KR102306883B1 - Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus - Google Patents
Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus Download PDFInfo
- Publication number
- KR102306883B1 KR102306883B1 KR1020190140549A KR20190140549A KR102306883B1 KR 102306883 B1 KR102306883 B1 KR 102306883B1 KR 1020190140549 A KR1020190140549 A KR 1020190140549A KR 20190140549 A KR20190140549 A KR 20190140549A KR 102306883 B1 KR102306883 B1 KR 102306883B1
- Authority
- KR
- South Korea
- Prior art keywords
- avian influenza
- seq
- influenza virus
- nucleotide sequence
- subtype avian
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2561/00—Nucleic acid detection characterised by assay method
- C12Q2561/113—Real time assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
현재 AI 국가예찰 및 진단에 사용되는 M/H5/H7형 AI 실시간 유전자 진단법은 유럽지역에 유행하는 조류인플루엔자 바이러스를 기반으로 제작된 표준 Primer 및 Probe를 사용하여 국제적으로 대표적이고 일반적으로 사용되는 방법이나, 최근 AI 바이러스의 변이가 빠르게 진행되어 국내 유입가능성이 큰 유라시아 지역의 유행주에 최적화된 진단키트의 개발 필요성이 제기되었다. 본 발명은 국내 분리주 및 유라시아 유행주 분석을 통해 최적화된 Primer 및 Probe를 새롭게 선정하고 이를 이용하여 실시간 유전자진단법을 적용한 진단키트에 관한 것이다. 본 발명의 진단키트로 다양한 국내 분리주 및 야외 임상시료들에 대한 실험결과 현행 방법 대비 높은 민감도를 나타내는 것으로 확인되었으며 특이도도 높은 것으로 확인되었다. 본 발명을 AI 국가예찰 및 진단에 적용하여 H5/H7형 고병원성 조류인플루엔자는 물론 조류인플루엔자 바이러스를 신속, 정확하게 진단함으로써 가금 산업의 피해를 최소화하고 국가방역에 기여하여 사회적, 경제적 기대효과가 클 것으로 예상된다. The M/H5/H7 type AI real-time genetic diagnosis method currently used for AI national surveillance and diagnosis is an internationally representative and generally used method using standard primers and probes made based on the avian influenza virus prevalent in Europe. , Due to the rapid mutation of AI virus recently, the need to develop a diagnostic kit optimized for epidemic strains in Eurasia where there is a high possibility of domestic introduction has been raised. The present invention relates to a diagnostic kit that newly selected Primer and Probe optimized through analysis of domestic isolates and Eurasian epidemic strains and applied real-time genetic diagnostics using them. As a result of experiments on various domestic isolates and field clinical samples with the diagnostic kit of the present invention, it was confirmed that it showed high sensitivity compared to the current method, and it was also confirmed that the specificity was high. By applying the present invention to AI national surveillance and diagnosis, it is expected to minimize damage to the poultry industry and contribute to national quarantine by rapidly and accurately diagnosing H5/H7 type highly pathogenic avian influenza as well as avian influenza virus, resulting in large social and economic expectations. do.
Description
본 발명은 H5 및 H7 아형 (subtype) 조류인플루엔자 바이러스 (avian influenza virus) 진단 키트에 관한 것으로, 보다 구체적으로 본 발명은 H5 및 H7 아형 조류인플루엔자 바이러스 표적 서열을 특이적으로 증폭 검출할 수 있는 각 아형에 대한 프라이머/프로브 (primer/probe) 각 2 세트 및 이를 포함하는 동시 검출용 조성물, 상기 조성물을 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스 실시간 유전자 진단 키트 및 상기 진단 키트를 이용하여 H5 및 H7 아형 조류인플루엔자 바이러스를 동시에 검사하는 방법에 관한 것이다.The present invention relates to a diagnostic kit for H5 and H7 subtype avian influenza virus, and more specifically, the present invention relates to each subtype capable of specifically amplifying and detecting H5 and H7 subtype avian influenza
조류인플루엔자는 조류인플루엔자 바이러스 감염에 의해 발생하는 조류의 급성 전염병으로 닭, 칠면조, 오리 등 가금류에서 피해가 심각하게 나타난다. 조류인플루엔자 바이러스의 병원성 정도에 따라 저병원성 조류인플루엔자 (low pathogenic avian influenza; LPAI)와 고병원성 조류인플루엔자 (highly pathogenic avian influenza; HPAI)로 구분되는데, 고병원성 조류인플루엔자는 위험도가 높아 세계동물보건기구 (OIE)에서도 관리 대상 질병으로 지정하고 있으며, 발생 시 OIE에 의무적으로 보고하도록 되어 있다.Avian influenza is an acute infectious disease of birds caused by infection with avian influenza virus, which causes serious damage to poultry such as chickens, turkeys, and ducks. According to the pathogenicity of the avian influenza virus, it is divided into low pathogenic avian influenza (LPAI) and highly pathogenic avian influenza (HPAI). It is designated as a disease to be managed, and when it occurs, it is mandatory to report it to the OIE.
조류인플루엔자 바이러스는 Orthomyxoviridae 과 (科, family), Influenzavirus A 속 (屬, genus)으로 분류되며, 단일 가닥 RNA 바이러스로서 서로 다른 8개의 RNA 분절 (segment)로 구성되어 있는데, 혈구응집소 (hemagglutinin; HA) 및 뉴라미니다제 (neuraminidase; NA)의 표면 항원 유전자와 M, NP, PB2 등 6개의 내부 유전자로 나뉘어진다. 병원성은 주로 HA 유전자와 관련이 있으며, HA 단백질 분절 부위에 특정한 병원성 관련 유전자 배열을 나타내면 고병원성으로 간주되고 있다.Avian influenza virus is classified into Orthomyxoviridae family and Influenzavirus A genus, single-stranded RNA virus composed of 8 different RNA segments, hemagglutinin (HA) And neuraminidase (neuraminidase; NA) is divided into the surface antigen gene and M, NP, PB2, such as six internal genes. Pathogenicity is mainly related to the HA gene, and it is considered to be highly pathogenic if it shows a specific pathogenic-related gene sequence in the HA protein segment region.
A형 인플루엔자 바이러스는 다양한 아형이 있는데, 바이러스 표면에 존재하는 혈구응집소의 특성에 따라 H1부터 H16까지 16종의 아형이 있으며, 뉴라미니다제라는 효소가 나타내는 표면 단백질의 특성에 따라 N1부터 N9까지 9종의 아형이 있다. 따라서, H형과 N형을 조합할 경우, A형 인플루엔자 바이러스는 이론적으로 총 144종의 아형이 존재하게 된다. 조류인플루엔자 바이러스는 아형이 매우 많고, 변이가 쉽게 일어나며, 자연 생태계의 야생 조류에 다양한 종류의 바이러스가 분포되어 있으면서도 이들에게는 감염되어도 뚜렷한 증상이 없이 경과될 수 있기 때문에 방역 측면에서 볼 때 가장 주의하여야 할 가축 전염병 중 하나이다.Influenza A virus has various subtypes. There are 16 subtypes from H1 to H16 depending on the characteristics of hemagglutinin on the surface of the virus, and N1 to N9 depending on the characteristics of the surface protein expressed by the enzyme neuraminidase. There are 9 subtypes. Therefore, when H type and N type are combined, there are theoretically a total of 144 subtypes of influenza A virus. Avian influenza virus has many subtypes, is easily mutated, and although various types of viruses are distributed in wild birds in the natural ecosystem, even if they are infected, they can pass without obvious symptoms. It is one of the livestock epidemics.
현재까지 가금류에서 고병원성 조류인플루엔자를 일으키는 조류인플루엔자 바이러스는 모두 H5 또는 H7 아형에 속하는 것이었지만, 자연계에 존재하는 H5 및 H7 아형의 조류인플루엔자 바이러스는 대부분 비병원성 또는 저병원성 바이러스이다. 그러나, 극히 드물지만 때로는 야생 조류에서 가금류로 종간의 전파 (interspecies transmission)가 이루어져 숙주 (host)가 변할 경우나 또는 야생 조류의 바이러스가 오리나 거위 등을 거쳐 닭이나 칠면조의 가금류로 전파되어 왔을 경우 유전자의 급격한 변이가 일어나 H5 또는 H7 아형 조류인플루엔자 바이러스 중 일부가 고병원성의 특성을 발현하는 것으로 알려져 있다. 1994년 멕시코에서의 H5N2, 1999년 이탈리아에서의 H7N1 그리고 2004년 캐나다에서의 H7N2에 의한 고병원성 조류인플루엔자는 닭이나 칠면조에서 저병원성 조류인플루엔자 감염으로 시작되어 이것이 확산되고 지속적으로 순환 감염되면서 바이러스 유전자가 변이되어 고병원성을 나타낸 사례들이다. 따라서, H5 또는 H7 아형의 조류인플루엔자 바이러스가 확인될 경우에는 저병원성이라 할지라도 고병원성 조류인플루엔자 바이러스에 준하여 강도 높은 방역 대책을 적용하는 것이 필요하다.To date, all avian influenza viruses causing highly pathogenic avian influenza in poultry belong to the H5 or H7 subtype, but most of the avian influenza viruses of H5 and H7 subtypes existing in nature are non-pathogenic or low pathogenic viruses. However, in extremely rare cases, when interspecies transmission occurs from wild birds to poultry and the host changes, or when the virus of wild birds has been transmitted to poultry of chickens or turkeys via ducks or geese, etc. It is known that some of the H5 or H7 subtype avian influenza viruses exhibit high pathogenicity due to rapid mutation of Highly pathogenic avian influenza caused by H5N2 in Mexico in 1994, H7N1 in Italy in 1999, and H7N2 in Canada in 2004 started as low pathogenic avian influenza infection in chickens or turkeys. These are examples of high pathogenicity. Therefore, when an avian influenza virus of subtype H5 or H7 is identified, it is necessary to apply high-intensity prevention measures in accordance with the highly pathogenic avian influenza virus, even if it is of low pathogenicity.
