KR20230118753A - Diagnostic kit and diagnostic method capable of distinguishing HA and NA genotypes of Swine influenza virus - Google Patents

Abstract

The present invention relates to a diagnostic kit and diagnostic method capable of distinguishing ha and na genotypes of swine influenza virus. When using a genetic diagnosis composition, kit, and genetic diagnosis method capable of distinguishing H1, H3, N1, and N2 genotypes of the present invention, the accurate HA and NA subtyping of domestic and overseas swine influenza isolates is possible, thereby enabling effective surveillance of swine influenza in the preparation for influenza pandemics.

Description

A diagnostic kit and diagnostic method capable of distinguishing HA and NA genotypes of swine influenza virus {Diagnostic kit and diagnostic method capable of distinguishing HA and NA genotypes of Swine influenza virus}

The present invention relates to a composition for diagnosing swine influenza capable of distinguishing HA and NA genotypes, a kit, and a diagnostic method. More specifically, it relates to a composition for genetic diagnosis, a kit, and a method for genetic diagnosis capable of distinguishing H1, H3, N1, and N2 genotypes of swine influenza, enabling accurate HA and NA subtyping of domestic and foreign isolated swine influenza to prevent influenza pandemic. In preparation for this, effective surveillance of swine influenza is possible.

To date, a total of four cases have been known in which animal influenza caused a pandemic in humans through interspecies transmission, of which three were avian influenza and one was a pandemic caused by swine influenza in 2009 (H1N1 pdm09). At that time, the Ministry of Agriculture, Food and Rural Affairs of Korea designated swine H5, H7 and swine influenza A (H1N1) as the second type of livestock infectious disease under the Livestock Contagious Disease Prevention Act for the reason that they were zoonotic diseases, and the Quarantine Headquarters also conducted joint research with industries to control swine influenza RT- The PCR method was developed and disseminated. However, when using this kit recently, i) in the case of H1N1, the possibility of misdiagnosis increased as domestic viruses mutated, and ii) there were H1N2 and H3N2 genotypes in addition to H1N1, but subtyping was impossible.

In particular, on June 30, 2020, in China, as a result of isolating and analyzing 179 swine influenza viruses detected among 30,000 samples from slaughterhouses from 2011 to 2018, among the six genotypes of Eurasian avain-like (EA) H1N1 A study has been published that the detection rate of G4 has increased (Sun et al., 2020). Accordingly, it is suggested that influenza EA H1N1 G4 is highly likely to cause a pandemic in humans, and the need to monitor it is greatly raised.

Republic of Korea Patent Registration No. 10-1729977 (2017.04.19. Registration)

The inventors of the present invention made diligent research efforts to develop a swine influenza diagnostic composition, kit, and diagnostic method capable of distinguishing HA and NA genotypes. As a result, the present invention was completed by identifying that accurate HA and NA subtyping of domestic and foreign isolate swine influenza is possible using the composition, kit, and diagnostic method of the present invention.

Accordingly, an object of the present invention is to provide a composition for diagnosing swine influenza capable of distinguishing HA and NA genotypes.

Another object of the present invention is to provide a kit for diagnosing swine influenza comprising the composition.

Another object of the present invention is to provide a method for diagnosing swine influenza using the composition or kit.

The term of the present invention, "swine influenza" is known to cause porcine respiratory disease syndrome (PRDC, Porcine Respiratory Disease Complex) along with other bacteria or viruses as the main cause of influenza A virus. In particular, it is known that pigs have receptors that bind to both avian and human influenza A viruses, and thus can serve as mixing vessels capable of creating these new recombinants. It has been reported that the incubation period is 1 to 3 days, clinical symptoms are 5 to 7 days, and viral shedding begins within 24 hours and lasts for 7 to 10 days (OIE disease card). Swine influenza was first isolated in the United States in 1930 after the first report in the United States, Hungary, and China in 1918. The major subtypes occurring worldwide, including Korea, are H1N1, H1N2, and H3N2. In 2009, as the infection of pigs with human influenza A (H1N1 pdm09) was confirmed, domestic and foreign monitoring and research were strengthened. It is managed as an infectious disease. Recently, an Eurasian avian like EA H1N1 G4 type was reported in China. G4 H1N1 binds well to human receptors, proliferates well in human airway epithelial cells, infects well in ferret models, and produces antibodies in related industries. It is a very important disease in terms of public health as a zoonosis, as it is reported that it has a high possibility of developing into an epidemic due to its high cost.

In order to develop a swine influenza diagnostic composition and diagnostic kit for surveillance of the above-described swine influenza virus, the present inventors focused on nucleotide sequences reported after the 2009 pandemic, recombinant swine influenza virus in Eurasia and North America and isolated swine influenza in Korea We designed a primer/probe set that can specifically amplify and detect swine influenza viruses with each genotype by aligning and comparing M, HA, NA, and NS genes, respectively, based on the viral nucleotide sequence. . At this time, if necessary for each genotype, two or more forward and/or reverse primers and corresponding probes were designed to increase sensitivity and coverage at the time of detection.

Subsequently, the designed primer/probe sets were synthesized, and each set was confirmed to work well in the real-time PCR reaction, and a total of 6 kits were constructed. High sensitivity was confirmed using domestic isolates, outdoor clinical samples and standard samples, There was no cross-reactivity to other viruses or bacteria, confirming high specificity.

Specifically, the above-described primer and probe design strategies were reviewed based on the following facts.

