KR102306883B1 - Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus - Google Patents

Abstract

The M/H5/H7 type AI real-time genetic diagnosis method currently used for AI national surveillance and diagnosis is an internationally representative and generally used method using standard primers and probes made based on the avian influenza virus prevalent in Europe. , Due to the rapid mutation of AI virus recently, the need to develop a diagnostic kit optimized for epidemic strains in Eurasia where there is a high possibility of domestic introduction has been raised. The present invention relates to a diagnostic kit that newly selected Primer and Probe optimized through analysis of domestic isolates and Eurasian epidemic strains and applied real-time genetic diagnostics using them. As a result of experiments on various domestic isolates and field clinical samples with the diagnostic kit of the present invention, it was confirmed that it showed high sensitivity compared to the current method, and it was also confirmed that the specificity was high. By applying the present invention to AI national surveillance and diagnosis, it is expected to minimize damage to the poultry industry and contribute to national quarantine by rapidly and accurately diagnosing H5/H7 type highly pathogenic avian influenza as well as avian influenza virus, resulting in large social and economic expectations. do.

Description

Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus

The present invention relates to a diagnostic kit for H5 and H7 subtype avian influenza virus, and more specifically, the present invention relates to each subtype capable of specifically amplifying and detecting H5 and H7 subtype avian influenza virus target sequences 2 sets of primers / probes for each and a composition for simultaneous detection comprising the same, H5 and H7 subtype avian influenza virus real-time gene diagnosis kit comprising the composition, and H5 and H7 subtype birds using the diagnostic kit It relates to a method for simultaneously testing influenza viruses.

Avian influenza is an acute infectious disease of birds caused by infection with avian influenza virus, which causes serious damage to poultry such as chickens, turkeys, and ducks. According to the pathogenicity of the avian influenza virus, it is divided into low pathogenic avian influenza (LPAI) and highly pathogenic avian influenza (HPAI). It is designated as a disease to be managed, and when it occurs, it is mandatory to report it to the OIE.

Avian influenza virus is classified into Orthomyxoviridae family and Influenzavirus A genus, single-stranded RNA virus composed of 8 different RNA segments, hemagglutinin (HA) And neuraminidase (neuraminidase; NA) is divided into the surface antigen gene and M, NP, PB2, such as six internal genes. Pathogenicity is mainly related to the HA gene, and it is considered to be highly pathogenic if it shows a specific pathogenic-related gene sequence in the HA protein segment region.

Influenza A virus has various subtypes. There are 16 subtypes from H1 to H16 depending on the characteristics of hemagglutinin on the surface of the virus, and N1 to N9 depending on the characteristics of the surface protein expressed by the enzyme neuraminidase. There are 9 subtypes. Therefore, when H type and N type are combined, there are theoretically a total of 144 subtypes of influenza A virus. Avian influenza virus has many subtypes, is easily mutated, and although various types of viruses are distributed in wild birds in the natural ecosystem, even if they are infected, they can pass without obvious symptoms. It is one of the livestock epidemics.

To date, all avian influenza viruses causing highly pathogenic avian influenza in poultry belong to the H5 or H7 subtype, but most of the avian influenza viruses of H5 and H7 subtypes existing in nature are non-pathogenic or low pathogenic viruses. However, in extremely rare cases, when interspecies transmission occurs from wild birds to poultry and the host changes, or when the virus of wild birds has been transmitted to poultry of chickens or turkeys via ducks or geese, etc. It is known that some of the H5 or H7 subtype avian influenza viruses exhibit high pathogenicity due to rapid mutation of Highly pathogenic avian influenza caused by H5N2 in Mexico in 1994, H7N1 in Italy in 1999, and H7N2 in Canada in 2004 started as low pathogenic avian influenza infection in chickens or turkeys. These are examples of high pathogenicity. Therefore, when an avian influenza virus of subtype H5 or H7 is identified, it is necessary to apply high-intensity prevention measures in accordance with the highly pathogenic avian influenza virus, even if it is of low pathogenicity.

Methods for diagnosing avian influenza include a method of isolating a virus that causes disease, a method of detecting a protein antigen or gene, and a serological method of detecting an antibody produced in an animal after virus infection. Among these, the most standard method is virus isolation, which is identified through indirect immunofluorescence method or hemagglutination inhibition test after virus isolation. Molecular biological methods such as reverse transcription-polymerase chain reaction (RT-PCR) for detection are widely used. Based on the HA and NA gene sequences, it is intended to rapidly perform avian influenza virus subtype detection and infection diagnosis using the RT-PCR method, etc. A diagnostic kit capable of detecting type N through multiplexed real-time RT-PCR in two tubes is disclosed, and in No. 10-1809721, 16 types of H type in each tube are disclosed. A diagnostic kit capable of detecting through conventional RT-PCR (RT-PCR) is disclosed, and in No. 10-1809710, 9 types of N types can be detected in each tube through conventional RT-PCR. A kit is disclosed. Molecular biological methods based on PCR have the advantage of being able to quickly and sensitively check the results, but due to the characteristics of the avian influenza virus, which is easily mutated, continuous monitoring of detection coverage and, if necessary, primers to improve detection performance /Probe improvement, etc. is requested.

Under this technical background, the present inventors have recently developed a real-time genetic diagnosis kit to improve the detection ability for avian influenza viruses of H5 and H7 subtypes isolated from Korea and Eurasia, and to develop a real-time genetic diagnosis kit that is relatively less affected by mutation. As a result of the research effort, two sets of primers/probes at different positions that can specifically amplify and detect the H5 subtype avian influenza virus target sequence and the H7 subtype avian influenza virus target sequence at different positions that can be specifically amplified and detected By designing two sets of primers/probes and using them together in a multiplexed real-time one-step RT-PCR reaction in a single tube, two detection sites for subtype H5 avian influenza virus and H7 subtype avian influenza A multi-oligo mix composition and a diagnostic kit including the composition were constructed to enable simultaneous detection of two virus detection sites, and then, using the diagnostic kit, H5 and H7 subtypes were used in domestic isolates and field clinical samples. The avian influenza virus detection performance was confirmed, and the present invention was completed. In particular, by using two detection sites for the diagnosis of avian influenza virus of each subtype, even if there is a problem due to a mutation in one detection site, detection is made through the other detection site, thereby maintaining the accuracy of diagnosis. made to help.

The content described in the technical part that is the background of the present invention is only for improving the understanding of the background of the present invention, and it merely provides background information for the present embodiment and does not constitute the prior art.

One object of the present invention is to provide a primer/probe set for specifically amplifying and detecting target sequences of subtype H5 avian influenza virus and subtype H7 avian influenza virus.

Another object of the present invention is to provide a composition for specifically amplifying and detecting target sequences of subtype H5 avian influenza virus and subtype H7 avian influenza virus.

Another object of the present invention is to provide a diagnostic kit for testing H5 subtype avian influenza virus and H7 subtype avian influenza virus comprising the composition.

Another object of the present invention is to provide a method for simultaneously testing H5 subtype avian influenza virus and H7 subtype avian influenza virus using the diagnostic kit.

On the other hand, the object of the present invention is not limited to the above objects, and other objects not mentioned will be clearly understood from the description below.