조류인플루엔자 진단법으로는 질병의 원인이 되는 바이러스를 분리하는 방법, 단백 항원이나 유전자를 검출하는 방법, 바이러스 감염 후 동물 체내에 생성되는 항체를 검출하는 혈청학적 방법 등이 이용되고 있다. 이 중 가장 기준이 되는 방법은 바이러스 분리로서, 바이러스 분리 후에 간접 면역형광법 (indirect immunofluorescence method)이나 혈구 응집 억제 시험법 (hemagglutination inhibition test) 등을 통해 동정을 하지만, 최근에는 조류인플루엔자 바이러스 특이 유전자 부위를 검출하는 역전사 중합효소 연쇄 반응 (reverse transcription-polymerase chain reaction; RT-PCR)과 같은 분자생물학적인 방법이 많이 이용된다. HA 및 NA 유전자 염기서열을 기초로 RT-PCR 방법 등을 이용하여 조류인플루엔자 바이러스 아형 검출 및 감염 진단을 신속하게 수행하려는 것으로, 대한민국 등록특허 제 10-1618435호에는 5종의 H형과 5종의 N형을 2개의 튜브에서 다중 실시간 RT-PCR (multiplexed real-time RT-PCR)을 통해 검출할 수 있는 진단 키트가 개시되어 있으며, 제 10-1809721호에는 16종의 H형을 각각의 튜브에서 종래 RT-PCR (conventional RT-PCR)을 통해 검출할 수 있는 진단 키트가 개시되어 있고, 제 10-1809710호에는 9종의 N형을 각각의 튜브에서 종래 RT-PCR을 통해 검출할 수 있는 진단 키트가 개시되어 있다. PCR에 기반한 분자생물학적인 방법들은 신속하고 민감하게 결과를 확인할 수 있다는 장점을 가지지만, 변이가 쉽게 일어나는 조류인플루엔자 바이러스 특성 상 검출 커버리지 (detection coverage)에 대한 지속적인 모니터링 및 필요 시 검출능 향상을 위한 프라이머/프로브 개선 등이 요구되고 있다.Methods for diagnosing avian influenza include a method of isolating a virus that causes disease, a method of detecting a protein antigen or gene, and a serological method of detecting an antibody produced in an animal after virus infection. Among these, the most standard method is virus isolation, which is identified through indirect immunofluorescence method or hemagglutination inhibition test after virus isolation. Molecular biological methods such as reverse transcription-polymerase chain reaction (RT-PCR) for detection are widely used. Based on the HA and NA gene sequences, it is intended to rapidly perform avian influenza virus subtype detection and infection diagnosis using the RT-PCR method, etc. A diagnostic kit capable of detecting type N through multiplexed real-time RT-PCR in two tubes is disclosed, and in No. 10-1809721, 16 types of H type in each tube are disclosed. A diagnostic kit capable of detecting through conventional RT-PCR (RT-PCR) is disclosed, and in No. 10-1809710, 9 types of N types can be detected in each tube through conventional RT-PCR. A kit is disclosed. Molecular biological methods based on PCR have the advantage of being able to quickly and sensitively check the results, but due to the characteristics of the avian influenza virus, which is easily mutated, continuous monitoring of detection coverage and, if necessary, primers to improve detection performance /Probe improvement, etc. is requested.
이러한 기술적 배경 하에서, 본 발명자들은 최근 국내 및 유라시아 지역에서 분리된 H5 및 H7 아형의 조류인플루엔자 바이러스들에 대한 검출능을 향상시키고, 변이에 의한 영향을 상대적으로 덜 받는 실시간 유전자 진단 키트를 개발하고자 예의 연구노력한 결과, H5 아형 조류인플루엔자 바이러스 표적 서열을 특이적으로 증폭 검출할 수 있는 서로 다른 위치의 프라이머/프로브 2 세트 및 H7 아형 조류인플루엔자 바이러스 표적 서열을 특이적으로 증폭 검출할 수 있는 서로 다른 위치의 프라이머/프로브 2 세트를 고안하고, 이들을 단일 튜브 내 다중 실시간 원스텝 RT-PCR (multiplexed real-time one-step RT-PCR) 반응에 함께 사용함으로써 H5 아형 조류인플루엔자 바이러스 2개 검출 부위 및 H7 아형 조류인플루엔자 바이러스 2개 검출 부위의 동시 검출이 가능하도록 다중 올리고 혼합 조성물 (multi oligo mix) 및 이 조성물을 포함하는 진단 키트를 구성한 다음, 상기 진단 키트를 이용하여 국내 분리주 및 야외 임상 시료들에서 H5 및 H7 아형 조류인플루엔자 바이러스 검출 성능을 확인하고, 본 발명을 완성하였다. 특히, 각 아형의 조류인플루엔자 바이러스 진단을 위해 검출 부위를 2군데씩 사용함으로써 하나의 검출 부위에 변이 등으로 인해 문제가 생기더라도 다른 하나의 검출 부위를 통해 검출이 이루어지도록 하여 진단의 정확성을 유지하는데 도움이 되도록 하였다.Under this technical background, the present inventors have recently developed a real-time genetic diagnosis kit to improve the detection ability for avian influenza viruses of H5 and H7 subtypes isolated from Korea and Eurasia, and to develop a real-time genetic diagnosis kit that is relatively less affected by mutation. As a result of the research effort, two sets of primers/probes at different positions that can specifically amplify and detect the H5 subtype avian influenza virus target sequence and the H7 subtype avian influenza virus target sequence at different positions that can be specifically amplified and detected By designing two sets of primers/probes and using them together in a multiplexed real-time one-step RT-PCR reaction in a single tube, two detection sites for subtype H5 avian influenza virus and H7 subtype avian influenza A multi-oligo mix composition and a diagnostic kit including the composition were constructed to enable simultaneous detection of two virus detection sites, and then, using the diagnostic kit, H5 and H7 subtypes were used in domestic isolates and field clinical samples. The avian influenza virus detection performance was confirmed, and the present invention was completed. In particular, by using two detection sites for the diagnosis of avian influenza virus of each subtype, even if there is a problem due to a mutation in one detection site, detection is made through the other detection site, thereby maintaining the accuracy of diagnosis. made to help.
본 발명의 배경이 되는 기술 부분에 기재된 내용은 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것으로서, 단순히 본 실시예에 대한 배경 정보를 제공할 뿐 종래 기술을 구성하는 것은 아니다.The content described in the technical part that is the background of the present invention is only for improving the understanding of the background of the present invention, and it merely provides background information for the present embodiment and does not constitute the prior art.
본 발명의 하나의 목적은 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스의 표적 서열을 특이적으로 증폭 검출하기 위한 프라이머/프로브 세트를 제공하는 데 있다.One object of the present invention is to provide a primer/probe set for specifically amplifying and detecting target sequences of subtype H5 avian influenza virus and subtype H7 avian influenza virus.
본 발명의 다른 목적은 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스의 표적 서열을 특이적으로 증폭 검출하기 위한 조성물을 제공하는 데 있다.Another object of the present invention is to provide a composition for specifically amplifying and detecting target sequences of subtype H5 avian influenza virus and subtype H7 avian influenza virus.
본 발명의 또 다른 목적은 상기 조성물을 포함하는 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스 검사용 진단 키트를 제공하는 데 있다.Another object of the present invention is to provide a diagnostic kit for testing H5 subtype avian influenza virus and H7 subtype avian influenza virus comprising the composition.
본 발명의 또 다른 목적은 상기 진단 키트를 이용하여 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스를 동시에 검사하는 방법을 제공하는 데 있다.Another object of the present invention is to provide a method for simultaneously testing H5 subtype avian influenza virus and H7 subtype avian influenza virus using the diagnostic kit.
한편, 이러한 본 발명의 목적은 상기의 목적들로 국한되지 않으며, 언급되지 않은 또 다른 목적들은 아래의 기재로부터 명확하게 이해될 수 있을 것이다.On the other hand, the object of the present invention is not limited to the above objects, and other objects not mentioned will be clearly understood from the description below.
본 발명자들은 최근 국내 및 유라시아 지역에서 분리된 것들을 포함하여 유라시아 계통 (Eurasian lineage)에 속하는 H5 및 H7 아형의 조류인플루엔자 바이러스들에 대해 우수한 검출능을 가지면서 향후 발생할 수 있는 변이에 의한 영향을 상대적으로 덜 받는 사용이 편리한 다중 실시간 원스텝 RT-PCR 진단 키트를 개발하기 위해, 미국 국립생물공학정보센터 (National Center for Biotechnology Information; NCBI)의 GenBank 데이터베이스로부터 2014년 이후 보고된 염기서열들을 중심으로 유라시아 계통에 속하는 H5 및 H7 아형 조류인플루엔자 바이러스의 HA 유전자 염기서열들을 수집한 다음, H5 아형 조류인플루엔자 바이러스 HA 유전자 염기서열들 및 H7 아형 조류인플루엔자 바이러스 HA 유전자 염기서열들을 각각 정렬 (sequence alignment)하고 자신 이외 아형들의 HA 유전자 염기서열들과 비교함으로써, H5 아형 조류인플루엔자 바이러스만 특이적으로 증폭 검출할 수 있는 프라이머/프로브 세트 및 H7 아형 조류인플루엔자 바이러스만 특이적으로 증폭 검출할 수 있는 프라이머/프로브 세트를 설계하였다. 이 때, 각 아형에 대해 유전자 상에서 멀리 떨어져있는 서로 다른 위치의 프라이머/프로브 2 세트씩을 설계함으로써, 검출 시 민감도 및 커버리지를 높이는 동시에 하나의 검출 부위에 문제가 생기더라도 다른 하나의 검출 부위를 통해 검출이 이루어지도록 하여 향후 발생할 수 있는 변이에 의한 영향을 단일 검출 부위만을 대상으로 하는 진단 키트에 비해 상대적으로 덜 받도록 하였다. 이어서, 상기와 같이 설계된 프라이머/프로브 세트들의 가상 환경 분석 (in silico analysis)을 수행하였는데, 농림축산검역본부의 자체 데이터베이스, 최근 국내 분리주들 및 인플루엔자 유전자 정보 데이터베이스인 GISAID(Global Initiative on Sharing All Influenza Data)에서 조회되는 최근 중국 분리주들에 대한 검출 커버리지가 아주 높고 자신 이외 아형들에 대한 특이도에 문제가 없을 것으로 분석되었다.The present inventors have excellent detection ability against avian influenza viruses of H5 and H7 subtypes belonging to the Eurasian lineage, including those recently isolated in Korea and Eurasia, and relatively reduce the effect of mutations that may occur in the future. In order to develop a multi-real-time one-step RT-PCR diagnostic kit that is less expensive and more convenient to use, Eurasian strains were analyzed based on the nucleotide sequences reported after 2014 from the GenBank database of the National Center for Biotechnology Information (NCBI) in the United States. After collecting the HA gene sequences of subtype avian influenza viruses belonging to H5 and H7, sequence alignment of the H5 subtype avian influenza virus HA gene sequences and the H7 subtype avian influenza virus HA gene sequences, respectively, and By comparison with the HA gene sequences, a primer/probe set capable of specifically amplifying and detecting only H5 subtype avian influenza virus and a primer/probe set capable of specifically amplifying and detecting only H7 subtype avian influenza virus were designed. At this time, for each subtype, by designing two sets of primers/probes at different positions far apart on the gene, the sensitivity and coverage during detection are increased, and even if there is a problem in one detection site, it is detected through the other detection site. In this way, it is made to be relatively less affected by mutations that may occur in the future compared to diagnostic kits that target only a single detection site. Next, in silico analysis of the primer/probe sets designed as described above was performed. The Agriculture, Forestry and Livestock Quarantine Headquarters' own database, the recent domestic isolates and influenza gene information database GISAID (Global Initiative on Sharing All Influenza Data) ), the detection coverage for recent Chinese isolates was very high, and it was analyzed that there would be no problem with specificity for subtypes other than itself.