Virus A (common) B (pdm09 H1N1) C (H1 specific) D (check G4) M M NA HA(Pig) HA(EA) NS(TRA) One. SIV, not pdm09 ○ Х Х ○ Х - 2.pdm09 ○ ○ ○ ○ Х Х 3.EA G1 ○ Х Х Х ○ Х 4.EA G2 ○ Х Х Х ○ Х 5.EA G3 ○ Х Х Х ○ ○ 6.EA G4 ○ ○ Х Х ○ ○ 7.EA G5 ○ Х Х Х ○ ○ 8.EA G6 ○ Х Х Х ○ ○

First, as described above, genetic information was collected and analyzed for the development of a highly sensitive qRT-PCR system capable of distinguishing major genotypes of swine influenza and EA H1N1 G4 and H1N1 influenza A (H1N1) genes, and genetic information for each major genotype After comparative analysis of secured and diagnostic target sites, suitable primers/probes are designed. A standard virus-positive panel for each genotype of swine influenza virus is constructed and the reactivity of the designed primer/probe set is evaluated.

According to one aspect of the present invention, the present invention provides a composition for diagnosing the genotype of swine influenza virus, comprising the following (a), (b), or a combination thereof:

(a) a set of oligonucleotides for diagnosis of influenza H1 genotype comprising:

(a1) a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 15, a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 16, and the nucleotide sequence of SEQ ID NO: 19 A primer for diagnosing influenza H1 genotype comprising the nucleotide sequence shown, a primer for diagnosing influenza H1 genotype including the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 20, or a combination thereof; and

(a2) a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 17, a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 18, or a combination thereof; and

(b) a set of oligonucleotides for diagnosis of influenza H3 genotype comprising:

A primer for diagnosing influenza H3 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 23, a primer for diagnosing influenza H3 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 24,

In one embodiment of the present invention, (a) of the composition of the present invention is a probe comprising a nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 21, a probe comprising a nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 22 , or a combination thereof.

In one embodiment of the present invention, (b) of the composition of the present invention further comprises a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 25.

In a specific embodiment of the present invention, when the virus contained in the sample is a swine influenza virus of the H1 genotype, the H1 gene is detected when detected using the composition comprising (a) of the present invention.

In another specific embodiment of the present invention, when the virus contained in the specimen is a swine influenza virus of the H3 genotype, the H3 gene is detected when detected using the composition comprising (b) of the present invention.

In one embodiment of the present invention, in addition to the above (a), (b), or a combination thereof, the swine influenza virus further comprising the following (c), (d), or a combination thereof A composition for genotype diagnosis is provided:

(c) a set of oligonucleotides for diagnosis of influenza N1 genotype comprising:

(c1) a primer for diagnosing influenza N1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 26, a primer for diagnosing influenza N1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 27, or a combination thereof; and

(c2) a primer for diagnosing influenza N1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 28; and

(d) a set of oligonucleotides for diagnosis of influenza N2 genotype comprising:

(d1) a primer for diagnosing influenza N2 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 31, a primer for diagnosing influenza N2 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 32, or a combination thereof; and

(d2) A primer for diagnosing influenza N2 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 33.

In one embodiment of the present invention, (c) is a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 29, a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 30, or a combination thereof additionally includes

In one embodiment of the present invention, (d) further comprises a probe comprising a nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 34.

In a specific embodiment of the present invention, when the virus contained in the specimen is a swine influenza virus of the N1 genotype, the N1 gene is detected when detected using the composition comprising (c) of the present invention.

In another specific embodiment of the present invention, when the virus contained in the sample is a swine influenza virus of the N2 genotype, the N2 gene is detected when detected using the composition comprising (d) of the present invention.

According to the above-described embodiment of the present invention, the composition for diagnosing swine influenza virus genotype of the present invention additionally includes:

(e) Primers for detecting the influenza M gene comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 1, and primers for detecting the influenza M gene comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 2.

In one embodiment of the present invention, the composition of the present invention further comprises a probe for detecting M gene comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 3.

According to one embodiment of the present invention, (a), (b), (c), (d), (e), or a combination thereof in the composition according to the above-described embodiment of the present invention probes are labeled with the same or different markers.

In a specific embodiment of the present invention, the composition of the composition for detecting the swine influenza virus is 2-8 pmoles of nucleotides containing the nucleotide sequence of each SEQ ID NO corresponding to the primer per real-time one-step RT-PCR reaction, or 3- 9 pmoles, and includes nucleic acids of each sequence number corresponding to the probe at a concentration of 0.5-4.5 pmoles, but is not limited thereto.

In a more specific embodiment of the present invention, the composition of the composition for detecting the swine influenza virus is 5 pmoles of nucleotides of each sequence number corresponding to the primer per real-time one-step RT-PCR reaction, nucleotides of each sequence number corresponding to the probe is a mixture of primers and probes so that 1.5 pmole or 3.5 pmole is used.

As used herein, the term "multiplexed real-time one-step RT-PCR" means PCR, RT-PCR, one-step RT-PCR, real-time (RT-)PCR and Means the sum of multiplex (RT-)PCR. Looking at each meaning, PCR refers to a technique for amplifying a specific region of DNA in large quantities in vitro, and RT-PCR refers to reverse transcription of RNA into DNA in vitro, followed by complementary DNA (cDNA) made in this way. ) means a technology that amplifies a specific area in large quantities. One-step RT-PCR means that the reverse transcription process of making cDNA and the amplification process of mass-copying a specific region of cDNA are performed in one in vitro, and real-time (RT-)PCR means that the result of amplification of a specific region is monitored in real time. Multiple (RT-)PCR means amplifying two or more different specific regions in large quantities at the same time in one reaction. Through multiple real-time one-step RT-PCR, it is possible to diagnose swine influenza virus detection and genotype differential diagnosis economically, quickly and easily.