The present inventors have excellent detection ability against avian influenza viruses of H5 and H7 subtypes belonging to the Eurasian lineage, including those recently isolated in Korea and Eurasia, and relatively reduce the effect of mutations that may occur in the future. In order to develop a multi-real-time one-step RT-PCR diagnostic kit that is less expensive and more convenient to use, Eurasian strains were analyzed based on the nucleotide sequences reported after 2014 from the GenBank database of the National Center for Biotechnology Information (NCBI) in the United States. After collecting the HA gene sequences of subtype avian influenza viruses belonging to H5 and H7, sequence alignment of the H5 subtype avian influenza virus HA gene sequences and the H7 subtype avian influenza virus HA gene sequences, respectively, and By comparison with the HA gene sequences, a primer/probe set capable of specifically amplifying and detecting only H5 subtype avian influenza virus and a primer/probe set capable of specifically amplifying and detecting only H7 subtype avian influenza virus were designed. At this time, for each subtype, by designing two sets of primers/probes at different positions far apart on the gene, the sensitivity and coverage during detection are increased, and even if there is a problem in one detection site, it is detected through the other detection site. In this way, it is made to be relatively less affected by mutations that may occur in the future compared to diagnostic kits that target only a single detection site. Next, in silico analysis of the primer/probe sets designed as described above was performed. The Agriculture, Forestry and Livestock Quarantine Headquarters' own database, the recent domestic isolates and influenza gene information database GISAID (Global Initiative on Sharing All Influenza Data) ), the detection coverage for recent Chinese isolates was very high, and it was analyzed that there would be no problem with specificity for subtypes other than itself.

After synthesizing all primers and probes that have been designed and analyzed in the virtual environment, each primer/probe set is checked whether it works well in a real-time one-step RT-PCR reaction, and 2 sets of primers/probes and H7 for detecting H5 subtype avian influenza virus A multi-oligo mixture composition was constructed in which all two sets of primers/probes for detecting subtype avian influenza virus were mixed. When configuring the multi-oligo mixture composition, there was no problem in the simultaneous detection of multiples by comparing the performance with a single primer/probe set and adjusting the amounts of individual primers and probes in the multi-oligo mixture composition. Using a multi-oligo mixture composition for testing H5 and H7 subtype avian influenza virus through multiple real-time one-step RT-PCR reactions in a single tube configured as described above and a diagnostic kit comprising the same, domestic isolates of H5 or H7 subtype avian influenza virus and High sensitivity was confirmed through a comparative test between nucleic acid extracts from field clinical samples confirmed positive for H5 or H7 subtype avian influenza virus and existing primer/probe sets for serial dilutions thereof. It was confirmed that there was no problem with specificity through the test.

The present invention discloses the inventions of the following 1. to 17.

1. A composition for detecting a target sequence of H5 subtype avian influenza virus, comprising:

(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or

(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;

or a combination thereof.

2. The composition of 1., wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 8.

3. The composition of 2., wherein the probes are labeled with the same marker.

4. A diagnostic kit for genetic testing of H5 subtype avian influenza virus comprising the composition of 1. to 3.

5. A composition for detecting a target sequence of H7 subtype avian influenza virus, comprising:

(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or

(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;

or a combination thereof.

6. The composition of 5., wherein (c) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 11, and (d) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 14.

7. The composition of 6., wherein the probes are labeled with the same marker.

8. A diagnostic kit for genetic testing of H7 subtype avian influenza virus comprising the composition of 5. to 7.

9. A composition for detecting a target sequence of H5 and H7 subtype avian influenza virus, comprising:

(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or

(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;

or combinations thereof, and

(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or

(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;

or a combination thereof.

10. The method of 9., wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 8, wherein (c) ) is a composition further comprising a probe represented by the nucleotide sequence of SEQ ID NO: 11, wherein (d) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 14.

11. The method of 10., wherein the probes added to (a) and (b) are labeled with a first marker, and the probes added to (c) and (d) are labeled with a second marker, and The composition of claim 1, wherein the first marker and the second marker are different from each other.

12. A diagnostic kit for genetic testing of H5 and H7 subtype avian influenza virus comprising the composition of 9. to 11.

13. The diagnostic kit of 12., wherein the diagnostic kit simultaneously detects H5 subtype avian influenza virus and H7 subtype avian influenza virus in a single tube.

14. (a) isolating RNA from the sample; and

(b) H5 comprising the step of specifically amplifying and detecting the isolated RNA through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 1. to 4. Simultaneous testing method for subtype avian influenza virus.

15. (a) isolating RNA from the sample; and

(b) H7 comprising the step of specifically amplifying and detecting the isolated RNA through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 5. to 8. Simultaneous testing method for subtype avian influenza virus.

16. (a) isolating RNA from the sample; and

(b) targeting the isolated RNA, using the composition or diagnostic kit of any one of 9. to 13. H5 comprising the step of specifically amplifying and detecting a target sequence through multiple real-time one-step RT-PCR reactions and a method for simultaneous testing of H7 subtype avian influenza virus.

17. In 16., when the signal of the first marker is confirmed as a result of the detection in step (b), it is determined that the gene of subtype avian influenza virus H5 is detected, and when the signal of the second marker is confirmed, it is determined that the signal of subtype H7 avian influenza Simultaneous testing method for H5 and H7 subtype avian influenza virus, which determines that the virus gene is detected.

According to one aspect of the present invention, the present invention provides a composition for detecting a target sequence of H5 subtype avian influenza virus comprising:

(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or

(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;

or a combination thereof.

In one embodiment of the present invention, (a) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 8.

In another embodiment of the present invention, the probes are labeled with the same marker.

According to another aspect of the present invention, the present invention provides a composition for detecting a target sequence of H7 subtype avian influenza virus comprising:

(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or

(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;

or a combination thereof.

In one embodiment of the present invention, (c) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 11, and (d) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 14.

In another embodiment of the present invention, the probes are labeled with the same marker.

According to another aspect of the present invention, the present invention provides a composition for detecting a target sequence of H5 and H7 subtype avian influenza virus comprising:

(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or

(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;

or combinations thereof, and

(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or

(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;

or a combination thereof.

In one embodiment of the present invention, (a) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 8, wherein (c) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 11, and (d) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 14.

In another embodiment of the present invention, the probes added to (a) and (b) are labeled with a first marker, and the probes added to (c) and (d) are labeled with a second marker , The first marker and the second marker are different from each other.

In a specific embodiment of the present invention, the composition of the composition for detecting H5 and/or H7 subtype avian influenza virus contains 2-8 pmoles of the nucleic acid of SEQ ID NO: 1 and 3 of the nucleic acid of SEQ ID NO: 2 per real-time one-step RT-PCR reaction. -9 pmole, 2-8 pmole of nucleic acid of SEQ ID NO: 3, 2-8 pmole of nucleic acid of SEQ ID NO: 4, 2-8 pmole of nucleic acid of SEQ ID NO: 5, 2-8 pmole of nucleic acid of SEQ ID NO: 6, SEQ ID NO: 2-8 pmole of nucleic acid of 7, 2-8 pmole of nucleic acid of SEQ ID NO: 8, 2-8 pmole of nucleic acid of SEQ ID NO: 9, 2-8 pmole of nucleic acid of SEQ ID NO: 10, 0.5- of nucleic acid of SEQ ID NO: 11 It contains 4.5 pmoles, 2-8 pmoles of the nucleic acid of SEQ ID NO: 12, 0.5-6.5 pmoles of the nucleic acid of SEQ ID NO: 13, and 0.5-6.5 pmoles of the nucleic acid of SEQ ID NO: 14.

In a more specific embodiment of the present invention, the composition of the composition for detecting H5 and/or H7 subtype avian influenza virus is 5 pmoles of the nucleic acid of SEQ ID NO: 1 and 6 pmoles of the nucleic acid of SEQ ID NO: 2 per real-time one-step RT-PCR reaction , 5 pmoles of the nucleic acid of SEQ ID NO: 3, 5 pmoles of the nucleic acid of SEQ ID NO: 4, 5 pmoles of the nucleic acid of SEQ ID NO: 5, 5 pmoles of the nucleic acid of SEQ ID NO: 6, 5 pmoles of the nucleic acid of SEQ ID NO: 7, the nucleic acid of SEQ ID NO: 8 5 pmoles of the nucleic acid, 5 pmoles of the nucleic acid of SEQ ID NO: 9, 5 pmoles of the nucleic acid of SEQ ID NO: 10, 1.5 pmoles of the nucleic acid of SEQ ID NO: 11, 5 pmoles of the nucleic acid of SEQ ID NO: 12, 3.5 pmoles of the nucleic acid of SEQ ID NO: 13 and The nucleic acid of SEQ ID NO: 14 is a mixture of primers and probes so that 3.5 pmol is used.