설계 및 가상 환경 분석이 완료된 모든 프라이머 및 프로브를 합성한 다음, 각 프라이머/프로브 세트별로 실시간 원스텝 RT-PCR 반응에서 잘 작동하는지 확인하고, H5 아형 조류인플루엔자 바이러스 검출을 위한 프라이머/프로브 2세트 및 H7 아형 조류인플루엔자 바이러스 검출을 위한 프라이머/프로브 2세트를 모두 혼합한 다중 올리고 혼합 조성물을 구성하였다. 다중 올리고 혼합 조성물 구성 시에는 단일 프라이머/프로브 세트와의 성능 비교 및 다중 올리고 혼합 조성물 내 개별 프라이머와 프로브의 양 조정을 통해 다중 동시 검출에 문제가 없도록 하였다. 상기와 같이 구성된 단일 튜브 내 다중 실시간 원스텝 RT-PCR 반응을 통한 H5 및 H7 아형 조류인플루엔자 바이러스 검사를 위한 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트를 이용하여, H5 또는 H7 아형 조류인플루엔자 바이러스 국내 분리주 및 H5 또는 H7 아형 조류인플루엔자 바이러스 양성으로 확인된 야외 임상 시료들로부터의 핵산 추출액과 이의 연속 희석액을 대상으로 한 기존 프라이머/프로브 세트와의 비교 테스트를 통해 높은 민감도를 확인하였으며, 자신 이외 다른 아형들에 대한 테스트를 통해 특이도에 문제가 없음을 확인하였다.After synthesizing all primers and probes that have been designed and analyzed in the virtual environment, each primer/probe set is checked whether it works well in a real-time one-step RT-PCR reaction, and 2 sets of primers/probes and H7 for detecting H5 subtype avian influenza virus A multi-oligo mixture composition was constructed in which all two sets of primers/probes for detecting subtype avian influenza virus were mixed. When configuring the multi-oligo mixture composition, there was no problem in the simultaneous detection of multiples by comparing the performance with a single primer/probe set and adjusting the amounts of individual primers and probes in the multi-oligo mixture composition. Using a multi-oligo mixture composition for testing H5 and H7 subtype avian influenza virus through multiple real-time one-step RT-PCR reactions in a single tube configured as described above and a diagnostic kit comprising the same, domestic isolates of H5 or H7 subtype avian influenza virus and High sensitivity was confirmed through a comparative test between nucleic acid extracts from field clinical samples confirmed positive for H5 or H7 subtype avian influenza virus and existing primer/probe sets for serial dilutions thereof. It was confirmed that there was no problem with specificity through the test.
본 발명은 다음 1. 내지 17.의 발명을 개시한다.The present invention discloses the inventions of the following 1. to 17.
1. 다음을 포함하는 H5 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물:1. A composition for detecting a target sequence of H5 subtype avian influenza virus, comprising:
(a) 서열번호 1의 염기서열로 표시되는 프라이머, 서열번호 2의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 3의 염기서열로 표시되는 프라이머; 또는(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or
(b) 서열번호 5의 염기서열로 표시되는 프라이머, 서열번호 6의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 7의 염기서열로 표시되는 프라이머; (b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;
또는 이들의 조합.or a combination thereof.
2. 1.에 있어서, 상기 (a)는 서열번호 4의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (b)는 서열번호 8의 염기서열로 표시되는 프로브를 추가적으로 포함하는, 조성물.2. The composition of 1., wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 8.
3. 2.에 있어서, 상기 프로브들은 동일한 표지자로 표지된 것인, 조성물.3. The composition of 2., wherein the probes are labeled with the same marker.
4. 1. 내지 3.의 조성물을 포함하는 H5 아형 조류인플루엔자 바이러스 유전자 검사용 진단 키트.4. A diagnostic kit for genetic testing of H5 subtype avian influenza virus comprising the composition of 1. to 3.
5. 다음을 포함하는 H7 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물:5. A composition for detecting a target sequence of H7 subtype avian influenza virus, comprising:
(c) 서열번호 9의 염기서열로 표시되는 프라이머; 및 서열번호 10의 염기서열로 표시되는 프라이머; 또는(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or
(d) 서열번호 12의 염기서열로 표시되는 프라이머; 및 서열번호 13의 염기서열로 표시되는 프라이머;(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;
또는 이들의 조합.or a combination thereof.
6. 5. 에 있어서, 상기 (c)는 서열번호 11의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (d)는 서열번호 14의 염기서열로 표시되는 프로브를 추가적으로 포함하는, 조성물.6. The composition of 5., wherein (c) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 11, and (d) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 14.
7. 6.에 있어서, 상기 프로브들은 동일한 표지자로 표지된 것인, 조성물.7. The composition of 6., wherein the probes are labeled with the same marker.
8. 5. 내지 7.의 조성물을 포함하는 H7 아형 조류인플루엔자 바이러스 유전자 검사용 진단 키트.8. A diagnostic kit for genetic testing of H7 subtype avian influenza virus comprising the composition of 5. to 7.
9. 다음을 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물:9. A composition for detecting a target sequence of H5 and H7 subtype avian influenza virus, comprising:
(a) 서열번호 1의 염기서열로 표시되는 프라이머, 서열번호 2의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 3의 염기서열로 표시되는 프라이머; 또는(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or
(b) 서열번호 5의 염기서열로 표시되는 프라이머, 서열번호 6의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 7의 염기서열로 표시되는 프라이머; (b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;
또는 이들의 조합, 및or combinations thereof, and
(c) 서열번호 9의 염기서열로 표시되는 프라이머; 및 서열번호 10의 염기서열로 표시되는 프라이머; 또는(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or
(d) 서열번호 12의 염기서열로 표시되는 프라이머; 및 서열번호 13의 염기서열로 표시되는 프라이머;(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;
또는 이들의 조합.or a combination thereof.
10. 9.에 있어서, 상기 (a)는 서열번호 4의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (b)는 서열번호 8의 염기서열로 표시되는 프로브를 추가적으로 포함하며, 상기 (c)는 서열번호 11의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (d)는 서열번호 14의 염기서열로 표시되는 프로브를 추가적으로 포함하는, 조성물.10. The method of 9., wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 8, wherein (c) ) is a composition further comprising a probe represented by the nucleotide sequence of SEQ ID NO: 11, wherein (d) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 14.
11. 10.에 있어서, 상기 (a)와 (b)에 추가되는 프로브들은 제1 표지자로 표지된 것이고, 상기 (c)와 (d)에 추가되는 프로브들은 제2 표지자로 표지된 것이며, 상기 제1 표지자와, 제2 표지자는 서로 다른 것인, 조성물.11. The method of 10., wherein the probes added to (a) and (b) are labeled with a first marker, and the probes added to (c) and (d) are labeled with a second marker, and The composition of
12. 9. 내지 11.의 조성물을 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스 유전자 검사용 진단 키트.12. A diagnostic kit for genetic testing of H5 and H7 subtype avian influenza virus comprising the composition of 9. to 11.
13. 12.에 있어서, 상기 진단 키트는 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스를 단일 튜브 내에서 동시 검출하는 것인, 진단 키트.13. The diagnostic kit of 12., wherein the diagnostic kit simultaneously detects H5 subtype avian influenza virus and H7 subtype avian influenza virus in a single tube.
14. (a) 검체에서 RNA를 분리하는 단계; 및14. (a) isolating RNA from the sample; and
(b) 상기 분리된 RNA를 대상으로, 1. 내지 4. 중 어느 하나의 조성물 또는 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H5 아형 조류인플루엔자 바이러스 동시 검사 방법.(b) H5 comprising the step of specifically amplifying and detecting the isolated RNA through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 1. to 4. Simultaneous testing method for subtype avian influenza virus.
15. (a) 검체에서 RNA를 분리하는 단계; 및15. (a) isolating RNA from the sample; and
(b) 상기 분리된 RNA를 대상으로, 5. 내지 8. 중 어느 하나의 조성물 또는 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H7 아형 조류인플루엔자 바이러스 동시 검사 방법.(b) H7 comprising the step of specifically amplifying and detecting the isolated RNA through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 5. to 8. Simultaneous testing method for subtype avian influenza virus.
16. (a) 검체에서 RNA를 분리하는 단계; 및16. (a) isolating RNA from the sample; and
(b) 상기 분리된 RNA를 대상으로, 9. 내지 13. 중 어느 하나의 조성물 또는 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스 동시 검사 방법.(b) targeting the isolated RNA, using the composition or diagnostic kit of any one of 9. to 13. H5 comprising the step of specifically amplifying and detecting a target sequence through multiple real-time one-step RT-PCR reactions and a method for simultaneous testing of H7 subtype avian influenza virus.
17. 16.에 있어서, 상기 (b) 단계의 검출 결과, 제1 표지자의 신호가 확인되면 H5 아형 조류인플루엔자 바이러스의 유전자가 검출된 것으로 판정하고, 제2 표지자의 신호가 확인되면 H7 아형 조류인플루엔자 바이러스의 유전자가 검출된 것으로 판정하는 것인, H5 및 H7 아형 조류인플루엔자 바이러스 동시 검사 방법.17. In 16., when the signal of the first marker is confirmed as a result of the detection in step (b), it is determined that the gene of subtype avian influenza virus H5 is detected, and when the signal of the second marker is confirmed, it is determined that the signal of subtype H7 avian influenza Simultaneous testing method for H5 and H7 subtype avian influenza virus, which determines that the virus gene is detected.
본 발명의 일 양태에 따르면, 본 발명은 다음을 포함하는 H5 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물을 제공한다:According to one aspect of the present invention, the present invention provides a composition for detecting a target sequence of H5 subtype avian influenza virus comprising:
(a) 서열번호 1의 염기서열로 표시되는 프라이머, 서열번호 2의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 3의 염기서열로 표시되는 프라이머; 또는(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or
(b) 서열번호 5의 염기서열로 표시되는 프라이머, 서열번호 6의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 7의 염기서열로 표시되는 프라이머; (b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;
또는 이들의 조합.or a combination thereof.
본 발명의 일 구현예에 있어서, 상기 (a)는 서열번호 4의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (b)는 서열번호 8의 염기서열로 표시되는 프로브를 추가적으로 포함한다.In one embodiment of the present invention, (a) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 8.
본 발명의 다른 구현예에 있어서, 상기 프로브들은 동일한 표지자로 표지된다.In another embodiment of the present invention, the probes are labeled with the same marker.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음을 포함하는 H7 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물을 제공한다:According to another aspect of the present invention, the present invention provides a composition for detecting a target sequence of H7 subtype avian influenza virus comprising:
(c) 서열번호 9의 염기서열로 표시되는 프라이머; 및 서열번호 10의 염기서열로 표시되는 프라이머; 또는(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or
(d) 서열번호 12의 염기서열로 표시되는 프라이머; 및 서열번호 13의 염기서열로 표시되는 프라이머;(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;
또는 이들의 조합.or a combination thereof.
본 발명의 일 구현예에 있어서, 상기 (c)는 서열번호 11의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (d)는 서열번호 14의 염기서열로 표시되는 프로브를 추가적으로 포함한다.In one embodiment of the present invention, (c) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 11, and (d) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 14.
본 발명의 다른 구현예에 있어서, 상기 프로브들은 동일한 표지자로 표지된 다.In another embodiment of the present invention, the probes are labeled with the same marker.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 다음을 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물을 제공한다:According to another aspect of the present invention, the present invention provides a composition for detecting a target sequence of H5 and H7 subtype avian influenza virus comprising:
(a) 서열번호 1의 염기서열로 표시되는 프라이머, 서열번호 2의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 3의 염기서열로 표시되는 프라이머; 또는(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1, a primer represented by the nucleotide sequence of SEQ ID NO: 2, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; or
(b) 서열번호 5의 염기서열로 표시되는 프라이머, 서열번호 6의 염기서열로 표시되는 프라이머, 또는 이들의 조합; 및 서열번호 7의 염기서열로 표시되는 프라이머; (b) a primer represented by the nucleotide sequence of SEQ ID NO: 5, a primer represented by the nucleotide sequence of SEQ ID NO: 6, or a combination thereof; and a primer represented by the nucleotide sequence of SEQ ID NO: 7;
또는 이들의 조합, 및or combinations thereof, and
(c) 서열번호 9의 염기서열로 표시되는 프라이머; 및 서열번호 10의 염기서열로 표시되는 프라이머; 또는(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; or
(d) 서열번호 12의 염기서열로 표시되는 프라이머; 및 서열번호 13의 염기서열로 표시되는 프라이머;(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13;
또는 이들의 조합.or a combination thereof.