As used herein, the term "primer" refers to a short nucleic acid fragment having a free 3'-hydroxyl group that complementarily binds to a template nucleic acid and functions as a starting point for synthesis. it means. The primers are enzymes for polymerization reaction (DNA polymerase, reverse transcriptase, etc.) and four different deoxynucleoside triphosphates (dNTPs) for polymerization reaction in an appropriate reaction buffer and temperature. ), the synthesis of a strand complementary to the template can be initiated in the presence of, and the primer length and reaction conditions can be modified based on those known in the art. If necessary, the primer may include a label that can be detected directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of the label include enzymes, radioactive isotopes, fluorescent molecules, chemical groups, etc. there is

As used herein, the term "probe" refers to a DNA or RNA nucleic acid fragment corresponding to as short as several bases to as long as several hundred bases used to detect the presence of a complementary target nucleic acid sequence by hybridization. That is, it may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, an RNA probe, or the like. The probe may include markers used for detection at the 5' and 3' ends of the corresponding nucleotide sequence, respectively. These markers include a fluorophore and a quencher at the 5' and 3' ends, respectively. It can be. Accordingly, when the fluorophore and the quencher are present in the probe in a combined form, light emission is suppressed by mutual interference, and when the probe is decomposed through a PCR reaction, the interference between the fluorophore and the quencher labeled on the probe disappears and emits light. do. As the fluorophore that can be labeled at the 5' end, any fluorescent material commonly used in the art may be used without limitation, for example, fluorescein, 6-carboxyfluorescein (FAM) ), hexachloro-6-carboxyfluorescein (Hexachloro-6-carboxyfluorescein; HEX), tetrachloro-6-carboxyfluorescein, VIC, JOE, 5-(2'-aminoethyl ) Amino naphthalene-1-sulfonic acid (5-(2'-Aminoethyl)amino naphthalene-1-sulfonic acid), Coumarin and its derivatives, Cyanine-5 (Cy5), Texas Red , tetramethylrhodamine, CAL Fluor Red 610, LC Red 610, and the like may be used. The quencher that can be labeled at the 3' end may also be used without limitation of a quencher commonly used in the art, for example, tetramethylrhodamine, 6-carboxytetramethylrhodamine (6-Carboxytetramethylrhodamine), BHQ- 1, BHQ-2, BHQ-3, 4-dimethylaminophenylazophenyl-4'-maleimide, and the like may be used. If real-time (RT-)PCR is performed using fluorescently labeled probes, amplified products can be monitored in real time, DNA and RNA can be quantified, and electrophoresis is not required, so accurate diagnosis can be made quickly and easily. It has the advantage of being possible.

It is possible for the primers and probes to incorporate additional features that do not alter the basic properties. That is, primers and probes may be modified using conventional means known in the art as long as they exhibit an effect capable of detecting the swine influenza virus of interest in the present invention.

In the present specification, the International Union of Biochemistry (IUB) ambiguity code was used to represent the nucleotide sequences of primers and probes. In the sequence, A is for adenine, C is for cytosine, G is for guanine, T is for thymine, R is for both adenine and guanine, Y is for cytosine and A site capable of both thymine and K represents a site capable of both guanine and thymine. This was equally applied in presenting all nucleotide sequences in this specification.

According to another aspect of the present invention, the present invention provides a kit for diagnosing H1 and H3 genotypes of swine influenza virus comprising the above-described composition of the present invention.

According to another aspect of the present invention, the present invention provides a kit for diagnosing H1/H3 genotypes and N1/N2 genotypes of swine influenza virus comprising the above-described composition of the present invention.

In one embodiment of the present invention, the present invention further comprises a probe corresponding to (a), (b), (c), (d), (e), or a combination thereof in the above-described composition. Provided is a kit for diagnosing the genotype of

In one embodiment of the present invention, the swine influenza virus is swine flu A (H1N1), Eurasian avian-like H1N1 influenza (Eurasian avian-like H1N1, EA H1N1), swine influenza virus of G4 genotype, or EA H1N1 G4 genotype It may be a swine influenza virus having H1 / H3 and N1 / N2 genotypes, such as swine influenza virus of, but is not limited thereto.

The diagnostic kit of the present invention is a multiple real-time one-step RT-PCR diagnostic kit for economically, quickly and easily performing the above-mentioned confirmation of infection and genotyping of various swine influenza viruses, including one or more primers and probes included in the composition, as well as analysis. One or more other component compositions, solutions or devices suitable for the method may be included.

As a specific example, the diagnostic kit of the present invention may include essential elements required to perform reverse transcription and PCR analysis. In addition to each primer/probe set specific for each detection site, the diagnostic kit includes a reverse transcriptase for synthesizing cDNA from swine influenza virus RNA, a DNA polymerase for amplifying a specific region of cDNA in large quantities, a reaction buffer, and dNTPs. , RNase inhibitor, sterile water, a test tube or other suitable container, and the like.

Components included in each test tube in the present invention include, but are not limited to, a multi-oligo mixture composition for simultaneous testing of swine influenza virus, DNA polymerase, reverse transcriptase, RNA degrading enzyme inhibitor, dATP, dCTP, dGTP, dTTP, Tris -HCl, MgCl2, KCl, BSA, nuclease-free water, etc., and the optimal amount of components or reactants used for a specific reaction can be determined by a person skilled in the art.

According to another aspect of the present invention, the present invention provides a method for simultaneously testing one or more swine influenza viruses in a sample using the diagnostic kit.

Specifically, the method for testing the swine influenza virus of the present invention,

(a) isolating RNA from the sample; and (b) specifically amplifying and detecting a target sequence from the separated RNA through a real-time RT-PCR reaction using the composition or diagnostic kit according to one aspect of the present invention.