In the primer/probe set of the present invention, SEQ ID NOs: 1 to 4 are primers/probe sets for the detection site at the 3'-end (3'-end) side of the HA gene of subtype H5 avian influenza virus, and SEQ ID NO: 5 to 8 are primers/probe sets for the detection site at the 5'-end (5'-end) side of the HA gene of subtype H5 avian influenza virus. In addition, SEQ ID NOs: 9 to 11 are primers/probe sets for the detection site at the 3' end of the HA gene of subtype H7 avian influenza virus, and SEQ ID NOs: 12 to 14 are 5' in the HA gene of subtype H7 avian influenza virus. Primer/probe set for the terminal detection site.

As used herein, the term "avian influenza virus" refers to a virus that can cause avian influenza in chickens, turkeys, ducks, wild birds, and the like. Avian influenza virus has various subtypes, such as 16 types of HA and 9 types of NA depending on the HA gene and NA gene encoding surface antigens, and it is known that there is no cross-protection between different subtypes. Among various subtypes of avian influenza viruses, it is known that all of the highly pathogenic avian influenza that have occurred so far are caused by subtypes H5 or H7.

The term "multiplexed real-time one-step RT-PCR (multiplexed real-time one-step RT-PCR)" used in the present invention is PCR, RT-PCR, one-step RT-PCR, real-time (RT-)PCR and Means the sum of multiple (RT-)PCRs. Looking at the meanings of each, PCR refers to a technique for amplifying a specific region of DNA in a large amount in vitro. ) refers to a technology that amplifies a specific area in large quantities. One-step RT-PCR means that the reverse transcription process to make cDNA and the amplification process to clone a specific region of cDNA in large quantities are performed in one in vitro, and real-time (RT-)PCR is a system in which the results of amplification of a specific region are monitored in real time. In other words, multiplex (RT-)PCR means to amplify two or more different specific regions in a large amount at the same time by performing one reaction. Through multiple real-time, one-step RT-PCR, it is possible to economically, quickly, and conveniently diagnose avian influenza virus detection and subtype differential diagnosis.

As used herein, the term "primer" refers to a short nucleic acid fragment having a free 3'-hydroxyl group that complementarily binds to a template nucleic acid and functions as a starting point for synthesis. it means. The primer contains enzymes [DNA polymerase, reverse transcriptase, etc.] for the polymerization reaction at an appropriate reaction buffer solution and temperature, and four different deoxynucleoside triphosphates (dNTPs). ) can initiate the synthesis of a strand complementary to the template, and the primer length and reaction conditions can be modified based on those known in the art. The primer may contain, if necessary, a label that is directly or indirectly detectable by spectroscopic, photochemical, biochemical, immunochemical or chemical means, and examples of the label include enzymes, radioisotopes, fluorescent molecules, chemical groups, etc. There is this.

In the present invention, the primer is not particularly limited as long as it can detect H5 or H7 subtype avian influenza virus, but preferably SEQ ID NOs: 1 to 3, SEQ ID NOs: 5 to 7, SEQ ID NOs: 9 and 10 and SEQ ID NOs: 12 and 13 oligonucleotides can be used.

As used herein, the term "probe" refers to a DNA or RNA nucleic acid fragment corresponding to a short number of bases to several hundred bases, which is used to detect the presence of a complementary target nucleic acid sequence by hybridization. Meaning, it may be prepared in the form of an oligonucleotide probe, a single-stranded DNA probe, an RNA probe, or the like. The probe may include a marker used for detection at the 5' and 3' ends of the corresponding nucleotide sequence, respectively. As these markers, a fluorophore and a quencher are labeled at the 5' and 3' ends, respectively. can be Accordingly, when the fluorophore and the quencher are bound to the probe, light emission is suppressed by mutual interference, and when the probe is decomposed through a PCR reaction, the interference between the fluorophore and the quencher labeled on the probe disappears to emit light. do. The fluorophore capable of being labeled at the 5' end may be a fluorescent material commonly used in the art without limitation, for example, fluorescein (Fluorescein), 6-carboxyfluorescein (6-Carboxyfluorescein; FAM). ), hexachloro-6-carboxyfluorescein (HEX), tetrachloro-6-carboxyfluorescein (Tetrachloro-6-carboxyfluorescein), VIC, JOE, 5- (2'-aminoethyl )Amino naphthalene-1-sulfonic acid (5-(2'-Aminoethyl)amino naphthalene-1-sulfonic acid), Coumarin and its derivatives, Cyanine-5 (Cyanine-5; Cy5), Texas Red (Texas Red) , Tetramethylrhodamine, Cal Fluor Red 610 (CAL Fluor Red 610), LC Red 610 (LC Red 610), etc. may be used. The quencher that can be labeled at the 3' end may also be used without limitation, a quencher commonly used in the art, for example, tetramethylrhodamine, 6-carboxytetramethylrhodamine (6-Carboxytetramethylrhodamine), BHQ- 1, BHQ-2, BHQ-3, 4-dimethylaminophenylazophenyl-4'-maleimide, etc. may be used. In this way, if real-time (RT-)PCR is performed using a probe labeled with a fluorescent substance, the amplified product can be monitored in real time, DNA and RNA can be quantified, and electrophoresis is not required, making accurate diagnosis quick and easy. It has the advantage of being able to

In the present invention, the probe is not particularly limited as long as it can detect H5 or H7 subtype avian influenza virus, but preferably oligonucleotides of SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 11 and SEQ ID NO: 14 are used. can

It is possible that the primers and probes incorporate additional features that do not change their basic properties. That is, the primers and probes may be modified using conventional means known in the art as long as they exhibit the effect of detecting H5 and H7 subtype avian influenza viruses targeted in the present invention.

In the present specification, the International Union of Biochemistry (IUB) ambiguity code was used to indicate the nucleotide sequences of primers and probes. In the nucleotide sequence, A is adenine, C is cytosine, G is guanine, T is thymine, R is both adenine and guanine possible sites, Y is cytosine and Both thymine are possible sites, and K stands for both guanine and thymine possible sites. This was equally applied in presenting all the nucleotide sequences of the present specification.

According to another aspect of the present invention, the present invention provides a primer represented by the base sequence of SEQ ID NO: 1, a primer represented by the base sequence of SEQ ID NO: 2, a primer represented by the base sequence of SEQ ID NO: 3, SEQ ID NO: 4 A probe represented by the base sequence of The probe, the primer represented by the nucleotide sequence of SEQ ID NO: 9, the primer represented by the nucleotide sequence of SEQ ID NO: 10, the probe represented by the nucleotide sequence of SEQ ID NO: 11, the primer represented by the nucleotide sequence of SEQ ID NO: 12, SEQ ID NO: 13 Multiple real-time one-step RT-PCR composition for specifically amplifying and detecting the target sequence of H5 and H7 subtype avian influenza virus in a sample, including both the primer represented by the nucleotide sequence and the probe represented by the nucleotide sequence of SEQ ID NO: 14 provides

The composition of the present invention is a multi-oligo mixture composition for simultaneous testing of subtype H5 avian influenza virus and subtype H7 avian influenza virus in a single tube, and in particular includes two sets of primers/probes binding to different positions for detection of each subtype This is characterized in that the sensitivity and coverage are increased during detection, and at the same time, even if there is a problem in one detection site, detection is made through the other detection site, so that it is less affected by mutations that may occur in the future.

According to one aspect of the present invention, the present invention provides a diagnostic kit for gene test for H5 subtype avian influenza virus, comprising the composition for detecting the target sequence of the H5 subtype avian influenza virus described above.