본 발명의 일 구현예에 있어서, 상기 (a)는 서열번호 4의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (b)는 서열번호 8의 염기서열로 표시되는 프로브를 추가적으로 포함하며, 상기 (c)는 서열번호 11의 염기서열로 표시되는 프로브를 추가적으로 포함하고, 상기 (d)는 서열번호 14의 염기서열로 표시되는 프로브를 추가적으로 포함한다.In one embodiment of the present invention, (a) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 8, wherein (c) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 11, and (d) further includes a probe represented by the nucleotide sequence of SEQ ID NO: 14.
본 발명의 다른 구현예에 있어서, 상기 (a)와 (b)에 추가되는 프로브들은 제1 표지자로 표지된 것이고, 상기 (c)와 (d)에 추가되는 프로브들은 제2 표지자로 표지된 것이며, 상기 제1 표지자와, 제2 표지자는 서로 다른 것이다.In another embodiment of the present invention, the probes added to (a) and (b) are labeled with a first marker, and the probes added to (c) and (d) are labeled with a second marker , The first marker and the second marker are different from each other.
본 발명의 구체적인 구현예에 있어서, H5 및/또는 H7 아형 조류인플루엔자 바이러스 검출을 위한 조성물의 조성은 실시간 원스텝 RT-PCR 반응당 서열번호 1의 핵산을 2-8 pmole, 서열번호 2의 핵산을 3-9 pmole, 서열번호 3의 핵산을 2-8 pmole, 서열번호 4의 핵산을 2-8 pmole, 서열번호 5의 핵산을 2-8 pmole, 서열번호 6의 핵산을 2-8 pmole, 서열번호 7의 핵산을 2-8 pmole, 서열번호 8의 핵산을 2-8 pmole, 서열번호 9의 핵산을 2-8 pmole, 서열번호 10의 핵산을 2-8 pmole, 서열번호 11의 핵산을 0.5-4.5 pmole, 서열번호 12의 핵산을 2-8 pmole, 서열번호 13의 핵산을 0.5-6.5 pmole 및 서열번호 14의 핵산을 0.5-6.5 pmole의 농도로 포함한다. In a specific embodiment of the present invention, the composition of the composition for detecting H5 and/or H7 subtype avian influenza virus contains 2-8 pmoles of the nucleic acid of SEQ ID NO: 1 and 3 of the nucleic acid of SEQ ID NO: 2 per real-time one-step RT-PCR reaction. -9 pmole, 2-8 pmole of nucleic acid of SEQ ID NO: 3, 2-8 pmole of nucleic acid of SEQ ID NO: 4, 2-8 pmole of nucleic acid of SEQ ID NO: 5, 2-8 pmole of nucleic acid of SEQ ID NO: 6, SEQ ID NO: 2-8 pmole of nucleic acid of 7, 2-8 pmole of nucleic acid of SEQ ID NO: 8, 2-8 pmole of nucleic acid of SEQ ID NO: 9, 2-8 pmole of nucleic acid of SEQ ID NO: 10, 0.5- of nucleic acid of SEQ ID NO: 11 It contains 4.5 pmoles, 2-8 pmoles of the nucleic acid of SEQ ID NO: 12, 0.5-6.5 pmoles of the nucleic acid of SEQ ID NO: 13, and 0.5-6.5 pmoles of the nucleic acid of SEQ ID NO: 14.
본 발명의 보다 구체적인 구현예에 있어서, H5 및/또는 H7 아형 조류인플루엔자 바이러스 검출을 위한 조성물의 조성은 실시간 원스텝 RT-PCR 반응당 서열번호 1의 핵산을 5 pmole, 서열번호 2의 핵산을 6 pmole, 서열번호 3의 핵산을 5 pmole, 서열번호 4의 핵산을 5 pmole, 서열번호 5의 핵산을 5 pmole, 서열번호 6의 핵산을 5 pmole, 서열번호 7의 핵산을 5 pmole, 서열번호 8의 핵산을 5 pmole, 서열번호 9의 핵산을 5 pmole, 서열번호 10의 핵산을 5 pmole, 서열번호 11의 핵산을 1.5 pmole, 서열번호 12의 핵산을 5 pmole, 서열번호 13의 핵산을 3.5 pmole 및 서열번호 14의 핵산을 3.5 pmole이 사용되도록 프라이머 및 프로브들을 혼합한 것이다.In a more specific embodiment of the present invention, the composition of the composition for detecting H5 and/or H7 subtype avian influenza virus is 5 pmoles of the nucleic acid of SEQ ID NO: 1 and 6 pmoles of the nucleic acid of SEQ ID NO: 2 per real-time one-step RT-PCR reaction , 5 pmoles of the nucleic acid of SEQ ID NO: 3, 5 pmoles of the nucleic acid of SEQ ID NO: 4, 5 pmoles of the nucleic acid of SEQ ID NO: 5, 5 pmoles of the nucleic acid of SEQ ID NO: 6, 5 pmoles of the nucleic acid of SEQ ID NO: 7, the nucleic acid of SEQ ID NO: 8 5 pmoles of the nucleic acid, 5 pmoles of the nucleic acid of SEQ ID NO: 9, 5 pmoles of the nucleic acid of SEQ ID NO: 10, 1.5 pmoles of the nucleic acid of SEQ ID NO: 11, 5 pmoles of the nucleic acid of SEQ ID NO: 12, 3.5 pmoles of the nucleic acid of SEQ ID NO: 13 and The nucleic acid of SEQ ID NO: 14 is a mixture of primers and probes so that 3.5 pmol is used.
본 발명의 상기 프라이머/프로브 세트에 있어서, 서열번호 1 내지 4는 H5 아형 조류인플루엔자 바이러스의 HA 유전자에 있어 3'말단 (3'-end)쪽 검출 부위를 위한 프라이머/프로브 세트이며, 서열번호 5 내지 8은 H5 아형 조류인플루엔자 바이러스의 HA 유전자에 있어 5'말단 (5'-end)쪽 검출 부위를 위한 프라이머/프로브 세트이다. 또한, 서열번호 9 내지 11은 H7 아형 조류인플루엔자 바이러스의 HA 유전자에 있어 3'말단쪽 검출 부위를 위한 프라이머/프로브 세트이며, 서열번호 12 내지 14는 H7 아형 조류인플루엔자 바이러스의 HA 유전자에 있어 5'말단쪽 검출 부위를 위한 프라이머/프로브 세트이다.In the primer/probe set of the present invention, SEQ ID NOs: 1 to 4 are primers/probe sets for the detection site at the 3'-end (3'-end) side of the HA gene of subtype H5 avian influenza virus, and SEQ ID NO: 5 to 8 are primers/probe sets for the detection site at the 5'-end (5'-end) side of the HA gene of subtype H5 avian influenza virus. In addition, SEQ ID NOs: 9 to 11 are primers/probe sets for the detection site at the 3' end of the HA gene of subtype H7 avian influenza virus, and SEQ ID NOs: 12 to 14 are 5' in the HA gene of subtype H7 avian influenza virus. Primer/probe set for the terminal detection site.
본 발명에서 사용되는 용어 "조류인플루엔자 바이러스 (avian influenza virus)"는 닭, 칠면조, 오리, 야생 조류 등에서 조류인플루엔자를 유발할 수 있는 원인 바이러스를 의미한다. 조류인플루엔자 바이러스는 표면 항원들을 암호화하고 있는 HA 유전자 및 NA 유전자에 따라 HA는 16종, NA는 9종으로 나누어지는 등 그 아형이 다양하며, 다른 아형 간에 교차 방어가 되지 않는다고 알려져 있다. 조류인플루엔자 바이러스의 다양한 아형 중 현재까지 발생한 고병원성 조류인플루엔자는 모두 H5 또는 H7 아형에 의한 것으로 알려져 있다.As used herein, the term "avian influenza virus" refers to a virus that can cause avian influenza in chickens, turkeys, ducks, wild birds, and the like. Avian influenza virus has various subtypes, such as 16 types of HA and 9 types of NA depending on the HA gene and NA gene encoding surface antigens, and it is known that there is no cross-protection between different subtypes. Among various subtypes of avian influenza viruses, it is known that all of the highly pathogenic avian influenza that have occurred so far are caused by subtypes H5 or H7.
본 발명에서 사용되는 용어 "다중 실시간 원스텝 RT-PCR (multiplexed real-time one-step RT-PCR)"은 각각의 의미를 가지는 PCR, RT-PCR, 원스텝 RT-PCR, 실시간 (RT-)PCR 및 다중 (RT-)PCR의 총합을 의미한다. 각각의 의미를 살펴보면, PCR은 DNA의 특정 영역을 시험관 내에서 대량으로 증폭하는 기술을 의미하며, RT-PCR은 시험관 내에서 RNA를 DNA로 역전사시킨 다음, 이렇게 만들어진 상보적 DNA (complementary DNA; cDNA)의 특정 영역을 대량으로 증폭하는 기술을 의미한다. 원스텝 RT-PCR은 cDNA를 만드는 역전사 과정과 cDNA의 특정 영역을 대량으로 복제하는 증폭 과정이 하나의 시험관 내에서 이루어지는 것을 의미하고, 실시간 (RT-)PCR은 특정 영역 증폭의 결과가 실시간으로 모니터링되는 것을 의미하며, 다중 (RT-)PCR은 한 번의 반응 수행으로 동시에 2개 이상의 다른 특정 영역들을 대량으로 증폭하는 것을 의미한다. 다중 실시간 원스텝 RT-PCR을 통해 경제적으로 빠르고 간편하게 조류인플루엔자 바이러스 검출 여부 및 아형 감별 진단을 할 수 있다.The term "multiplexed real-time one-step RT-PCR (multiplexed real-time one-step RT-PCR)" used in the present invention is PCR, RT-PCR, one-step RT-PCR, real-time (RT-)PCR and Means the sum of multiple (RT-)PCRs. Looking at the meanings of each, PCR refers to a technique for amplifying a specific region of DNA in a large amount in vitro. ) refers to a technology that amplifies a specific area in large quantities. One-step RT-PCR means that the reverse transcription process to make cDNA and the amplification process to clone a specific region of cDNA in large quantities are performed in one in vitro, and real-time (RT-)PCR is a system in which the results of amplification of a specific region are monitored in real time. In other words, multiplex (RT-)PCR means to amplify two or more different specific regions in a large amount at the same time by performing one reaction. Through multiple real-time, one-step RT-PCR, it is possible to economically, quickly, and conveniently diagnose avian influenza virus detection and subtype differential diagnosis.
본 발명에서 사용되는 용어 "프라이머 (primer)"는 주형 (template) 핵산에 상보적으로 결합하여 합성을 위한 시발점으로 기능하는 자유 3'-수산화기 (free 3'-hydroxyl group)를 가지는 짧은 핵산 단편을 의미한다. 프라이머는 적절한 반응 완충 용액 (buffer) 및 온도에서 중합 반응을 위한 효소 [DNA 중합 효소 (DNA polymerase), 역전사 효소 (reverse transcriptase) 등] 및 상이한 4가지 데옥시뉴클레오사이드 트리포스페이트 (deoxynucleoside triphosphates; dNTPs)의 존재 하에서 주형에 상보적인 가닥의 합성을 개시할 수 있는데, 프라이머 길이 및 반응 조건 등은 당업계에 공지된 것을 기초로 변형할 수 있다. 프라이머는 필요할 경우 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있으며, 표지의 예로는 효소, 방사선 동위원소, 형광성 분자, 화학 그룹 등이 있다.As used herein, the term "primer" refers to a short nucleic acid fragment having a free 3'-hydroxyl group that complementarily binds to a template nucleic acid and functions as a starting point for synthesis. it means. The primer contains enzymes [DNA polymerase, reverse transcriptase, etc.] for the polymerization reaction at an appropriate reaction buffer solution and temperature, and four different deoxynucleoside triphosphates (dNTPs). ) can initiate the synthesis of a strand complementary to the template, and the primer length and reaction conditions can be modified based on those known in the art. The primer may contain, if necessary, a label that is directly or indirectly detectable by spectroscopic, photochemical, biochemical, immunochemical or chemical means, and examples of the label include enzymes, radioisotopes, fluorescent molecules, chemical groups, etc. There is this.