According to a preferred embodiment of the present invention, the specimen may be selected from the group consisting of birds, livestock and humans, and includes blood, serum, plasma, feces, tissues, etc. isolated therefrom.

According to the present invention, RNA is extracted from a specimen according to a method known in the art, and then a single tube is used using a diagnostic kit containing a composition consisting of the primer/probe sets of the present invention in an extract containing the extracted RNA. Multiple real-time one-step RT-PCR is performed at The results of amplification and detection are confirmed in real time. For example, if emission of a fluorescent substance commonly labeled with the probes of the present invention is confirmed, this indicates that swine influenza virus is present in the sample and its genotype can be confirmed. That is, it is possible to discriminate the genotype along with the presence or absence of swine influenza virus in the specimen.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a diagnostic composition, kit, and diagnostic method for swine influenza capable of distinguishing HA and NA genotypes.

(i) In the case of using the genetic diagnosis composition, kit, and genetic diagnosis method capable of distinguishing H1, H3, N1 and N2 genotypes of swine influenza of the present invention, accurate HA and NA subtyping of domestic and foreign isolated swine influenza is possible, thereby preventing influenza In preparation for a pandemic, effective surveillance of swine influenza is possible.

1 is a diagram showing the results of aligning the M genes of influenza identified in swine flu, SIV, G2, G4, G1, G3, G5, and G6 from 2016 to 2019.
FIG. 2 is a diagram showing the results of aligning NA genes of novel influenza (H1N1), swine influenza with N2 genotype, and Eurasian swine influenza with G1 to G6 genotypes.
3 is a diagram showing the results of aligning the HA gene of Eurasian avian-like (EA) H1N1 and H1N1 influenza A (H1N1).
4 is a diagram showing the results of aligning NS genes such as G3, G4, G5, and G6 North American recombinant influenza viruses, G1 genotype Eurasian influenza viruses, and G2 genotype H1N1 influenza viruses to confirm the EA H1N1 G4 genotype.
5 is a diagram showing the results of aligning the HA gene of swine influenza virus having H1 or H3 genotype.
6 is a diagram showing the result of aligning the NA gene of the swine influenza virus having the N1 genotype.
7 is a diagram showing the results of aligning NA genes of swine influenza viruses having various genotypes, including N2.
8 to 12 are views showing the evaluation results of the reactivity and detection limit of the primers/probes selected in Examples 1 to 5 of the present invention.
13 is a diagram showing a comparison of the efficacy of an existing diagnostic kit using outdoor samples (lung samples: 50 pieces) and the diagnostic kit developed according to the present invention.
14 and 15 show the results of in silico analysis to confirm the possibility of interference with avian (H5, H7, H9), dog (H3N2), or equine (H3N8) influenza viruses of the swine influenza diagnostic kit of the present invention. is the diagram shown.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

The present inventors attempted to develop a diagnostic method capable of discriminating major genotypes of swine influenza and detecting EA H1N1 G4 and swine flu A (H1N1), which are currently prevalent.

Example 1: Primer/probe design and selection for detecting a common M gene for swine influenza positivity and an NA gene specific for swine influenza (NF)

Example 1-1. H1N1 influenza specific primer/probe design and selection within the M gene

1 is a diagram showing the results of aligning the M genes of new influenza, SIV, G2 and G4 genotypes of swine flu, Eurasian swine influenza of G1, G3, G5 and G6 genotypes identified in 2016-2019.

As shown in FIG. 1, the present inventors derived forward/reverse primers and probes that can commonly detect the various swine influenza viruses through the alignment.

Example 1-2. Influenza A (H1N1) specific primer/probe design and selection within the NA gene

FIG. 2 is a diagram showing the results of aligning NA genes of novel influenza (H1N1), swine influenza with N2 genotype, and Eurasian swine influenza with G1 to G6 genotypes.

As shown in FIG. 2, the present inventors derived forward/reverse primers and probes capable of specifically detecting the N1 gene of swine flu (H1N1) through the alignment.

As described above, based on the results of the alignment analysis, primers and probes were designed to amplify both genes in the case of H1N1 influenza A by targeting the M gene and NA gene specific to H1N1. The results are shown in Table 2 below.

division Name Oligo name (5'-3') Target gene Size sequence number SIV-NF
(M/NA) J1972F GGCTAGCACTACGGCAAA M 18 One J1973R GCTAGGATGAGTCCCAATAGT M 21 2 J2044P FAM-ATGGAGGTTGCTAATYAGACTAGGC-BHQ1 M 25 3 J1945F GAACGGATGGACTGGGACAGA NA 21 4 J1946R CAATCCAGCCCTGTTAGTTCT NA 21 5 J1947P FAM-AGTGGTCAGGATATAGCGGGAGT-BHQ1 NA 23 6

Example 2: Primer/probe design and selection for distinguishing between Eurasian avian-like (EA) H1N1 and H1N1 influenza A (H1N1) within the HA gene

To select primers and probes for distinguishing between Eurasian avian-like (EA) H1N1 and swine flu A (H1N1) within the HA gene, the present inventors aligned the HA gene and selected a suitable region as follows.

3 is a diagram showing the results of aligning the HA gene of Eurasian avian-like (EA) H1N1 and H1N1 influenza A (H1N1).

As shown in FIG. 3, the present inventors designed each of the forward primers and probes capable of distinguishing between Eurasian avian-like (EA) H1N1 and swine flu A (H1N1) within the HA gene through the alignment as follows. At this time, reverse primers for detecting the HA gene of EA H1N1 and swine flu A (H1N1) were shared and used identically.