According to another aspect of the present invention, the present invention provides a diagnostic kit for genetic testing of H7 subtype avian influenza virus, comprising the composition for detecting the target sequence of the H7 subtype avian influenza virus described above.

According to another aspect of the present invention, the present invention provides H5 and H7 subtype avian influenza virus genes including both the composition for detecting the target sequence of the H5 subtype avian influenza virus and the composition for detecting the target sequence of the H7 subtype avian influenza virus. A diagnostic kit for testing is provided.

The diagnostic kit for genetic testing is specifically a multi-real-time, one-step RT-PCR diagnostic kit for testing H5 and H7 subtype avian influenza viruses in a sample.

The diagnostic kit of the present invention is a multi-real-time one-step RT-PCR diagnostic kit for economically, quickly and conveniently performing confirmation of infection and subtype differentiation of H5 subtype avian influenza virus and H7 subtype avian influenza virus, SEQ ID NO: 1 included in the composition 14 to 14, as well as one or more other component compositions, solutions, or devices suitable for the assay method.

As a specific example, the diagnostic kit of the present invention may include essential elements necessary for performing the reverse transcription reaction and PCR analysis. In addition to each primer/probe set specific for each detection site, the diagnostic kit includes a reverse transcriptase for synthesizing cDNA from avian influenza virus RNA, a DNA polymerase for amplifying a specific region of cDNA in large quantities, a reaction buffer solution, and dNTPs. , RNase inhibitor, sterile water, test tube or other suitable container.

Components included in each test tube in the present invention include, but are not limited to, a multi-oligo mixture composition for simultaneous testing of H5 and H7 subtype avian influenza virus, DNA polymerase, reverse transcriptase, RNA degrading enzyme inhibitor, dATP, dCTP, dGTP , dTTP, Tris-HCl, MgCl 2 , KCl, BSA, nuclease-free water, and the like, and the optimal amount of a component or reactant used for a specific reaction can be determined by those skilled in the art.

According to another aspect of the present invention, the present invention provides a method for simultaneously testing H5 and/or H7 subtype avian influenza virus in a sample using the diagnostic kit.

Specifically, the method for testing H5 subtype avian influenza virus of the present invention comprises the steps of (a) isolating RNA from a specimen; and (b) specifically amplifying and detecting the target sequence through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 1. to 4. .

In addition, the method for testing H7 subtype avian influenza virus of the present invention comprises the steps of (a) isolating RNA from a specimen; and (b) specifically amplifying and detecting the target sequence through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 5. to 8. with respect to the isolated RNA. .

In addition, the method for simultaneously testing H5 and H7 subtype avian influenza virus of the present invention specifically comprises the steps of: (a) isolating RNA from a specimen from an animal suspected of being infected with avian influenza virus; and (b) specifically amplifying and detecting the target sequence from the isolated RNA through multiple real-time one-step RT-PCR reactions using the diagnostic kit for detecting H5 and H7 subtype avian influenza virus.

According to a preferred embodiment of the present invention, the specimen may be selected from the group consisting of birds, livestock, and humans, and includes blood, serum, plasma, feces, tissues, etc. isolated therefrom.

According to the present invention, RNA is extracted from a sample according to a method known in the art, and then a single tube is used using a diagnostic kit comprising a composition consisting of the primer/probe sets of the present invention in an extract containing the extracted RNA. Perform multiple real-time one-step RT-PCR in The results of amplification and detection are confirmed in real time. For example, when the emission of a fluorescent material commonly labeled with the probes of SEQ ID NO: 4 and SEQ ID NO: 8 is confirmed, avian influenza virus is present in the sample and its subtype is H5 In the same way, when the emission of a fluorescent material commonly labeled with the probes of SEQ ID NO: 11 and SEQ ID NO: 14 is confirmed, this means that the avian influenza virus is present in the sample and its subtype is H7. That is, it is possible to differentiate between H5 and H7 subtypes together with whether H5 and H7 subtype avian influenza viruses are detected in the sample.

In the present invention, novel primer/probe sets capable of specifically amplifying and detecting subtype H5 avian influenza virus and novel primer/probe sets capable of specifically amplifying and detecting subtype avian influenza virus H7 are designed, It was confirmed that H5 subtype avian influenza virus and H7 subtype avian influenza virus could be selectively diagnosed at the same time by using a composition consisting of primer/probe sets and a diagnostic kit including the same. The composition of the present invention and a diagnostic kit containing the same are configured to enable economical, fast and convenient testing through multiple real-time, one-step RT-PCR reactions in a single tube, and two sets of primers/probes are activated for each subtype to detect Since it is designed to increase visual sensitivity and coverage while being less affected by mutations that may occur in the future, it may be usefully used to detect H5 and H7 subtype avian influenza viruses and to differentiate subtypes.

Using the composition for detecting H5 and H7 subtype avian influenza virus of the present invention and a diagnostic kit comprising the same, infection with H5 and H7 subtype avian influenza virus that is likely to cause highly pathogenic avian influenza with only one one-step RT-PCR reaction in a single tube Since it is possible to simultaneously test not only itself but also the virus subtype quickly, simply, and with very high reliability, it can be usefully used for diagnosing avian influenza virus infection and monitoring avian influenza using the same. In addition, if the composition for detecting avian influenza virus of H5 and H7 subtypes of the present invention using two sets of primers/probes at different positions for detection of each subtype and a diagnostic kit including the same, sensitivity and coverage are high In addition, even if there is a problem in one detection site, detection is performed through the other detection site, so the effect of mutations that may occur in the future will be relatively small compared to diagnostic kits that target only a single detection site, so the H5 and H7 subtypes Accurate diagnosis of avian influenza virus is possible. Therefore, it is expected that the present invention can be applied to precise diagnosis of avian influenza virus to rapidly and accurately diagnose H5 and H7 subtype avian influenza viruses, thereby minimizing damage to the poultry industry and greatly contributing to national quarantine.

In addition, various effects other than the above-described effects may be directly or implicitly disclosed in the detailed description according to the embodiments of the present invention to be described later.

1 is a diagram showing detection sites on H5 and H7 subtype avian influenza virus genes that are amplified and detected with primer/probe sets according to the present invention.
2A-2F are diagrams showing the results of a real-time one-step RT-PCR reaction using only each primer/probe set according to the present invention.
3A-3G are diagrams showing the results of multiple real-time one-step RT-PCR reactions using a multi-oligo mixture composition in which all primer/probe sets of the present invention are mixed.
4a-4j are diagrams showing the sensitivity comparison test results of the multi-oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H5 subtype avian influenza virus positive samples with the existing primer/probe set.
5A-5E are diagrams showing the results of a sensitivity comparison test with the existing primer/probe set of the multi-oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H7 subtype avian influenza virus positive samples.
6 is a view showing the specificity test results for different subtypes of the multi-oligo mixture composition of the present invention.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art to which the present invention pertains that the scope of the present invention is not to be construed as being limited by these examples.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood in the art to which this invention belongs. In general, the nomenclature used herein is that which is well known and commonly used in the art to which this invention pertains. On the other hand, the terms used herein are used only to describe specific embodiments, and are not intended to limit the present invention. The singular expression includes the plural expression unless the context clearly dictates otherwise.