본 발명에 있어서, 상기 프라이머는 H5 또는 H7 아형 조류인플루엔자 바이러스를 검출할 수 있는 한 특별히 이에 제한되지 않으나, 바람직하게는 서열번호 1 내지 3, 서열번호 5 내지 7, 서열번호 9와 10 및 서열번호 12와 13의 올리고뉴클레오티드 (oligonucleotide)들을 사용할 수 있다.In the present invention, the primer is not particularly limited as long as it can detect H5 or H7 subtype avian influenza virus, but preferably SEQ ID NOs: 1 to 3, SEQ ID NOs: 5 to 7, SEQ ID NOs: 9 and 10 and SEQ ID NOs: 12 and 13 oligonucleotides can be used.
본 발명에서 사용되는 용어 "프로브 (probe)"는 혼성화 (hybridization)에 의해 상보적인 목적 핵산 서열의 존재를 검출하는데 사용되어지는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 DNA 또는 RNA 핵산 단편을 의미하는데, 올리고뉴클레오티드 프로브, 단일 가닥 DNA 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 프로브는 해당 염기서열의 5'과 3'말단에 각각 검출에 이용되는 표지자를 포함할 수 있으며, 이러한 표지자로는 형광단 (fluorophore)과 소광체 (quencher)가 각각 5'과 3'말단에 표지될 수 있다. 이에 따라, 프로브에 형광단과 소광체가 서로 결합한 형태로 존재할 때에는 상호 간섭에 의해 발광이 억제되고, PCR 반응 등을 통해 프로브의 분해가 이루어지면 프로브에 표지된 형광단과 소광체 간의 간섭이 사라져 발광을 하게 된다. 상기 5'말단에 표지될 수 있는 형광단은 당업계에서 통상적으로 사용되는 형광 물질이 제한 없이 사용될 수 있는데, 예를 들면 플루오레세인 (Fluorescein), 6-카르복시플루오레세인 (6-Carboxyfluorescein; FAM), 핵사클로로-6-카르복시플루오레세인 (Hexachloro-6-carboxyfluorescein; HEX), 테트라클로로-6-카르복시플루오레세인 (Tetrachloro-6-carboxyfluorescein), VIC, JOE, 5-(2'-아미노에틸)아미노 나프탈렌-1-술폰산 (5-(2'-Aminoethyl)amino naphthalene-1-sulfonic acid), 쿠마린 (Coumarin) 및 이의 유도체, 시아닌-5 (Cyanine-5; Cy5), 텍사스 레드 (Texas Red), 테트라메틸로다민 (Tetramethylrhodamine), 칼 플루오르 레드 610 (CAL Fluor Red 610), 엘씨 레드 610 (LC Red 610) 등이 사용될 수 있다. 상기 3'말단에 표지될 수 있는 소광체 또한 당업계에서 통상적으로 사용되는 소광제가 제한 없이 사용될 수 있는데, 예를 들면 테트라메틸로다민, 6-카르복시테트라메틸로다민 (6-Carboxytetramethylrhodamine), BHQ-1, BHQ-2, BHQ-3, 4-다이메틸아미노페닐아조페닐-4'-말레이미드 (4-Dimethylaminophenylazophenyl-4'-maleimide) 등이 사용될 수 있다. 이처럼 형광 물질이 표지된 프로브를 사용하여 실시간 (RT-)PCR을 수행하면, 증폭된 산물을 실시간으로 모니터링할 수 있고, DNA 및 RNA의 정량이 가능하며, 전기영동이 필요 없어 빠르고 간편하게 정확한 진단이 가능하다는 장점을 갖는다.As used herein, the term "probe" refers to a DNA or RNA nucleic acid fragment corresponding to a short number of bases to several hundred bases, which is used to detect the presence of a complementary target nucleic acid sequence by hybridization. Meaning, it may be prepared in the form of an oligonucleotide probe, a single-stranded DNA probe, an RNA probe, or the like. The probe may include a marker used for detection at the 5' and 3' ends of the corresponding nucleotide sequence, respectively. As these markers, a fluorophore and a quencher are labeled at the 5' and 3' ends, respectively. can be Accordingly, when the fluorophore and the quencher are bound to the probe, light emission is suppressed by mutual interference, and when the probe is decomposed through a PCR reaction, the interference between the fluorophore and the quencher labeled on the probe disappears to emit light. do. The fluorophore capable of being labeled at the 5' end may be a fluorescent material commonly used in the art without limitation, for example, fluorescein (Fluorescein), 6-carboxyfluorescein (6-Carboxyfluorescein; FAM). ), hexachloro-6-carboxyfluorescein (HEX), tetrachloro-6-carboxyfluorescein (Tetrachloro-6-carboxyfluorescein), VIC, JOE, 5- (2'-aminoethyl )Amino naphthalene-1-sulfonic acid (5-(2'-Aminoethyl)amino naphthalene-1-sulfonic acid), Coumarin and its derivatives, Cyanine-5 (Cyanine-5; Cy5), Texas Red (Texas Red) , Tetramethylrhodamine, Cal Fluor Red 610 (CAL Fluor Red 610), LC Red 610 (LC Red 610), etc. may be used. The quencher that can be labeled at the 3' end may also be used without limitation, a quencher commonly used in the art, for example, tetramethylrhodamine, 6-carboxytetramethylrhodamine (6-Carboxytetramethylrhodamine), BHQ- 1, BHQ-2, BHQ-3, 4-dimethylaminophenylazophenyl-4'-maleimide, etc. may be used. In this way, if real-time (RT-)PCR is performed using a probe labeled with a fluorescent substance, the amplified product can be monitored in real time, DNA and RNA can be quantified, and electrophoresis is not required, making accurate diagnosis quick and easy. It has the advantage of being able to
본 발명에 있어서, 상기 프로브는 H5 또는 H7 아형 조류인플루엔자 바이러스를 검출할 수 있는 한 특별히 이에 제한되지 않으나, 바람직하게는 서열번호 4, 서열번호 8, 서열번호 11 및 서열번호 14의 올리고 뉴클레오티드들을 사용할 수 있다.In the present invention, the probe is not particularly limited as long as it can detect H5 or H7 subtype avian influenza virus, but preferably oligonucleotides of SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 11 and SEQ ID NO: 14 are used. can
상기 프라이머 및 프로브는 기본 성질을 변화시키지 않는 추가의 특징을 혼입하는 것이 가능하다. 즉, 본 발명에서 목적으로 하는 H5 및 H7 아형 조류인플루엔자 바이러스를 검출할 수 있는 효과를 나타내는 한, 당업계에 공지된 통상적인 수단을 이용하여 프라이머 및 프로브가 변형될 수 있다.It is possible that the primers and probes incorporate additional features that do not change their basic properties. That is, the primers and probes may be modified using conventional means known in the art as long as they exhibit the effect of detecting H5 and H7 subtype avian influenza viruses targeted in the present invention.
본 명세서에서는 프라이머 및 프로브의 염기서열을 나타냄에 있어 국제 생화학 연합 (International Union of Biochemistry; IUB) 중의성 코드 (ambiguity code)를 사용하였다. 염기서열에서 A는 아데닌 (adenine)을, C는 시토신 (cytosine)을, G는 구아닌 (guanine)을, T는 티민 (thymine)을, R은 아데닌과 구아닌 둘 다 가능한 자리를, Y는 시토신과 티민 둘 다 가능한 자리를, K는 구아닌과 티민 둘 다 가능한 자리를 나타낸다. 이는 본 명세서의 모든 염기서열을 제시하는 데에 있어 동일하게 적용되었다.In the present specification, the International Union of Biochemistry (IUB) ambiguity code was used to indicate the nucleotide sequences of primers and probes. In the nucleotide sequence, A is adenine, C is cytosine, G is guanine, T is thymine, R is both adenine and guanine possible sites, Y is cytosine and Both thymine are possible sites, and K stands for both guanine and thymine possible sites. This was equally applied in presenting all the nucleotide sequences of the present specification.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 상기 서열번호 1의 염기서열로 표시되는 프라이머, 서열번호 2의 염기서열로 표시되는 프라이머, 서열번호 3의 염기서열로 표시되는 프라이머, 서열번호 4의 염기서열로 표시되는 프로브, 서열번호 5의 염기서열로 표시되는 프라이머, 서열번호 6의 염기서열로 표시되는 프라이머, 서열번호 7의 염기서열로 표시되는 프라이머, 서열번호 8의 염기서열로 표시되는 프로브, 서열번호 9의 염기서열로 표시되는 프라이머, 서열번호 10의 염기서열로 표시되는 프라이머, 서열번호 11의 염기서열로 표시되는 프로브, 서열번호 12의 염기서열로 표시되는 프라이머, 서열번호 13의 염기서열로 표시되는 프라이머 및 서열번호 14의 염기서열로 표시되는 프로브를 모두 포함하는, 시료 중의 H5 및 H7 아형 조류인플루엔자 바이러스의 표적 서열을 특이적으로 증폭 검출하기 위한 다중 실시간 원스텝 RT-PCR용 조성물을 제공한다.According to another aspect of the present invention, the present invention provides a primer represented by the base sequence of SEQ ID NO: 1, a primer represented by the base sequence of SEQ ID NO: 2, a primer represented by the base sequence of SEQ ID NO: 3, SEQ ID NO: 4 A probe represented by the base sequence of The probe, the primer represented by the nucleotide sequence of SEQ ID NO: 9, the primer represented by the nucleotide sequence of SEQ ID NO: 10, the probe represented by the nucleotide sequence of SEQ ID NO: 11, the primer represented by the nucleotide sequence of SEQ ID NO: 12, SEQ ID NO: 13 Multiple real-time one-step RT-PCR composition for specifically amplifying and detecting the target sequence of H5 and H7 subtype avian influenza virus in a sample, including both the primer represented by the nucleotide sequence and the probe represented by the nucleotide sequence of SEQ ID NO: 14 provides
본 발명의 조성물은 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스의 단일 튜브 내 동시 검사를 위한 다중 올리고 혼합 조성물로서, 특히 각 아형의 검출을 위해 서로 다른 위치에 결합하는 프라이머/프로브 2 세트씩을 포함시켜 검출 시 민감도 및 커버리지를 높이는 동시에 하나의 검출 부위에 문제가 생기더라도 다른 하나의 검출 부위를 통해 검출이 이루어지도록 하여 향후 발생할 수 있는 변이에 의한 영향을 덜 받도록 하는 것을 특징으로 한다.The composition of the present invention is a multi-oligo mixture composition for simultaneous testing of subtype H5 avian influenza virus and subtype H7 avian influenza virus in a single tube, and in particular includes two sets of primers/probes binding to different positions for detection of each subtype This is characterized in that the sensitivity and coverage are increased during detection, and at the same time, even if there is a problem in one detection site, detection is made through the other detection site, so that it is less affected by mutations that may occur in the future.
본 발명의 일 양태에 따르면, 본 발명은 상술한 H5 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물을 포함하는 H5 아형 조류인플루엔자 바이러스 유전자 검사용 진단 키트를 제공한다.According to one aspect of the present invention, the present invention provides a diagnostic kit for gene test for H5 subtype avian influenza virus, comprising the composition for detecting the target sequence of the H5 subtype avian influenza virus described above.