The results are shown in Table 3.

division Name Oligo name (5'-3') Target gene Size sequence number SIV HA
(EA/NF) J1961F AGATTTTGGCGATCTACTCCAC HA(EA) 22 7 J1962R GACCCATTAGARCACATCCA HA (EA/NF) 20 8 J1964P FAM-CCAGTTCCCTGGTCTTRTTAGTCTC-BHQ1 HA(EA) 25 9 J1960F AGATTTTGGCGATCTATTCAAC HA(NF) 22 10 J1963P Cy5-CCAGTTCATTGGTACTGGTAGTCTC-BHQ2 HA(NF) 25 11

Example 3: Primer/probe design and selection for G4 detection for EA H1N1 G4 confirmation

4 is a diagram showing the results of aligning NS genes such as G3, G4, G5, and G6 North American recombinant influenza viruses, G1 genotype Eurasian influenza viruses, and G2 genotype H1N1 influenza viruses to confirm the EA H1N1 G4 genotype.

As shown in FIG. 4, the present inventors designed primers and probes capable of specifically detecting the EA G4 genotype through alignment of the NS genes of the North American recombinant influenza virus having the G2 to G6 genotypes.

The results are shown in Table 4.

division Name Oligo name (5'-3') Target gene Size sequence number SIV TR(NS) J1965F TACCTACTTCGCGCTACATA NS 20 12 J1966R CCTGGTCCATTCGAACACAA NS 20 13 J1967P FAM-CCTCGAGGARATGTCACGAGACTG-BHQ1 NS 24 14

Example 4: Primer/probe design and selection for HA gene (H1/H3) subtyping

5 is a diagram showing the results of aligning the HA gene of swine influenza virus having H1 or H3 genotype.

As shown in FIG. 5, the present inventors designed primers and probes to enable subtyping of the HA gene to H1 or H3 in swine influenza virus having the H1 or H3 genotype.

The results are shown in Table 5.

division Name Oligo name (5'-3') Target gene Size sequence number SIV HA
(H1/H3) J1960F AGATTTTGGCGATCTATTCAAC HA(H1) 22 15 J1989F AGATTTTGGCGATCTACTCYAC HA(H1) 22 16 J1962R GACCCATTAGARCACATCCA HA(H1) 20 17 J1994R GACCCATTGGARCACATCCA HA(H1) 20 18 J1992F GGATTCTGTCGATCTACTCAAC HA(H1) 22 19 J1993F ATATYCTGGCGATCTACTCAAC HA(H1) 22 20 J1990P FAM-CCAGTTCATTGGTACTGKTAGTCTC-BHQ1 HA(H1) 25 21 J1991P FAM-TAGTCTCYCTGGGGGCAATCAGCT-BHQ1 HA(H1) 24 22 J1995F TATGGATTTCCTTTGCCAYATCA HA(H3) 23 23 J1996R ATTAATGCAYTCAAATGCAAATGTT HA(H3) 25 24 J1997P CY5-CTAATGTTGCCYTTTTGGCAGGCCC-BHQ2 HA(H3) 25 25

Example 5: Primer/probe design and selection for NA gene (N1/N2) subtyping

Example 5-1. N1 specific primer/probe design and selection

6 is a diagram showing the result of aligning the NA gene of the swine influenza virus having the N1 genotype.

As shown in FIG. 6, the present inventors designed primers and probes to enable subtyping from swine influenza virus to N1.

Example 5-2. N2 specific oligo design alignment

7 is a diagram showing the results of aligning NA genes of swine influenza viruses having various genotypes, including N2.

As shown in FIG. 7, the present inventors designed primers and probes to enable subtyping with N2 in swine influenza virus.

The results are shown in Table 6.

division Name Oligo name (5'-3') Target gene Size sequence number SIV NA
(N1/N2) J1998F CAGCATATCYTTTTGTGGGTGT N1 21 26 J1999F AGCGGAAGCAGCATTTCTTTYTGTG N1 25 27 J2000R TACTTGTCAATGGTRAATGGCA N1 22 28 J2001P FAM- TGGTCTTGGCCAGACGGTGCTGAG-BHQ1 N1 24 29 J2002P FAM-CTGGTCRTGGCCAGACGGAGCTGAT-BHQ1 N1 25 30 J2003F AAGTCTGGTGGACHTCAAACA N2 21 31 J2006F AGTATGGTGGACCTCAAAYAGTA N2 23 32 J2004R GCTTATATAGGCATGADATTGAT N2 23 33 J2005P Cy5-TGGAACAGGCTCATGGCCTGATGG-BHQ1 N2 24 34

Example 6: Evaluation of reactivity and detection limit of selected primers/probes

The present inventors used swine influenza virus samples as shown in Table 7 below to evaluate the reactivity and detection limit of the primers/probes selected in Examples 1 to 5.

division sample name subtype One H1N1 influenza A (H1N1, isolate in 2019) H1N1 2 Influenza A (H1N1, isolate in 2011) H1N1 3 Swine flu (2018 isolate) H1N2 4 Swine flu (2011 isolate) H3N2 5 Influenza A (H1N1, isolate in 2009) H1N1 6 A/sw/Kor/Can01/2004 (vaccine wine) H1N1 7 A/sw/Kor/Gyeongnam 05K1 (Baeksinju) H1N2 8 A/sw/kor/can04/2005 (vaccine wine) H3N2

The qRT-PCR conditions for using the primers/probes selected in Examples 1 to 5 are shown in Table 8.

The results of evaluating the reactivity and detection limit of the selected primer/probe are shown in FIGS. 8 to 12.