Example 1: H5 and H7 subtypes for the detection of avian influenza virus gene amplification primer and probe design

In order to design primers and probes for amplification detection of H5 and H7 subtype avian influenza virus genes, the present inventors first analyzed the H5 and H7 subtype avian influenza viruses belonging to the Eurasian lineage based on the nucleotide sequences reported after 2014 from the GenBank database. HA gene sequences were collected. Then, the 550 subtype avian influenza virus HA gene sequences of the collected H5 subtype were aligned with the HA gene sequences of subtypes other than the H5 subtype, and then, at the 3' and 5' end regions of the gene, H5 subtype avian influenza, respectively. Two sets of primers/probes capable of specifically amplifying and detecting only viruses were designed ( FIG. 1 ). In the case of forward primers, two per primer/probe set were designed to increase sensitivity and coverage due to nucleotide sequence diversity due to mutation. In addition, the HA gene sequences of about 250 collected H7 subtype avian influenza virus were aligned with the HA gene sequences of subtypes other than the H7 subtype, and then, at the 3' and 5' ends of the gene, H7 subtype avian influenza, respectively. Two sets of primers/probes capable of specifically amplifying and detecting only viruses were designed ( FIG. 1 ). The reason for designing two sets of primers/probes for each subtype is to increase sensitivity and coverage while at the same time allowing detection through the other detection site even if there is a problem in one detection site, thereby reducing the effect of mutations that may occur in the future. It was meant to be less.

1 is a view showing the detection sites on the H5 and H7 subtype avian influenza virus HA gene amplified and detected with primer/probe sets according to the present invention. The detection site is indicated along with the expected size of the amplification product.

Specifically, for the detection site at the 3' end of the H5 subtype avian influenza virus HA gene, forward primers called H5A_F1 (SEQ ID NO: 1) and H5A_F2 (SEQ ID NO: 2), and reverse primers called H5A_R1 (SEQ ID NO: 3) and H5A_P1 (SEQ ID NO: 4) was designed; For the detection site at the 5' end of the H5 subtype avian influenza virus HA gene, forward primers called H5B_F3 (SEQ ID NO: 5) and H5B_F4 (SEQ ID NO: 6), reverse primers called H5B_R2 (SEQ ID NO: 7), and H5B_P2 (SEQ ID NO: 8) The probe was designed; For the detection site at the 3' end of the H7 subtype avian influenza virus HA gene, a forward primer named H7A_F1 (SEQ ID NO: 9), a reverse primer named H7A_R1 (SEQ ID NO: 10), and a probe named H7A_PS (SEQ ID NO: 11) were designed; For the detection site at the 5' end of the H7 subtype avian influenza virus HA gene, a forward primer named H7B_F2 (SEQ ID NO: 12), a reverse primer named H7B_R2 (SEQ ID NO: 13), and a probe named H7B_P2 (SEQ ID NO: 14) were designed (Table 1). ). When the probes designed as described above were synthesized, a fluorescent material was labeled at the 5' end. H5A_P1 and H5B_P2 were labeled with FAM, and H7A_PS and H7B_P2 were labeled with LC Red 610. In addition, a quencher was labeled at the 3' end during the synthesis of the probes. H5A_P1 and H5B_P2 were labeled with BHQ-1, and H7A_PS and H7B_P2 were labeled with BHQ-2.

Primers and probes for detecting H5 and H7 subtype avian influenza virus HA gene target subtype SEQ ID NO: name Base sequence and probe label information H5 One H5A_F1 AGAGAGGAAATAAGTGGRGTAA 2 H5A_F2 AGRGAAGAAATAAGCGGRGTGA 3 H5A_R1 CACATCCATAAAGATARACCAGC 4 H5A_P1 [FAM] ACCAAATACTGTCAATTTTATTCAACAG [BHQ-1] H5 5 H5B_F3 TTTGCATTGGTTAYCATGCA 6 H5B_F4 GGAGAAAATAGTGCTTCTTYTTGC 7 H5B_R2 GGGCATGTGTAACAGTRACGTT 8 H5B_P2 [FAM] GCAGGTTGACACRATAATGGA [BHQ-1] H7 9 H7A_F1 GCTAYAAAGATTGGATACTTTGGTTTAG 10 H7A_R1 ACACATATGAAGACAAGGCCCAT 11 H7A_PS [LC Red] CATCATGTTTCATACTTCTKGCCAT [BHQ-2] H7 12 H7B_F2 GAAAAGGACRGTTGACCTCGGT 13 H7B_R2 ARACATCACTYCCTTCTCGCCT 14 H7B_P2 [LC Red] TGGGGACRATCACTGGACCACCYCA [BHQ-2]

Next, virtual environment analysis of the primer/probe sets designed as described above was performed.

First, a predicted detection coverage analysis was performed. Two sets of primers/probes for detecting H5 subtype avian influenza virus HA gene showed an expected detection coverage of 99.6% (554 out of 556 nucleotide sequences detectable) with respect to the database used in the design, and the For the database integrating recent domestic isolates and recent Chinese isolates searched in GISAID, it showed an expected detection coverage of 99.5% (562 out of 565 nucleotide sequences detectable). In addition, 2 sets of primers/probes for detecting H7 subtype avian influenza virus HA gene showed an expected detection coverage of 100.0% (255 out of 255 nucleotide sequences can be detected) with respect to the database used for design, and the Agricultural, Forestry and Livestock Quarantine Headquarters It showed an expected detection coverage of 99.8% (989 out of 991 nucleotide sequences detectable) for the database integrating the database, recent domestic isolates, and recent Chinese isolates searched in GISAID.

A predicted specificity analysis was then performed. Predicted specificity analysis was performed using NCBI's Blast program, and for each set of forward primer, reverse primer, and probe, it is a method of checking whether there are other sequences that are likely to be detected except the target sequence on the NCBI database proceeded with As a result, other than the target nucleotide sequence, no other nucleotide sequences that could be detected were identified. Accordingly, 2 sets of primers/probes for detecting subtype H5 avian influenza virus and 2 sets of primers/probes for detecting subtype avian influenza virus H7 All sets were analyzed to have no problem with specificity for subtypes other than themselves.

Example 2: Confirmation of performance by each primer/probe set

After synthesizing all the primers and probes designed in Example 1, a real-time one-step RT-PCR reaction was performed to confirm whether the target nucleic acid was specifically amplified and detected for each primer/probe set. As a template for the real-time one-step RT-PCR reaction, an in vitro transcript or RNA extract was diluted according to a primer/probe set and used. The in vitro transcript is obtained by synthesizing a DNA fragment including the front and rear nucleotide sequences of the corresponding amplification product and then converting it into RNA. It was extracted using the Viral NA Kit.

Each reaction mixture (15 μL) contains 5 μL of RNA template prepared as above [10 ⁶ , 10 ⁴ or 10 ² copies/5 μL], 5 pmole of forward primer, 5 pmole of reverse primer, 2.5 pmole of probe, and Taq DNA Polymerase (Taq DNA polymerase) 1.8 U, reverse transcriptase 6 U, RNAse inhibitor 3 U, 0.16 mM dNTPs, 1X reaction buffer [75 mM Tris-HCl (pH 8.0), 5 mM MgCl ₂ , 50 mM KCl, 0.3% BSA] and the residual amount of nuclease-removed water.

Real-time one-step RT-PCR reaction was performed using a CFX96 Real-time PCR Detection System from Bio-Rad under the following conditions: reverse transcription step 50° C. for 10 minutes; pre-denaturation step 95° C. 10 min; [denaturation step 95° C. 20 seconds -> annealing/extension step 60° C. 30 seconds] X 45 times. For the negative control, nuclease-removed water was used instead of the RNA template.

As a result, it was confirmed that each primer/probe set of the present invention can be detected by specifically amplifying a desired H5 or H7 subtype avian influenza virus gene (FIG. 2 and Table 2).