본 발명의 다른 일 양태에 따르면, 본 발명은 상술한 H7 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물을 포함하는 H7 아형 조류인플루엔자 바이러스 유전자 검사용 진단 키트를 제공한다.According to another aspect of the present invention, the present invention provides a diagnostic kit for genetic testing of H7 subtype avian influenza virus, comprising the composition for detecting the target sequence of the H7 subtype avian influenza virus described above.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 상술한 H5 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물 및 H7 아형 조류인플루엔자 바이러스의 표적서열 검출용 조성물을 모두 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스 유전자 검사용 진단 키트를 제공한다.According to another aspect of the present invention, the present invention provides H5 and H7 subtype avian influenza virus genes including both the composition for detecting the target sequence of the H5 subtype avian influenza virus and the composition for detecting the target sequence of the H7 subtype avian influenza virus. A diagnostic kit for testing is provided.
상기 유전자 검사용 진단 키트는 구체적으로 시료 중의 H5 및 H7 아형 조류인플루엔자 바이러스 검사용 다중 실시간 원스텝 RT-PCR 진단 키트이다.The diagnostic kit for genetic testing is specifically a multi-real-time, one-step RT-PCR diagnostic kit for testing H5 and H7 subtype avian influenza viruses in a sample.
본 발명의 진단 키트는 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스의 감염 여부 확인 및 아형 감별을 경제적으로 빠르고 간편하게 수행하기 위한 다중 실시간 원스텝 RT-PCR 진단 키트로서, 상기 조성물에 포함되는 서열번호 1 내지 14 중 1 이상의 프라이머 및 프로브 뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 포함할 수 있다.The diagnostic kit of the present invention is a multi-real-time one-step RT-PCR diagnostic kit for economically, quickly and conveniently performing confirmation of infection and subtype differentiation of H5 subtype avian influenza virus and H7 subtype avian influenza virus, SEQ ID NO: 1 included in the
구체적인 일례로서, 본 발명의 진단 키트는 역전사 반응 및 PCR 분석을 수행하기 위해 필요한 필수 요소를 포함할 수 있다. 상기 진단 키트는 각 검출 부위에 대한 특이적인 각각의 프라이머/프로브 세트 외에도 조류인플루엔자 바이러스 RNA로부터 cDNA를 합성하기 위한 역전사 효소, cDNA의 특정 영역을 대량으로 증폭하기 위한 DNA 중합 효소, 반응 완충 용액, dNTPs, RNA 분해 효소 억제제 (RNase inhibitor), 멸균수, 테스트 튜브 또는 다른 적절한 용기 등을 포함할 수 있다.As a specific example, the diagnostic kit of the present invention may include essential elements necessary for performing the reverse transcription reaction and PCR analysis. In addition to each primer/probe set specific for each detection site, the diagnostic kit includes a reverse transcriptase for synthesizing cDNA from avian influenza virus RNA, a DNA polymerase for amplifying a specific region of cDNA in large quantities, a reaction buffer solution, and dNTPs. , RNase inhibitor, sterile water, test tube or other suitable container.
본 발명에서 각 테스트 튜브에 포함되는 성분들로는, 이에 국한되지 않지만, H5 및 H7 아형 조류인플루엔자 바이러스 동시 검사를 위한 다중 올리고 혼합 조성물, DNA 중합 효소, 역전사 효소, RNA 분해 효소 억제제, dATP, dCTP, dGTP, dTTP, Tris-HCl, MgCl2, KCl, BSA, 핵산 분해 효소 제거수 (nuclease-free water) 등이 있으며, 특정 반응을 위해 사용되는 성분 또는 반응물의 최적량은 당업자에 의해 결정될 수 있다.Components included in each test tube in the present invention include, but are not limited to, a multi-oligo mixture composition for simultaneous testing of H5 and H7 subtype avian influenza virus, DNA polymerase, reverse transcriptase, RNA degrading enzyme inhibitor, dATP, dCTP, dGTP , dTTP, Tris-HCl,
본 발명의 또 다른 일 양태에 따르면, 본 발명은 상기 진단 키트를 이용하여 시료 중의 H5 및/또는 H7 아형 조류인플루엔자 바이러스를 동시에 검사하는 방법을 제공한다.According to another aspect of the present invention, the present invention provides a method for simultaneously testing H5 and/or H7 subtype avian influenza virus in a sample using the diagnostic kit.
구체적으로 본 발명의 H5 아형 조류인플루엔자 바이러스를 검사하는 방법은 (a) 검체에서 RNA를 분리하는 단계; 및 (b) 상기 분리된 RNA를 대상으로, 1. 내지 4. 중 어느 하나의 조성물 또는 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함한다. Specifically, the method for testing H5 subtype avian influenza virus of the present invention comprises the steps of (a) isolating RNA from a specimen; and (b) specifically amplifying and detecting the target sequence through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 1. to 4. .
또한, 본 발명의 H7 아형 조류인플루엔자 바이러스를 검사하는 방법은 (a) 검체에서 RNA를 분리하는 단계; 및 (b) 상기 분리된 RNA를 대상으로, 5. 내지 8. 중 어느 하나의 조성물 또는 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함한다.In addition, the method for testing H7 subtype avian influenza virus of the present invention comprises the steps of (a) isolating RNA from a specimen; and (b) specifically amplifying and detecting the target sequence through multiple real-time one-step RT-PCR reactions using the composition or diagnostic kit of any one of 5. to 8. with respect to the isolated RNA. .
또한, 본 발명의 H5 및 H7 아형 조류인플루엔자 바이러스를 동시에 검사하는 방법은 구체적으로, (a) 조류인플루엔자 바이러스 감염이 의심되는 동물로부터의 검체에서 RNA를 분리하는 단계; 및 (b) 상기 분리된 RNA를 대상으로, 상기 H5 및 H7 아형 조류인플루엔자 바이러스 검출용 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함한다.In addition, the method for simultaneously testing H5 and H7 subtype avian influenza virus of the present invention specifically comprises the steps of: (a) isolating RNA from a specimen from an animal suspected of being infected with avian influenza virus; and (b) specifically amplifying and detecting the target sequence from the isolated RNA through multiple real-time one-step RT-PCR reactions using the diagnostic kit for detecting H5 and H7 subtype avian influenza virus.
본 발명의 바람직한 구현예에 따르면, 상기 검체는 조류, 가축 및 인간으로 이루어진 군으로부터 선택될 수 있으며, 이로부터 분리된 혈액, 혈청, 혈장, 분변, 조직 등을 포함한다.According to a preferred embodiment of the present invention, the specimen may be selected from the group consisting of birds, livestock, and humans, and includes blood, serum, plasma, feces, tissues, etc. isolated therefrom.
본 발명에 따르면, 당업계에서의 공지의 방법에 따라 검체에서 RNA를 추출한 다음, 추출된 RNA를 함유한 추출액에 본 발명의 프라이머/프로브 세트들로 이루어진 조성물을 포함하는 진단 키트를 이용하여 단일 튜브에서 다중 실시간 원스텝 RT-PCR을 실시한다. 증폭 및 검출의 결과는 실시간으로 확인되는데, 예를 들어 서열번호 4와 서열번호 8의 프로브들에 공통으로 표지된 형광 물질의 발광이 확인되면, 이는 검체 내에 조류인플루엔자 바이러스가 존재하며 그 아형은 H5임을 의미하고, 마찬가지 방식으로 서열번호 11과 서열번호 14의 프로브들에 공통으로 표지된 형광 물질의 발광이 확인되면, 이는 검체 내에 조류인플루엔자 바이러스가 존재하며 그 아형은 H7임을 의미한다. 즉, 검체 내의 H5 및 H7 아형 조류인플루엔자 바이러스 검출 여부와 함께 H5 또는 H7 아형에 대한 감별이 가능하다.According to the present invention, RNA is extracted from a sample according to a method known in the art, and then a single tube is used using a diagnostic kit comprising a composition consisting of the primer/probe sets of the present invention in an extract containing the extracted RNA. Perform multiple real-time one-step RT-PCR in The results of amplification and detection are confirmed in real time. For example, when the emission of a fluorescent material commonly labeled with the probes of SEQ ID NO: 4 and SEQ ID NO: 8 is confirmed, avian influenza virus is present in the sample and its subtype is H5 In the same way, when the emission of a fluorescent material commonly labeled with the probes of SEQ ID NO: 11 and SEQ ID NO: 14 is confirmed, this means that the avian influenza virus is present in the sample and its subtype is H7. That is, it is possible to differentiate between H5 and H7 subtypes together with whether H5 and H7 subtype avian influenza viruses are detected in the sample.
본 발명에서는 H5 아형 조류인플루엔자 바이러스를 특이적으로 증폭 검출할 수 있는 신규한 프라이머/프로브 세트들 및 H7 아형 조류인플루엔자 바이러스를 특이적으로 증폭 검출할 수 있는 신규한 프라이머/프로브 세트들을 설계하고, 상기 프라이머/프로브 세트들로 이루어진 조성물 및 이를 포함하는 진단 키트를 이용하여 H5 아형 조류인플루엔자 바이러스 및 H7 아형 조류인플루엔자 바이러스를 동시에 선택적으로 진단할 수 있음을 확인하였다. 본 발명의 조성물 및 이를 포함하는 진단 키트는 단일 튜브 내 다중 실시간 원스텝 RT-PCR 반응을 통해 경제적으로 빠르고 간편하게 검사를 할 수 있도록 구성되어 있으며, 각 아형에 대해 프라이머/프로브 2 세트씩이 작용하여 검출 시 민감도 및 커버리지를 높이는 동시에 향후 발생할 수 있는 변이에 의한 영향을 덜 받도록 제작되어 있으므로, H5 및 H7 아형 조류인플루엔자 바이러스 검출 여부 및 아형 감별에 유용하게 이용될 수 있을 것이다.In the present invention, novel primer/probe sets capable of specifically amplifying and detecting subtype H5 avian influenza virus and novel primer/probe sets capable of specifically amplifying and detecting subtype avian influenza virus H7 are designed, It was confirmed that H5 subtype avian influenza virus and H7 subtype avian influenza virus could be selectively diagnosed at the same time by using a composition consisting of primer/probe sets and a diagnostic kit including the same. The composition of the present invention and a diagnostic kit containing the same are configured to enable economical, fast and convenient testing through multiple real-time, one-step RT-PCR reactions in a single tube, and two sets of primers/probes are activated for each subtype to detect Since it is designed to increase visual sensitivity and coverage while being less affected by mutations that may occur in the future, it may be usefully used to detect H5 and H7 subtype avian influenza viruses and to differentiate subtypes.