As a result of examining the 8 standard strains of swine influenza shown in Table 6 using the selected primers and probes, it was judged to be suitable for detection, and as a result of confirming the theoretical detection limit using plasmid DNA with the corresponding oligo combination, 1 copy It was confirmed that each detection was possible up to /ul.

Example 7: Prototyping and Evaluation of Diagnostic Kit Efficacy

Example 7-1. prototyping

Using the primer/probe sets shown in Tables 1 to 5, the present inventors produced a total of 6 prototypes having the configuration shown in Table 9 below, and evaluated efficacy in domestic isolates of swine influenza and outdoor samples.

Schematic diagram for determining swine influenza in prototypes genotype NS-SIV-31(M) NS-SIV-32 NF (M/NA) NS-SIV-33 HA (EA/NF) NS-SIV-34
NS(TR) NS-SIV-35 HA (H1/H3) NS-SIV-36 NA (N1/N2) Common M NA EA NF NS(TR) H1 H3 N1 N2 H1N1 + +/- +/- +/- +/- +/- + - + - H1N2 + +/- +/- +/- +/- +/- + - - + H3N2 + +/- +/- +/- +/- +/- - + - + Newflu + + + - + - + - + - G4 + + - + - + + - + -

Example 7-2. Efficacy evaluation of diagnostic kits

1) Efficacy evaluation of diagnostic kits produced from domestic isolates

The present inventors conducted an efficacy evaluation of the diagnostic kit produced for domestic isolates from '09 to '20 (total of 50 strains※).

※ H1N1 (10 weeks), H1N1 (10 weeks), H1N2 (10 weeks), H3N2 (10 weeks)

The results are shown in Table 10.

Comparison of efficacy of existing diagnostic kits and developed diagnostic kits using domestic isolates division kit positive number H1N1(10) swine flu
Enza (20) H1N2(10) H3N2(10) original kit common common M RT-PCR 10 20 10 10 new species Newflu M RT-PCR 8 20 7 4 development kit common M qRT-PCR 10 20 10 10 new species
& G4 NF, EA MP qRT-PCR
(NF qRT-PCR,
HA qRT-PCR;
NS qRT-PCR) 0 ^※ 20 ^※ 0 ^※ 0 ^※ subtype classification MP qRT-PCR (H1, H3) 10(H1) 20(H1) 10(H1) 0 MP qRT-PCR (N1, N2) 10(N1) 20(N1) 10(N2) 10(N2)

※ NF, EA MP qRT-PCR (Final decision after analyzing three types of qRT-PCR with new H1N1 and G4 detection kits) ※※ NF: New Flu, MP: Multi-Plex

As shown in Table 10, in the case of the existing common M RT-PCR kit, all 50 weeks were positive, and in the case of the Newflu M RT-PCR kit, in addition to swine flu, 8 weeks of H1N1, 7 weeks of H1N2, and 4 weeks of H3N2 were also detected as positive. could confirm that Therefore, it was confirmed that the existing kits could not accurately measure the new influenza.

In addition, as shown in Table 10, it was confirmed that the diagnostic kit developed by the present inventors reduced false positives and was capable of subtyping compared to existing kits. Specifically, the existing kit had 100% sensitivity and 37% specificity, but the developed kit of the present invention had 100% sensitivity and 100% specificity.

2) Efficacy evaluation of diagnostic kits using outdoor samples (spleen juice) suspected of swine influenza infection

The present inventors also tested the efficacy of a diagnostic kit developed for 44 swine influenza infection suspected outdoor samples (spleen) collected in 2021 (four farms in Eumseong-gun, Chungcheongbuk-do) and 2 swine influenza virus strains (H1N2) isolated from outdoor samples. was evaluated.

The results are shown in Table 11.

Comparison of efficacy of existing diagnostic kits and developed diagnostic kits using outdoor samples division kit positive number Real-time PCR Outdoor Sample(46) Ct value IPC value original kit common common M RT-PCR 46 - - new species NewfluM RT-PCR 6 - - development kit common M qRT-PCR 15 12.6~32.8 25.6 to 29.4 new species
& G4 NF qRT-PCR M gene (FAM) 15 15.1 to 33.7 23.5~25.8 NA gene (Cy5) 0 - HA qRT-PCR Eurasian (FAM) 14 14.1~32.1 23.4 to 25.7 Swine Influenza (Cy5) 0 - (G4) NS qRT-PCR NS gene (FAM) 0 - 23.3 to 25.5 subtype classification MP qRT-PCR H1 (FAM) 15
(1 positive) 15.2 to 33.8 22.6~23.7 H2(Cy5) 0 - MP qRT-PCR N1 (FAM) 1 (false positive) 14.8 to 32.5 23.9~26.0 N2(Cy5) 12 -

As shown in Table 11, in the case of the existing common M RT-PCR kit, all 46 were confirmed as positive. However, in the developed common M qRT-PCR kit, it was confirmed that 31 out of 46 results of the existing kit were false positives, and in fact negative (15 positives). In addition, in the case of the existing Newflu M RT-PCR kit, 6 were detected as swine flu A (H1N1) positive. However, in the new influenza diagnostic kit of the present invention, it was confirmed that all 6 of the existing kits were false positive and actually all were negative, so that the new kit of the present invention had a significantly higher false positive detection rate of new influenza compared to the existing kit. It was found that lowered

In addition, as a result of subtyping of 15 cases in which the M gene of the new kit of the present invention was positive, 12 were confirmed to be H1N2 (subtyping could not be confirmed for 3 cases).

3) Prototype evaluation in outdoor samples (lung samples: 50)

The efficacy of the prototype in outdoor samples was evaluated using pig lung samples (50 pieces) requested in 2021 to the Disease Diagnosis Division of the Agriculture, Forestry and Livestock Quarantine Headquarters to which the present inventors belonged.