Ct value by template concentration template concentration (a) (b) (c) (d) (e) (f) 10 ⁶ copies 19.18 19.52 21.19 18.20 18.27 18.37 19.23 19.52 21.03 18.08 18.30 18.23 10 ⁴ copies 25.81 26.19 28.62 24.88 24.95 25.02 25.82 26.33 28.62 24.87 25.04 24.92 10 ² copies 32.35 32.57 36.30 31.53 32.03 31.51 32.72 32.96 36.45 31.44 31.50 31.43 voice
control - - - - - - - - - - - -

2 is a view showing the results of a real-time one-step RT-PCR reaction using only each primer/probe set according to the present invention, (a) is H5A_F1, H5A_R1 and It is the reaction result of the primer/probe set consisting of H5A_P1; (b) is the reaction result of a primer/probe set consisting of H5A_F2, H5A_R1 and H5A_P1 for the detection site at the 3' end of the H5 subtype avian influenza virus gene;

(c) is the reaction result of a primer/probe set consisting of H5B_F3, H5B_R2 and H5B_P2 for the detection site at the 5' end of the H5 subtype avian influenza virus gene; (d) is the reaction result of the primer/probe set consisting of H5B_F4, H5B_R2 and H5B_P2 for the detection site at the 5' end of the H5 subtype avian influenza virus gene;

(e) is a reaction result of a primer/probe set consisting of H7A_F1, H7A_R1 and H7A_PS for the detection site at the 3' end of the H7 subtype avian influenza virus gene; (f) shows the reaction result of a primer/probe set consisting of H7B_F2, H7B_R2 and H7B_P2 for the detection site at the 5' end of the H7 subtype avian influenza virus gene.

As shown in Table 2 and FIG. 2, using the primer/probe sets of the present invention, a composition usable for detecting H5 and H7 subtype avian influenza virus and subtype differential diagnosis and a diagnostic kit including the same can be prepared. Could know.

Example 3: Multiple oligo mixture composition composition and of the diagnostic kit produce

A single primer/probe set and a single primer/probe set while adjusting the amounts of individual primers and probes in the composition to construct a multiple oligo mixture composition for multiple real-time one-step RT-PCR in which all of the primer/probe sets whose performance was confirmed in Example 2 were mixed By comparing the reaction results of

The optimal composition of the multi-oligo mixture composition for simultaneous detection of H5 and H7 subtype avian influenza virus configured as described above is 5 pmole of H5A_F1, 6 pmole of H5A_F2, 5 pmole of H5A_R1, 5 pmole of H5A_P1, and H5B_F3 per multiple real-time one-step RT-PCR reaction. Primers and probes were mixed so that 5 pmole, H5B_F4 5 pmole, H5B_R2 5 pmole, H5B_P2 5 pmole, H7A_F1 5 pmole, H7A_R1 5 pmole, H7A_PS 1.5 pmole, H7B_F2 5 pmole, H7B_R2 3.5 pmole and H7B_Pole were used.

To verify the performance of the multi-oligo mixture composition, multiple real-time one-step RT-PCR reactions were performed using a dilution of in vitro transcript or RNA extract as a template. Each reaction mixture (15 μL) consists of 5 μL of RNA template (10 ⁶ , 10 ⁴ , 10 ² , 50 or 20 copies/5 μL), 1X multiple oligo mixed composition prepared as above, 1.8 U of Taq DNA polymerase, reverse transcription Enzyme 6 U, RNAase inhibitor 3 U, 0.16 mM dNTPs, 1X reaction buffer [75 mM Tris-HCl (pH 8.0), 5 mM MgCl ₂ , 50 mM KCl, 0.3% BSA] and remaining amount of nuclease-removed water included. Multiple real-time one-step RT-PCR reactions were performed using a CFX96 real-time PCR instrument under the following conditions: reverse transcription step 50° C. for 10 min; pre-denaturation step 95° C. 10 min; (denaturation step 95° C. 20 seconds -> annealing/stretching step 62° C. 30 seconds) X 45 times. For the negative control, nuclease-removed water was used instead of the RNA template.

The results are shown in Table 3 and FIG. 3 .

Ct value by template concentration template
density (a) (b) (c) (d) (e) (f) (g) 10 ⁶ copies 19.75 20.36 18.29 19.81 18.97 19.58 19.53 19.50 20.21 18.03 19.88 19.02 19.49 19.48 10 ⁴ copies 26.08 26.56 24.71 26.41 25.44 26.23 26.07 26.29 26.58 24.60 26.34 25.50 26.14 26.08 10 ² copies 32.30 32.57 30.52 32.52 32.25 32.49 32.62 32.23 32.18 30.99 32.38 32.46 32.21 32.21 50 copies 33.23 33.25 33.55 33.42 20 copies 33.75 35.37 34.31 34.29 voice
control - - - -

As a result, the multi-oligo mixture composition of the present invention specifically targets H5 and H7 subtype avian influenza virus genes with little difference in performance from individual real-time one-step RT-PCR reactions using a single primer/probe set in multiple real-time one-step RT-PCR reactions. It was confirmed that amplification can be detected (FIG. 3 and Table 3).

Therefore, it was found that by using the multi-oligo mixture composition of the present invention and a diagnostic kit comprising the same, it was found that the detection and subtype differential diagnosis of H5 and H7 subtype avian influenza virus could be economically and quickly and conveniently.

3 is a view showing the results of multiple real-time one-step RT-PCR reaction using a multi-oligo mixture composition in which all primer/probe sets of the present invention are mixed, (a) is H5 subtype avian influenza containing a nucleotide sequence complementary to H5A_F1; It is a reaction result using an in vitro transcript containing a detection site at the 3' end of a viral gene as a template; (b) is a reaction result using as a template an in vitro transcript containing a detection site at the 3' end of the H5 subtype avian influenza virus gene containing a nucleotide sequence complementary to H5A_F2 as a template; (c) is a reaction result using H5 subtype avian influenza virus (GISAID EPI509704) RNA extract as a template; (d) is the reaction result using the in vitro transcript containing the 3' terminal detection site of the H7 subtype avian influenza virus gene as a template; (e) is a reaction result using an in vitro transcript containing a detection site at the 5' end of the H7 subtype avian influenza virus gene as a template; (f) is a reaction result up to a lower concentration using H5 subtype avian influenza virus (GISAID EPI509698) RNA extract as a template; (g) shows the reaction results up to a lower concentration using the H7 subtype avian influenza virus (Genbank FJ750852) RNA extract as a template.

The diagnostic kit including the multi-oligo mixture composition for simultaneous detection of H5 and H7 subtype avian influenza virus consists of the following three components: 5X multi-oligo mixture composition; an enzyme mix comprising Taq DNA polymerase, reverse transcriptase and RNA degrading enzyme inhibitors; 5X reaction buffer mix containing dNTPs and reaction buffer solution. The diagnostic kit may be composed of four components, including nucleolytic enzyme removal water, for the convenience of the user.

Example 4: Confirmation of clinical usefulness - sensitivity

Sensitivity to the domestic isolate of H5 or H7 subtype avian influenza virus and the outdoor isolate confirmed as positive for H5 or H7 subtype avian influenza virus of the multi-oligo mixture composition constructed in Example 3 and the diagnostic kit comprising the same with the existing primer/probe set It was confirmed by comparison. The domestic and foreign isolates were those stored by the Agriculture, Forestry and Livestock Quarantine Headquarters (Table 4), and RNA nucleic acids were extracted using the NX-48 Viral NA kit of Genolution Co., Ltd., and then serially diluted at 10-fold intervals.

Each reaction mixture (15 μL) using the multiplex oligo mixture composition and the diagnostic kit containing the same was prepared by mixing 5 μL of RNA template (RNA extract stock solution or serial dilutions thereof), 3 μL of 5X multiplex oligo mixture composition, 1.2 μL of enzyme mixture, 5X reaction buffer. 3 μL of the solution mixture and 2.8 μL of nuclease-removed water were included.