본 발명의 H5 및 H7 아형 조류인플루엔자 바이러스 검출용 조성물 및 이를 포함하는 진단 키트를 이용하면, 단일 튜브에서 한 번의 원스텝 RT-PCR 반응만으로 고병원성 조류인플루엔자를 일으킬 가능성이 있는 H5 및 H7 아형 조류인플루엔자 바이러스 감염 자체뿐만 아니라 상기 바이러스 아형에 대한 확인을 빠르고 간편하면서도 매우 높은 신뢰도로 동시에 검사할 수 있으므로, 조류인플루엔자 바이러스의 감염 진단과 이를 이용한 조류인플루엔자 모니터링에 유용하게 사용될 수 있다. 또한, 각 아형의 검출을 위해 서로 다른 위치의 프라이머/프로브 2 세트씩을 사용하는 본 발명의 H5 및 H7 아형 조류인플루엔자 바이러스 검출용 조성물 및 이를 포함하는 진단 키트를 이용하면, 검출 시 민감도 및 커버리지가 높을 뿐만 아니라 하나의 검출 부위에 문제가 생기더라도 다른 하나의 검출 부위를 통해 검출이 이루어져 향후 발생할 수 있는 변이에 의한 영향이 단일 검출 부위만을 대상으로 하는 진단 키트에 비해 상대적으로 적을 것이므로, H5 및 H7 아형 조류인플루엔자 바이러스의 정확한 진단이 가능하다. 따라서, 본 발명을 조류인플루엔자 바이러스 정밀 진단에 적용하여 H5 및 H7 아형 조류인플루엔자 바이러스를 신속, 정확하게 진단함으로써, 가금 산업의 피해를 최소화하고 국가 방역에 크게 기여할 수 있을 것으로 예상된다.Using the composition for detecting H5 and H7 subtype avian influenza virus of the present invention and a diagnostic kit comprising the same, infection with H5 and H7 subtype avian influenza virus that is likely to cause highly pathogenic avian influenza with only one one-step RT-PCR reaction in a single tube Since it is possible to simultaneously test not only itself but also the virus subtype quickly, simply, and with very high reliability, it can be usefully used for diagnosing avian influenza virus infection and monitoring avian influenza using the same. In addition, if the composition for detecting avian influenza virus of H5 and H7 subtypes of the present invention using two sets of primers/probes at different positions for detection of each subtype and a diagnostic kit including the same, sensitivity and coverage are high In addition, even if there is a problem in one detection site, detection is performed through the other detection site, so the effect of mutations that may occur in the future will be relatively small compared to diagnostic kits that target only a single detection site, so the H5 and H7 subtypes Accurate diagnosis of avian influenza virus is possible. Therefore, it is expected that the present invention can be applied to precise diagnosis of avian influenza virus to rapidly and accurately diagnose H5 and H7 subtype avian influenza viruses, thereby minimizing damage to the poultry industry and greatly contributing to national quarantine.
아울러, 상술한 효과 이외의 다양한 효과들이 후술될 본 발명의 실시예에 따른 상세한 설명에서 직접적 또는 암시적으로 개시될 수 있다.In addition, various effects other than the above-described effects may be directly or implicitly disclosed in the detailed description according to the embodiments of the present invention to be described later.
도 1은 본 발명에 따른 프라이머/프로브 세트들로 증폭 검출되는 H5 및 H7 아형 조류인플루엔자 바이러스 유전자 상의 검출 부위들을 표시한 도면이다.
도 2a-2f는 본 발명에 따른 각각의 프라이머/프로브 세트만을 이용한 실시간 원스텝 RT-PCR 반응 결과를 나타낸 도면이다.
도 3a-3g는 본 발명의 모든 프라이머/프로브 세트들을 혼합한 다중 올리고 혼합 조성물을 이용한 다중 실시간 원스텝 RT-PCR 반응 결과를 나타낸 도면이다.
도 4a-4j는 H5 아형 조류인플루엔자 바이러스 양성 시료들로부터의 핵산 추출액의 연속 희석액에서 본 발명의 다중 올리고 혼합 조성물의 기존 프라이머/프로브 세트와의 민감도 비교 테스트 결과를 나타낸 도면이다.
도 5a-5e는 H7 아형 조류인플루엔자 바이러스 양성 시료들로부터의 핵산 추출액의 연속 희석액에서 본 발명의 다중 올리고 혼합 조성물의 기존 프라이머/프로브 세트와의 민감도 비교 테스트 결과를 나타낸 도면이다.
도 6은 본 발명의 다중 올리고 혼합 조성물의 다른 아형들에 대한 특이도 테스트 결과를 나타낸 도면이다.1 is a diagram showing detection sites on H5 and H7 subtype avian influenza virus genes that are amplified and detected with primer/probe sets according to the present invention.
2A-2F are diagrams showing the results of a real-time one-step RT-PCR reaction using only each primer/probe set according to the present invention.
3A-3G are diagrams showing the results of multiple real-time one-step RT-PCR reactions using a multi-oligo mixture composition in which all primer/probe sets of the present invention are mixed.
4a-4j are diagrams showing the sensitivity comparison test results of the multi-oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H5 subtype avian influenza virus positive samples with the existing primer/probe set.
5A-5E are diagrams showing the results of a sensitivity comparison test with the existing primer/probe set of the multi-oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H7 subtype avian influenza virus positive samples.
6 is a view showing the specificity test results for different subtypes of the multi-oligo mixture composition of the present invention.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art to which the present invention pertains that the scope of the present invention is not to be construed as being limited by these examples.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적, 과학적 용어들은 본 발명이 속하는 기술 분야에서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 발명이 속하는 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다. 한편, 본 명세서에서 사용된 용어들은 단지 특정한 실시예를 설명하기 위해 사용된 것으로서, 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한 복수의 표현을 포함한다.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood in the art to which this invention belongs. In general, the nomenclature used herein is that which is well known and commonly used in the art to which this invention pertains. On the other hand, the terms used herein are used only to describe specific embodiments, and are not intended to limit the present invention. The singular expression includes the plural expression unless the context clearly dictates otherwise.
실시예Example 1: H5 및 H7 아형 조류인플루엔자 바이러스 유전자 증폭 검출을 위한 1: H5 and H7 subtypes for the detection of avian influenza virus gene amplification 프라이머primer 및 and 프로브probe 설계 design
본 발명자들은 H5 및 H7 아형 조류인플루엔자 바이러스 유전자의 증폭 검출을 위한 프라이머 및 프로브들을 설계하기 위해, 먼저 GenBank 데이터베이스로부터 2014년 이후 보고된 염기서열들을 중심으로 유라시아 계통에 속하는 H5 및 H7 아형 조류인플루엔자 바이러스의 HA 유전자 염기서열들을 수집하였다. 이어서, 수집된 550여개의 H5 아형 조류인플루엔자 바이러스 HA 유전자 염기서열들을 H5 아형 이외 다른 아형들의 HA 유전자 염기서열들과 함께 정렬한 다음, 유전자의 3'말단 및 5'말단 부위에서 각각 H5 아형 조류인플루엔자 바이러스만 특이적으로 증폭 검출할 수 있는 프라이머/프로브 2 세트를 설계하였다(도 1). 정방향 프라이머 (forward primer)의 경우 변이에 기인한 염기서열의 다양성 때문에 민감도 및 커버리지를 높이기 위해서 프라이머/프로브 1 세트당 2개씩을 설계하였다. 또한, 수집된 250여개의 H7 아형 조류인플루엔자 바이러스 HA 유전자 염기서열들을 H7 아형 이외 다른 아형들의 HA 유전자 염기서열들과 함께 정렬한 다음, 유전자의 3'말단 및 5'말단 부위에서 각각 H7 아형 조류인플루엔자 바이러스만 특이적으로 증폭 검출할 수 있는 프라이머/프로브 2 세트를 설계하였다 (도 1). 각 아형에 대해 프라이머/프로브 2 세트씩을 설계한 이유는 민감도 및 커버리지를 높이는 동시에 하나의 검출 부위에 문제가 생기더라도 다른 하나의 검출 부위를 통해 검출이 이루어지도록 하여 향후 발생할 수 있는 변이에 의한 영향을 덜 받도록 하기 위함이었다.In order to design primers and probes for amplification detection of H5 and H7 subtype avian influenza virus genes, the present inventors first analyzed the H5 and H7 subtype avian influenza viruses belonging to the Eurasian lineage based on the nucleotide sequences reported after 2014 from the GenBank database. HA gene sequences were collected. Then, the 550 subtype avian influenza virus HA gene sequences of the collected H5 subtype were aligned with the HA gene sequences of subtypes other than the H5 subtype, and then, at the 3' and 5' end regions of the gene, H5 subtype avian influenza, respectively. Two sets of primers/probes capable of specifically amplifying and detecting only viruses were designed ( FIG. 1 ). In the case of forward primers, two per primer/probe set were designed to increase sensitivity and coverage due to nucleotide sequence diversity due to mutation. In addition, the HA gene sequences of about 250 collected H7 subtype avian influenza virus were aligned with the HA gene sequences of subtypes other than the H7 subtype, and then, at the 3' and 5' ends of the gene, H7 subtype avian influenza, respectively. Two sets of primers/probes capable of specifically amplifying and detecting only viruses were designed ( FIG. 1 ). The reason for designing two sets of primers/probes for each subtype is to increase sensitivity and coverage while at the same time allowing detection through the other detection site even if there is a problem in one detection site, thereby reducing the effect of mutations that may occur in the future. It was meant to be less.
도 1은 본 발명에 따른 프라이머/프로브 세트들로 증폭 검출되는 H5 및 H7 아형 조류인플루엔자 바이러스 HA 유전자 상의 검출 부위들을 표시한 도면으로서, 각 아형 유전자에 대한 3'말단쪽 검출 부위 및 5'말단쪽 검출 부위가 증폭 산물의 예상 크기와 함께 표시되어 있다.1 is a view showing the detection sites on the H5 and H7 subtype avian influenza virus HA gene amplified and detected with primer/probe sets according to the present invention. The detection site is indicated along with the expected size of the amplification product.
구체적으로, H5 아형 조류인플루엔자 바이러스 HA 유전자의 3'말단쪽 검출 부위를 위해 H5A_F1 (서열번호 1)과 H5A_F2 (서열번호 2)라는 정방향 프라이머들, H5A_R1 (서열번호 3)이라는 역방향 프라이머 (reverse primer) 및 H5A_P1 (서열번호 4)이라는 프로브가 설계되었으며; H5 아형 조류인플루엔자 바이러스 HA 유전자의 5'말단쪽 검출 부위를 위해 H5B_F3 (서열번호 5)와 H5B_F4 (서열번호 6)라는 정방향 프라이머들, H5B_R2 (서열번호 7)라는 역방향 프라이머 및 H5B_P2 (서열번호 8)라는 프로브가 설계되었으며; H7 아형 조류인플루엔자 바이러스 HA 유전자의 3'말단쪽 검출 부위를 위해 H7A_F1 (서열번호 9)이라는 정방향 프라이머, H7A_R1 (서열번호 10)이라는 역방향 프라이머 및 H7A_PS (서열번호 11)라는 프로브가 설계되었으며; H7 아형 조류인플루엔자 바이러스 HA 유전자의 5'말단쪽 검출 부위를 위해 H7B_F2 (서열번호 12)라는 정방향 프라이머, H7B_R2 (서열번호 13)라는 역방향 프라이머 및 H7B_P2 (서열번호 14)라는 프로브가 설계되었다 (표 1). 상기와 같이 설계된 프로브들의 합성 시 5'말단에 형광 물질을 표지시켰는데, H5A_P1 및 H5B_P2는 FAM으로 표지되었고, H7A_PS 및 H7B_P2는 LC Red 610으로 표지되었다. 또한, 프로브들의 합성 시 3'말단에 소광제를 표지시켰는데, H5A_P1 및 H5B_P2는 BHQ-1으로 표지되었고, H7A_PS 및 H7B_P2는 BHQ-2로 표지되었다.Specifically, for the detection site at the 3' end of the H5 subtype avian influenza virus HA gene, forward primers called H5A_F1 (SEQ ID NO: 1) and H5A_F2 (SEQ ID NO: 2), and reverse primers called H5A_R1 (SEQ ID NO: 3) and H5A_P1 (SEQ ID NO: 4) was designed; For the detection site at the 5' end of the H5 subtype avian influenza virus HA gene, forward primers called H5B_F3 (SEQ ID NO: 5) and H5B_F4 (SEQ ID NO: 6), reverse primers called H5B_R2 (SEQ ID NO: 7), and H5B_P2 (SEQ ID NO: 8) The probe was designed; For the detection site at the 3' end of the H7 subtype avian influenza virus HA gene, a forward primer named H7A_F1 (SEQ ID NO: 9), a reverse primer named H7A_R1 (SEQ ID NO: 10), and a probe named H7A_PS (SEQ ID NO: 11) were designed; For the detection site at the 5' end of the H7 subtype avian influenza virus HA gene, a forward primer named H7B_F2 (SEQ ID NO: 12), a reverse primer named H7B_R2 (SEQ ID NO: 13), and a probe named H7B_P2 (SEQ ID NO: 14) were designed (Table 1). ). When the probes designed as described above were synthesized, a fluorescent material was labeled at the 5' end. H5A_P1 and H5B_P2 were labeled with FAM, and H7A_PS and H7B_P2 were labeled with LC Red 610. In addition, a quencher was labeled at the 3' end during the synthesis of the probes. H5A_P1 and H5B_P2 were labeled with BHQ-1, and H7A_PS and H7B_P2 were labeled with BHQ-2.