The results are shown in Table 12.

division kit Outdoor Samples (50) positivity voice original kit common Common M RT-PCR 25 25 development kit common M qRT-PCR 25 25 new species
& G4 NF qRT-PCR M gene (FAM) 6 0 NA gene (Cy5) 11 0 HA qRT-PCR Eurasian (FAM) 0 0 Newflu (Cy5) 8 0 (G4)
NS qRT-PCR NS gene (FAM) 10 0 subtype classification MP qRT-PCR H1 (FAM) 20 0 H3 (Cy5) 5 0 MP qRT-PCR N1 (FAM) 10 0 N2(Cy5) 15 0

As shown in Table 12, the results of specifically confirming the efficacy of the existing diagnostic kit and the developed diagnostic kit using the outdoor samples (lung samples: 50) are shown in FIG. 13. As a result, 25 swine influenza were positive. , and swine flu/G4 was confirmed negative. In addition, as a result of subtyping the swine influenza positive (25), H1N1 (10), H1N2 (10), and H3N2 (5) were finally confirmed.

In addition, as a result of confirming the above 25 positive samples, it was confirmed that the H1N1 influenza sequence was inserted into several genes, and G4 was not confirmed.

4) Evaluation of specificity and accuracy in the standard sample of the development kit

The present inventors performed prototype evaluation on 50 isolates and 25 positive samples (waste samples) as standard samples.

The results are shown in Table 13.

division kit Standard samples (50 isolates and 25 positive samples) H1N1(10) Newflu(20) H1N2(10) H3N2(10) common M qRT-PCR 20 20 20 15 new species
& G4 NF, EA MP qRT-PCR
(NF qRT-PCR,
HA qRT-PCR;
NS qRT-PCR) 0 20 0 0 subtype classification MP qRT-PCR (H1, H3) 20(H1) 20(H1) 20(H1) 15(H3) MP qRT-PCR (N1, N2) 20(N1) 20(N1) 20(N2) 15(N2)

As shown in Table 13, the development kit of the present invention was confirmed to have 100% specificity and 100% accuracy.

5) In silico analysis of developed swine influenza subtyping primer & probe

The present inventors showed the results of in silico analysis of the primers of the swine influenza subtyping kit developed in the present invention on the HA gene and NA gene in FIGS. 14 and 15.

As shown in FIGS. 14 and 15, the swine influenza diagnostic kit of the present invention has no possibility of interference with avian (H5, H7, H9), dog (H3N2), and equine (H3N8) influenza viruses, and it was confirmed that it is specific for swine influenza. .

6) Specificity analysis of developed swine influenza subtyping primer & probe

The present inventors confirmed whether the swine influenza diagnostic kit developed according to the present invention exhibits non-specific reactions to viral agents (11 types) and bacterial agents (14 types) that cause infectious diseases in pigs.

Each viral and bacterial causative agent was as follows.

Viruses: CSFV (Classical Swine Fever Virus), PRRSV (Porcine Reproductive and Respiratory Syndrome Virus), PCV2 (Porcine Circovirus 2, Porcine Circovirus Type 2), PEDV (Porcine Epidemic Diarrhea) Virus, swine epidemic diarrhea virus), TGEV (Transmissinble Gastroenteritis Virus), PPV (Porcine Parvovirus), ADV (Aujesky Virus), JEV (Japanese Encephalitis Virus) , EMCV (Encephalomyocarditis Virus), PDCoV (Porcine Deltacoronavirus), PCV3 (Porcine Circovirus 3, Porcine Circovirus type 3).

Bacterial causative agents: ST ( Salmonella Typhimurium, Salmonella infection), SEP (swine enzootic pneumonia , swine epidemic), Hps ( Haemophilus parasuis, glass disease), Pm ( Pasteurella multocida, Pasteurella pneumonia), App ( Actinobacillus pleuropneumoniae, pleuropneumoniae) ), S. suis ( Streptococcus suis, streptococcal infection), CpA ( Clostridium perfringens A, Clostridium perfringens A), Law ( Lawsonia intracellularis, Lawsonia), SD (Swine Dysentery), SE (Swine Erysipelas, only swine), Cd ( Clostridium difficile, Clostridium difficile), A. suis ( Actinobacillus suis), S. hyicus (Staphylococcus hyicus , exudative dermatitis).

As such, the inventors of the present invention developed the conventional RT-PCR, which was developed as an industrial joint research at the Viral Disease and Systemic Disease Laboratory in response to the outbreak of swine influenza A (H1N1) in 2009, by real-time RT-PCR according to the domestic swine influenza epidemic strain variation. We developed HA (H1, H3) and NA (N1, N2) subtyping real-time RT-PCR that can discriminate domestic prevalent subtypes (H1N1, H1N2, and H3N2).