As the existing primer/probe set, the primer/probe set for detecting Eurasian subtype H5 avian influenza virus and the primer/probe set for detecting Eurasian strain H7 subtype avian influenza virus recommended by OIE were used. The base sequence and probe label information of the existing primer/probe set are as follows:

H5 forward primer, ACATATGACTACCCACARTATTCAG; H5 reverse primer, AGACCAGCTAYCATGATTGC; H5 probe, [FAM] TCWACAGTGGCGAGTTCCCTAGCA [BHQ-1]; H7 forward primer, GGCCAGTATTAGAAACAACACCTATGA; H7 reverse primer, GCCCCGAAGCTAAACCAAAGTAT; H7 probe, [LC Red] CCGCTGCTTAGTTTGACTGGGTCAATCT [BHQ-2].

Each reaction mixture (15 µL) using the existing primer/probe set was prepared with 5 µL of RNA template (RNA extraction stock or serial dilutions thereof), 5 pmoles of forward primer, 5 pmoles of reverse primer, 4 pmoles of probe (for H5 probes) or 2.5 pmole (for H7 probe), Taq DNA polymerase 1.8 U, reverse transcriptase 6 U, RNAse inhibitor 3 U, 0.16 mM dNTPs, 1X reaction buffer [75 mM Tris-HCl (pH 8.0), 5 mM MgCl ₂ , 50 mM KCl, 0.3% BSA] and the remaining amount of nuclease-removed water.

Real-time one-step RT-PCR reaction was performed using a CFX96 real-time PCR instrument under the following conditions: reverse transcription step 50° C. for 10 minutes; pre-denaturation step 95° C. 10 min; (denaturation step 95° C. 20 seconds -> annealing/stretching step 60° C. 30 seconds) X 45 times. Fluorescence detection was performed only in the remaining 40 times except for the first 5 times, and the Ct value was expressed by adding 5 times.

Information on isolates used in sensitivity experiments sample number separate state name pathogenic HA genotype
(Clade) Gene Accession number One A/broiler duck/Korea/Buan2/2014(H5N8) HPAI 2.3.4.4 EPI509704 2 A/broiler duck/Korea/H1731/2014(H5N8) HPAI 2.3.4.4 EPI573221 3 A/duck/Korea/H1924/2014 (H5N8) HPAI 2.3.4.4 EPI573239 4 A/mallard duck/Korea/H2102/2015(H5N8) HPAI 2.3.4.4 EPI837542 5 A/duck/Korea/ES2/2016(H5N6) HPAI 2.3.4.4 EPI866093 6 A/duck/Korea/HD1/2017(H5N6) HPAI 2.3.4.4 EPI1123317 7 A/spot-billed duck/Korea/WA696/2014(H5N3) LPAI - EPI888272 8 A/wild bird/Korea/H2016/2014(H5N3) LPAI - EPI888273 9 A/mallard/Korea/H95-4/2016(H5N3) LPAI - unpublished 10 A/mallard/Korea/A32-3/2017(H5N2) LPAI - unpublished 11 A/mandarin duck/Korea/H539-3/2016(H7N7) LPAI - EPI1226587 12 A/mallard/Korea/H982-6/2017(H7N7) LPAI - EPI1226507 13 A/duck/Japan/AQ-HE28-3/2016 (H7N9) LPAI - EPI1564434 14 A/duck/Japan/AQ-HE29-22/2017 (H7N9) HPAI - EPI1075315 15 A/duck/Japan/AQ-HE29-52/2017(H7N9) HPAI - EPI1140614

As a result, it was confirmed that the multi-oligo mixture composition of the present invention and the diagnostic kit including the same exhibited higher sensitivity than the existing primer/probe set. Specifically, in 5 out of 10 samples positive for H5 subtype avian influenza virus, the multi-oligo mixture composition of the present invention and a diagnostic kit comprising the same showed relatively better results (FIGS. 4 and 5), and H7 subtype avian influenza virus In 4 out of 5 positive samples, the multi-oligo mixture composition of the present invention and a diagnostic kit including the same showed relatively better results ( FIGS. 5 and 6 ). Therefore, it was found that by using the multi-oligo-mix composition of the present invention and a diagnostic kit comprising the same, it was found that detection of H5 and H7 subtype avian influenza virus and subtype differential diagnosis could be fairly accurately performed, and primers/probes for each subtype The positive effect of using 2 sets each was found indirectly.

4 is a view showing the sensitivity comparison test results of the multiple oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H5 subtype avian influenza virus positive samples with the existing primer/probe sets, serial dilutions of each nucleic acid extract Only the last two results are shown. In FIG. 4 (a) is a comparison result for Sample 1; (b) is a comparison result for sample 2; (c) is a comparison result for sample 3; (d) is a comparison result for sample 4; (e) is a comparison result for sample 5; (f) is the comparison result for sample 6; (g) is a comparison result for sample 7; (h) is a comparison result for sample 8; (i) is a comparison result for sample 9; (j) is a comparison result for sample 10. In (a) to (j), the upper graph is the result using the multi-oligo mixture composition, and the lower graph is the result using the existing primer/probe set.

Ct value by template concentration template concentration composition existing set template concentration composition existing set - (a) - (b) 10 ^-7 33.17 35.83 10 ^-6 33.54 36.91 32.92 36.14 33.35 36.16 10 ^-8 37.32 37.25 10 ^-7 - - 41.78 38.83 - - - (c) - (d) 10 ^-6 32.44 35.62 10 ^-6 33.09 35.68 32.79 36.06 33.16 34.79 10 ^-7 35.68 - 10 ^-7 38.39 38.44 37.11 38.33 37.28 41.83 - (e) - (f) 10 ^-7 33.38 38.32 10 ^-5 32.70 33.04 33.20 37.02 33.08 32.67 10 ^-8 37.30 - 10 ^-6 36.45 35.97 35.76 - 38.26 37.25 - (g) - (h) 10 ^-5 31.38 36.11 10 ^-5 31.98 36.27 31.36 35.96 31.76 36.14 10 ^-6 42.95 - 10 ^-6 35.61 37.26 34.07 - 34.71 - - (i) - (j) 10 ^-5 - - 10 ^-5 32.07 32.20 34.17 - 32.05 31.84 10 ^-6 - - 10 ^-6 34.61 35.47 - - 35.25 34.97

5 is a view showing the sensitivity comparison test results of the multiple oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H7 subtype avian influenza virus positive samples with the existing primer/probe sets, serial dilutions of each nucleic acid extract Only the last two results are shown. In Figure 5 (a) is a comparison result for sample 11; (b) is a comparison result for sample 12; (c) is a comparison result for sample 13; (d) is a comparison result for sample 14; (e) is a comparison result for sample 15. In (a) to (e), the upper graph is the result using the multi-oligo mixture composition, and the lower graph is the result using the existing primer/probe set.

Ct value by template concentration template concentration composition existing set template concentration composition existing set - (a) - (b) 10 ^-7 35.04 - 10 ^-7 35.54 41.69 34.41 44.79 35.98 - 10 ^-8 - - 10 ^-8 - - 39.78 - - - - (c) - (d) 10 ^-6 33.58 37.26 10 ^-6 31.95 32.68 33.52 36.43 32.41 33.03 10 ^-7 36.46 - 10 ^-7 34.58 35.54 35.87 39.08 36.40 36.76 - (e) - 10 ^-7 35.49 35.16 34.37 35.12 10 ^-8 36.77 - - -

Example 5: Confirmation of clinical usefulness - specificity

The specificity of the multiple oligo mixture composition constructed in Example 3 and the diagnostic kit comprising the same to subtypes other than H5 and H7 subtype avian influenza virus was confirmed. A total of 32 strains of avian influenza virus including 2 strains each of H5 and H7 subtypes were used (Table 7). Each reaction mixture (15 µL) was prepared by adding 5 µL of RNA template extracted from avian influenza virus positive sample, 3 µL of 5X multiple oligo mixture composition, 1.2 µL of enzyme mixture, 3 µL of 5X reaction buffer mixture, and 2.8 µL of nuclease-removed water. included. Multiple real-time one-step RT-PCR reactions were performed using a CFX96 real-time PCR instrument under the following conditions: reverse transcription step 50° C. for 10 min; pre-denaturation step 95° C. 10 min; (denaturation step 95° C. 20 seconds -> annealing/stretching step 60° C. 30 seconds) X 45 times.

