing PCR on the Corilina strain and the saprophytes and similar strains in Table 5 under the conditions in Table 3 (annealing temperature 64°C), Xanthomonas arboricola pv. It was confirmed that a band of the expected size was strongly expressed only in the Corilina sample (Figure 4).

List of saprophytic and similar bacteria No. Strain strain number One Xanthmonas arboricloa pv. corylina KACC 19313 2 Curtobacterium pusillum APQA 3 Curtobacterium citreum APQA 4 Agrobacterium larrymoorei APQA 5 Stenotrophomonas maltophilia APQA 6 Microbacterium testaceum APQA 7 Agrobacterium sp. APQA 8 Chryseobacterium profundimaris APQA 9 Acidovorax oryzae APQA 10 Pantoea ananatis APQA 11 Pseudomonas putida APQA 12 Xanthomonas sacchari APQA 13 Stenotrophomonas maltophilia APQA 14 Enterobacter cloacae APQA 15 Cronobacter dublinensis APQA 16 Kosakonia sp. APQA 17 Bacillus marisflavi APQA 18 Pseudomonas sp. APQA

In addition, G company's PCR premix and primer set no. 6 using Xanthomonas arboricola pv. As a result of performing PCR on the Corilina strain and similar strains in Table 6 under the conditions in Table 3 (annealing temperature 64°C), Xanthomonas arboricola pv. It was confirmed that a band of the expected size was strongly expressed only in the Corilina sample (FIG. 5). Through this, primer set no. of the present invention. 6 is Xanthomonas arboricola pv. A primer set that could specifically detect Corilina was finally selected.

List of similar strains No. Strain strain number (P) Xanthmonas arboricloa pv. corylina KCTC 19313 One Xanthmonas arboricloa NWB SC208 2 Xanthmonas arboricloa pv. pruni LMG 850 3 Xanthmonas arboricloa pv. poinsettiicola LMG 5402 4 Xanthmonas arboricloa pv. juglandis LMG 745 5 Xanthmonas arboricloa pv. populi LMG 9713

2-2. Validation of primer sets using test target plants

The final selected primer set no. PCR was performed to determine whether 6 reacted with the genomic DNA of the host plant.

Specifically, according to Koch's law, Xanthomonas arboricola pv. Corilina was inoculated into the leaves and stems of hazelnut trees to infect them, and 2 to 3 weeks later, it was confirmed that holes and withering symptoms appeared along the leaf veins (Figure 6A). Next, the leaves showing symptoms were cut and cultured in pure culture to perform direct PCR, or PCR was performed with directly extracted DNA, using primer set no. It was confirmed that no non-specific reaction occurred with the nucleic acid sample of the hexavalent host plant (Figure 6B).

2-3. Detection limit analysis of primer sets through end-point testing

The final selected primer set no. To confirm the detection limit of 6, the total DNA template was 10 (lane 1), 1, 10 ^-1 , 10 ^-2 , 10 ^-3 , 10 ^-4 , 10 ^-5 , 10 ^-6 , 10 ^-7 , 10 Sensitivity analysis was performed by varying the concentration of ^-8 ng (lane 10).

As a result, it was confirmed that a DNA concentration of up to 10 ^-2 ng could be detected when using the PCR premix product from Company G, and a DNA concentration of up to 10 ^-1 ng when using the PCR premix product from Company P (Figure 7). Through this, primer set no. of the present invention. Hexavalent Xanthomonas arboricola pv. It was found to be a marker with excellent sensitivity for Corilina.

<110> REPUBLIC OF KOREA(Animal and Plant Quarantine Agency) <120> Specific primer set for detecting Xanthomonas arboricola pv. corylina and uses it <130> PN21483 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cctagacgtc cttccattgc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 aaggctgctt cggattcata 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cagaaaagca gggccataac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gcaatggaag gacgtctagg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cttcaccacc ccctatctcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agcagggcca taacttcttg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 attgcctcgc aactatctcc 20

Claims (5)

Xanthomonas arboricola pv, comprising the oligonucleotide primer set of SEQ ID NOs: 7 and 2. Primer set for specifically detecting Corylina ( Xanthomonas arboricola pv. corylina ). An oligonucleotide primer set according to claim 1; and a reagent for performing an amplification reaction. A kit for specifically detecting Corylina ( Xanthomonas arboricola pv. corylina ). The kit according to claim 2, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs, and buffer. isolating genomic DNA from a plant sample;
Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the oligonucleotide primer set according to claim 1; and
Detecting the product of the amplification step; Xanthomonas arboricola pv. Method for specifically detecting Corylina ( Xanthomonas arboricola pv. corylina ). The method of claim 4, wherein the detection of the amplification product is performed using a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.