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) MEDIAN Diagnostics Inc. <120> Diagnostic kit and diagnostic method capable of distinguishing HA and NA genotypes of Swine influenza virus <130> PN220012 <160> 34 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> artificial sequence <220> <223> SIV NF J1972F <400> 1 ggctagcact acggcaaa 18 <210> 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> SIV NF J1973R <400> 2 gctaggatga gtcccaatag t 21 <210> 3 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV NF J2044P <400> 3 atggaggttg ctaatyagac taggc 25 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> SIV NF J1945F <400> 4 gaacggatgg actgggacag a 21 <210> 5 <211> 21 <212> DNA <213> artificial sequence <220> <223> SIV NF J1946R <400> 5 caatccagcc ctgttagttc t 21 <210> 6 <211> 23 <212> DNA <213> artificial sequence <220> <223> SIV NF J1947P <400> 6 agtggtcagg atatagcggg agt 23 <210> 7 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV HA (EA/NF) J1961F <400> 7 agattttggc gatctactcc ac 22 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> SIV HA (EA/NF) J1962R <400> 8 gacccattag arcacatcca 20 <210> 9 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV HA (EA/NF) J1964P <400> 9 ccagttccct ggtcttrtta gtctc 25 <210> 10 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV HA (EA/NF) J1960F <400> 10 agattttggc gatctattca ac 22 <210> 11 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV HA (EA/NF) J1963P <400> 11 ccagttcatt ggtactggta gtctc 25 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> SIV TR(NS) J1965F <400> 12 tacctacttc gcgctacata 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> SIV TR(NS) J1966R <400> 13 cctggtccat tcgaacacaa 20 <210> 14 <211> 24 <212> DNA <213> artificial sequence <220> <223> SIV TR(NS) J1967P <400> 14 cctcgaggar atgtcacgag actg 24 <210> 15 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1960F <400> 15 agattttggc gatctattca ac 22 <210> 16 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1989F <400> 16 agattttggc gatctactcy ac 22 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1962R <400> 17 gacccattag arcacatcca 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1994R <400> 18 gacccattgg arcacatcca 20 <210> 19 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1992F <400> 19 ggattctgtc gatctactca ac 22 <210> 20 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1993F <400> 20 atatyctggc gatctactca ac 22 <210> 21 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1990P <400> 21 ccagttcatt ggtactgkta gtctc 25 <210> 22 <211> 24 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1991P <400> 22 tagtctcyct gggggcaatc agct 24 <210> 23 <211> 23 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1995F <400> 23 tatggatttc ctttgccaya tca 23 <210> 24 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1996R <400> 24 attaatgcay tcaaatgcaa atgtt 25 <210> 25 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV HA (H1/H3) J1997P <400> 25 ctaatgttgc cyttttggca ggccc 25 <210> 26 <211> 21 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J1998F <400> 26 cagcatatcy ttttgtggtg t 21 <210> 27 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J1999F <400> 27 agcggaagca gcatttcttt ytgtg 25 <210> 28 <211> 22 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2000R <400> 28 tacttgtcaa tggtraatgg ca 22 <210> 29 <211> 24 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2001P <400> 29 tggtcttggc cagacggtgc tgag 24 <210> 30 <211> 25 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2002P <400> 30 ctggtcrtgg ccagacggag ctgat 25 <210> 31 <211> 21 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2003F <400> 31 aagtctggtg gachtcaaac a 21 <210> 32 <211> 23 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2006F <400> 32 agtatggtgg acctcaaaya gta 23 <210> 33 <211> 23 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2004R <400> 33 gcttatatag gcatgadatt gat 23 <210> 34 <211> 24 <212> DNA <213> artificial sequence <220> <223> SIV NA (N1/N2) J2005P <400> 34 tggaacaggc tcatggcctg atgg 24

Claims (10)

A composition for diagnosing the genotype of swine influenza virus comprising the following (a), (b), or a combination thereof:
(a) a set of oligonucleotides for diagnosis of influenza H1 genotype comprising:
(a1) a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 15, a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 16, and the nucleotide sequence of SEQ ID NO: 19 A primer for diagnosing influenza H1 genotype comprising the nucleotide sequence shown, a primer for diagnosing influenza H1 genotype including the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 20, or a combination thereof; and
(a2) a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 17, a primer for diagnosing influenza H1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 18, or a combination thereof; and
(b) a set of oligonucleotides for diagnosis of influenza H3 genotype comprising:
A primer for diagnosing influenza H3 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 23, a primer for diagnosing influenza H3 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 24,
The method of claim 1, wherein (a) further comprises a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 21, a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 22, or a combination thereof. To, a composition for diagnosing the genotype of swine influenza virus.
The genotyping composition of claim 1, wherein (b) further comprises a probe comprising a nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 25.
The composition for diagnosing the genotype of swine influenza virus according to claim 1, further comprising the following (c), (d), or a combination thereof:
(c) a set of oligonucleotides for diagnosis of influenza N1 genotype comprising:
(c1) a primer for diagnosing influenza N1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 26, a primer for diagnosing influenza N1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 27, or a combination thereof; and
(c2) a primer for diagnosing influenza N1 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 28; and
(d) a set of oligonucleotides for diagnosis of influenza N2 genotype comprising:
(d1) a primer for diagnosing influenza N2 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 31, a primer for diagnosing influenza N2 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 32, or a combination thereof; and
(d2) A primer for diagnosing influenza N2 genotype comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 33.
The method of claim 1, wherein (c) further comprises a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 29, a probe comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 30, or a combination thereof. To, a composition for diagnosing the genotype of swine influenza virus.
The composition for diagnosing genotype of swine influenza virus according to claim 1, wherein (d) further comprises a probe comprising a nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 34.
The composition for diagnosing swine influenza virus genotype according to any one of claims 1 to 6, further comprising:
(e) Primers for detecting the influenza M gene comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 1, and primers for detecting the influenza M gene comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 2.
The composition for diagnosing swine influenza virus genotype according to claim 1, further comprising a probe for detecting M gene comprising the nucleotide sequence represented by the nucleotide sequence of SEQ ID NO: 3.
A kit for diagnosing H1 and H3 genotypes of swine influenza virus, comprising the composition of any one of claims 1 to 3.
A kit for diagnosing H1/H3 genotypes and N1/N2 genotypes of swine influenza virus, comprising the composition of any one of claims 4 to 6.