As a result, it was confirmed that the multi-oligo mixture composition of the present invention and the diagnostic kit including the same had no problem in specificity for subtypes other than the desired subtypes ( FIGS. 6 and 7 ). Therefore, when viewed comprehensively with the sensitivity test results, using the multi-oligo mixture composition of the present invention and a diagnostic kit comprising the same, detection of H5 and H7 subtype avian influenza virus and subtype differential diagnosis can be performed with very high reliability. was found to be

6 is a view showing the specificity test results for different subtypes of the multi-oligo mixture composition of the present invention. No amplification signal was observed except for samples 11, 12, 17 and 18 used as positive controls.

Isolate information and positive control Ct values used for specificity experiments sample number separate state name HA serosubtype H5 detection channel Ct value H7 detection channel Ct value Gene Accession number One A/mallard/Korea/WA167/2019(H1N1) H1 - - unpublished 2 A/mallard/Korea/H227/2018(H1N2) H1 - - unpublished 3 A/spot-billed duck/Korea/H232/2018(H1N3) H1 - - unpublished 4 A/spot-billed duck/Korea/H002/2019(H2N1) H2 - - unpublished 5 A/mallard/Korea/H215/2018(H2N2) H2 - - unpublished 6 A/spot-billed duck/Korea/H301-5/2018(H3N1) H3 - - unpublished 7 A/mallard/Korea/A46/2016(H3N2) H3 - - unpublished 8 A/mallard/Korea/H407-2/2016(H4N5) H4 - - unpublished 9 A/duck/Korea/H027/2019(H4N6) H4 - - unpublished 10 A/oriental turtle dove/Korea/H281-1/2018(H4N8) H4 - - unpublished 11 A/eurasian wigeon/Korea/WA228CL/2019(H5N1) H5 LPAI 27.43 - unpublished 12 A/mallard/Korea/H95-4/2016(H5N3) H5 LPAI 23.82 - unpublished 13 A/common teal/Korea/WA719/2018(H6N2) H6 - - unpublished 14 A/white-fronted goose/Korea/H256/2018(H6N5) H6 - - unpublished 15 A/spot-billed duck/Korea/H277/2018(H6N6) H6 - - unpublished 16 A/mallard/Korea/T107-9/2016(H6N8) H6 - - unpublished 17 A/mallard/Korea/WB1192/2010(H7N4) H7 LPAI - 17.46 unpublished 18 A/duck/Korea/H337/2018(H7N5) H7 LPAI - 17.38 unpublished 19 A/duck/Korea/H001/2019(H8N4) H8 - - unpublished 20 A/chicken/Korea/04164/2004(H9N8) H9 - - unpublished 21 A/mallard/Korea/H037/2019(H10N3) H10 - - unpublished 22 A/spot-billed duck/Korea/H298/2018(H10N4) H10 - - unpublished 23 A/mallard/Korea/H206/2018(H10N5) H10 - - unpublished 24 A/spot-billed duck/Korea/H299-1/2018(H11N2) H11 - - unpublished 25 A/mallard/Korea/WA266/2016(H11N3) H11 - - unpublished 26 A/duck/England/1956 (H11N6) H11 - - EPI242283 27 A/duck/Korea/H034/2019(H11N9) H11 - - unpublished 28 A/spot-billed duck/Korea/H310/2018(H12N2) H12 - - unpublished 29 A/duck/Alberta/60/1976 (H12N5) H12 - - EPI744935 30 A/environment/Korea/H1237/2014(H13N8) H13 - - unpublished 31 A/mallard/Gurjev/263/1982 (H14N5) H14 - - EPI129967 32 A/shearwater/Australia/2576/1979 (H15N9) H15 - - EPI129343

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus <130> PN190297 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5A_F1 <400> 1 agagaggaaa taagtggrgt aa 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5A_F2 <400> 2 agrgaagaaa taagcggrgt ga 22 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> H5A_R1 <400> 3 cacatccata aagataracc agc 23 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> H5A_P1 <400> 4 accaaatact gtcaatttat tcaacag 27 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> H5B_F3 <400> 5 tttgcattgg taycatgca 20 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> H5B_F4 <400> 6 ggagaaaata gtgcttctty ttgc 24 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5B_R2 <400> 7 gggcatgtgt aacagtracg tt 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> H5B_P2 <400> 8 gcaggttgac acrataatgg a 21 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> H7A_F1 <400> 9 gctayaaaga tgtgatactt tggtttag 28 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> H7A_R1 <400> 10 acacatatga agacaaggcc cat 23 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> H7A_PS <400> 11 catcatgttt catacttctk gccat 25 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H7B_F2 <400> 12 gaaaaggacr gttgacctcg gt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H7B_R2 <400> 13 aracatcact yccttctcgc ct 22 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> H7B_P2 <400> 14 tggggacrat cactggacca ccyca 25

Claims (15)

A composition for detecting a target sequence of H5 subtype avian influenza virus, comprising:
(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; and
(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a primer represented by the nucleotide sequence of SEQ ID NO: 6; and a primer represented by the nucleotide sequence of SEQ ID NO: 7.
The composition of claim 1, wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 8.
The composition of claim 2, wherein the probes are labeled with the same marker.
A diagnostic kit for H5 subtype avian influenza virus gene test comprising the composition of any one of claims 1 to 3.
A composition for detecting a target sequence of H5 and H7 subtype avian influenza virus, comprising:
(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; and
(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a primer represented by the nucleotide sequence of SEQ ID NO: 6; and a primer represented by the nucleotide sequence of SEQ ID NO: 7, and
(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; and
(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13.
The method of claim 5, wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, wherein (b) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 8, (c) A composition further comprising a probe represented by the nucleotide sequence of SEQ ID NO: 11, wherein (d) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 14.
The method of claim 6, wherein the probes added to (a) and (b) are labeled with a first marker, the probes added to (c) and (d) are labeled with a second marker, and The first marker and the second marker are different from each other.
A diagnostic kit for genetic testing of H5 and H7 subtypes avian influenza virus comprising the composition of any one of claims 5 to 7.
The diagnostic kit according to claim 8, wherein the diagnostic kit simultaneously detects H5 subtype avian influenza virus and H7 subtype avian influenza virus in a single tube.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) H5 subtype comprising the step of specifically amplifying and detecting a target sequence through a multiple real-time one-step RT-PCR reaction using the composition of any one of claims 1 to 3 for the isolated RNA Avian influenza virus testing method.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) H5 subtype avian influenza virus testing method comprising the step of specifically amplifying and detecting the isolated RNA through a multi-real-time one-step RT-PCR reaction using the diagnostic kit of claim 4 .
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) using the composition of any one of claims 5 to 7 for the isolated RNA, H5 and H7 subtype avian influenza virus test method.
The method according to claim 12, wherein, as a result of the detection in step (b), when the signal of the first marker is confirmed, it is determined that the gene of the H5 subtype avian influenza virus is detected, and when the signal of the second marker is confirmed, the H7 subtype avian influenza virus H5 and H7 subtype avian influenza virus testing method to determine that the gene is detected.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) H5 and H7 subtype avian influenza virus testing method comprising the step of specifically amplifying and detecting the isolated RNA target sequence through multiple real-time one-step RT-PCR reaction using the diagnostic kit of claim 8 .
15. The method of claim 14, wherein as a result of the detection in step (b), when the signal of the first marker is confirmed, it is determined that the gene of the H5 subtype avian influenza virus is detected, and when the signal of the second marker is confirmed, the H7 subtype avian influenza virus H5 and H7 subtype avian influenza virus testing method to determine that the gene is detected.

Images