다음으로, 상기와 같이 설계된 프라이머/프로브 세트들의 가상 환경 분석을 수행하였다. Next, virtual environment analysis of the primer/probe sets designed as described above was performed.
먼저, 예상 검출 커버리지 분석을 수행하였다. H5 아형 조류인플루엔자 바이러스 HA 유전자 검출용 프라이머/프로브 2 세트는 설계 시 사용한 데이터베이스에 대해 99.6% (염기서열 556개 중 554개 검출 가능)의 예상 검출 커버리지를 나타냈고, 농림축산검역본부의 자체 데이터베이스, 최근 국내 분리주들 및 GISAID에서 조회되는 최근 중국 분리주들을 통합한 데이터베이스에 대해서는 99.5% (염기서열 565개 중 562개 검출 가능)의 예상 검출 커버리지를 나타냈다. 또한, H7 아형 조류인플루엔자 바이러스 HA 유전자 검출용 프라이머/프로브 2 세트는 설계 시 사용한 데이터베이스에 대해 100.0% (염기서열 255개 중 255개 검출 가능)의 예상 검출 커버리지를 나타냈고, 농림축산검역본부의 자체 데이터베이스, 최근 국내 분리주들 및 GISAID에서 조회되는 최근 중국 분리주들을 통합한 데이터베이스에 대해 99.8% (염기서열 991개 중 989개 검출 가능)의 예상 검출 커버리지를 나타냈다. First, a predicted detection coverage analysis was performed. Two sets of primers/probes for detecting H5 subtype avian influenza virus HA gene showed an expected detection coverage of 99.6% (554 out of 556 nucleotide sequences detectable) with respect to the database used in the design, and the For the database integrating recent domestic isolates and recent Chinese isolates searched in GISAID, it showed an expected detection coverage of 99.5% (562 out of 565 nucleotide sequences detectable). In addition, 2 sets of primers/probes for detecting H7 subtype avian influenza virus HA gene showed an expected detection coverage of 100.0% (255 out of 255 nucleotide sequences can be detected) with respect to the database used for design, and the Agricultural, Forestry and Livestock Quarantine Headquarters It showed an expected detection coverage of 99.8% (989 out of 991 nucleotide sequences detectable) for the database integrating the database, recent domestic isolates, and recent Chinese isolates searched in GISAID.
이어서, 예상 특이도 분석을 수행하였다. 예상 특이도 분석은 NCBI의 Blast 프로그램을 사용하여 진행되었으며, 정방향 프라이머, 역방향 프라이머, 프로브로 이루어진 각 세트별로 NCBI 데이터베이스 상에서 목적 염기서열을 제외하고 검출될 가능성이 있는 다른 염기서열이 있는지를 확인하는 방법으로 진행되었다. 그 결과, 목적 염기서열을 제외하고 검출될 가능성이 있는 다른 염기서열은 전혀 확인되지 않았으며, 이에 따라 H5 아형 조류인플루엔자 바이러스 검출용 프라이머/프로브 2 세트 및 H7 아형 조류인플루엔자 바이러스 검출용 프라이머/프로브 2 세트 모두 자신 이외 아형들에 대한 특이도에 문제가 없을 것으로 분석되었다.A predicted specificity analysis was then performed. Predicted specificity analysis was performed using NCBI's Blast program, and for each set of forward primer, reverse primer, and probe, it is a method of checking whether there are other sequences that are likely to be detected except the target sequence on the NCBI database proceeded with As a result, other than the target nucleotide sequence, no other nucleotide sequences that could be detected were identified. Accordingly, 2 sets of primers/probes for detecting subtype H5 avian influenza virus and 2 sets of primers/probes for detecting subtype avian influenza virus H7 All sets were analyzed to have no problem with specificity for subtypes other than themselves.
실시예 2: 각 프라이머/프로브 세트별 성능 확인Example 2: Confirmation of performance by each primer/probe set
상기 실시예 1에서 설계된 모든 프라이머 및 프로브들을 합성한 다음, 각 프라이머/프로브 세트별로 표적 핵산을 특이적으로 증폭 검출하는지 여부를 확인하기 위해 실시간 원스텝 RT-PCR 반응을 수행하였다. 실시간 원스텝 RT-PCR 반응을 위한 주형으로는 프라이머/프로브 세트에 따라 시험관 내 전사물 (in vitro transcript) 또는 RNA 추출액을 희석하여 사용하였다. 시험관 내 전사물은 해당 증폭 산물의 앞뒤 염기서열을 포함하여 DNA 단편을 합성한 다음 RNA로의 전사 (transcription) 과정을 통해 얻어진 것이며, RNA 추출액은 해당 조류인플루엔자 바이러스 아형 양성 시료로부터 ㈜제놀루션 NX-48 Viral NA Kit를 사용하여 추출된 것이다. After synthesizing all the primers and probes designed in Example 1, a real-time one-step RT-PCR reaction was performed to confirm whether the target nucleic acid was specifically amplified and detected for each primer/probe set. As a template for the real-time one-step RT-PCR reaction, an in vitro transcript or RNA extract was diluted according to a primer/probe set and used. The in vitro transcript is obtained by synthesizing a DNA fragment including the front and rear nucleotide sequences of the corresponding amplification product and then converting it into RNA. It was extracted using the Viral NA Kit.
각 반응 혼합물 (15 μL)은 상기와 같이 준비된 RNA 주형 5 μL [106, 104 또는 102 카피 (copy)/5 μL], 정방향 프라이머 5 pmole, 역방향 프라이머 5 pmole, 프로브 2.5 pmole, Taq DNA 중합 효소 (Taq DNA polymerase) 1.8 U, 역전사 효소 6 U, RNA 분해 효소 억제제 3 U, 0.16 mM dNTPs, 1X 반응 완충 용액 [75 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 50 mM KCl, 0.3% BSA] 및 핵산 분해 효소 제거수 잔량을 포함하였다. Each reaction mixture (15 μL) contains 5 μL of RNA template prepared as above [10 6 , 10 4 or 10 2 copies/5 μL], 5 pmole of forward primer, 5 pmole of reverse primer, 2.5 pmole of probe, and Taq DNA Polymerase (Taq DNA polymerase) 1.8 U, reverse transcriptase 6 U, RNAse inhibitor 3 U, 0.16 mM dNTPs, 1X reaction buffer [75 mM Tris-HCl (pH 8.0), 5 mM MgCl 2 , 50 mM KCl, 0.3% BSA] and the residual amount of nuclease-removed water.
실시간 원스텝 RT-PCR 반응은 바이오-라드 (Bio-Rad)사의 CFX96 실시간 PCR 기기 (CFX96 Real-time PCR Detection System)를 사용하여 다음과 같은 조건에서 수행하였다: 역전사 단계 50℃ 10분; 전변성 (pre-denaturation) 단계 95℃ 10분; [변성 (denaturation) 단계 95℃ 20초 -> 어닐링/신장 (annealing/extension) 단계 60℃ 30초] X 45회. 음성 대조군의 경우, 핵산 분해 효소 제거수를 RNA 주형 대신 사용하였다.Real-time one-step RT-PCR reaction was performed using a CFX96 Real-time PCR Detection System from Bio-Rad under the following conditions: reverse transcription step 50° C. for 10 minutes; pre-denaturation step 95° C. 10 min; [denaturation step 95° C. 20 seconds -> annealing/extension step 60° C. 30 seconds] X 45 times. For the negative control, nuclease-removed water was used instead of the RNA template.
그 결과, 본 발명의 각 프라이머/프로브 세트들은 목적하는 H5 또는 H7 아형 조류인플루엔자 바이러스 유전자를 특이적으로 증폭시켜서 검출할 수 있음을 확인하였다 (도 2 및 표 2).As a result, it was confirmed that each primer/probe set of the present invention can be detected by specifically amplifying a desired H5 or H7 subtype avian influenza virus gene (FIG. 2 and Table 2).
대조군voice
control
도 2는 본 발명에 따른 각각의 프라이머/프로브 세트만을 이용한 실시간 원스텝 RT-PCR 반응 결과를 나타낸 도면으로서, (a)는 H5 아형 조류인플루엔자 바이러스 유전자의 3'말단쪽 검출 부위를 위한 H5A_F1, H5A_R1 및 H5A_P1으로 구성된 프라이머/프로브 세트의 반응 결과이며; (b)는 H5 아형 조류인플루엔자 바이러스 유전자의 3'말단쪽 검출 부위를 위한 H5A_F2, H5A_R1 및 H5A_P1으로 구성된 프라이머/프로브 세트의 반응 결과이며; 2 is a view showing the results of a real-time one-step RT-PCR reaction using only each primer/probe set according to the present invention, (a) is H5A_F1, H5A_R1 and It is the reaction result of the primer/probe set consisting of H5A_P1; (b) is the reaction result of a primer/probe set consisting of H5A_F2, H5A_R1 and H5A_P1 for the detection site at the 3' end of the H5 subtype avian influenza virus gene;
(c)는 H5 아형 조류인플루엔자 바이러스 유전자의 5'말단쪽 검출 부위를 위한 H5B_F3, H5B_R2 및 H5B_P2로 구성된 프라이머/프로브 세트의 반응 결과이며; (d)는 H5 아형 조류인플루엔자 바이러스 유전자의 5'말단쪽 검출 부위를 위한 H5B_F4, H5B_R2 및 H5B_P2로 구성된 프라이머/프로브 세트의 반응 결과이며; (c) is the reaction result of a primer/probe set consisting of H5B_F3, H5B_R2 and H5B_P2 for the detection site at the 5' end of the H5 subtype avian influenza virus gene; (d) is the reaction result of the primer/probe set consisting of H5B_F4, H5B_R2 and H5B_P2 for the detection site at the 5' end of the H5 subtype avian influenza virus gene;
(e)는 H7 아형 조류인플루엔자 바이러스 유전자의 3'말단쪽 검출 부위를 위한 H7A_F1, H7A_R1 및 H7A_PS로 구성된 프라이머/프로브 세트의 반응 결과이며; (f)는 H7 아형 조류인플루엔자 바이러스 유전자의 5'말단쪽 검출 부위를 위한 H7B_F2, H7B_R2 및 H7B_P2로 구성된 프라이머/프로브 세트의 반응 결과이다.(e) is a reaction result of a primer/probe set consisting of H7A_F1, H7A_R1 and H7A_PS for the detection site at the 3' end of the H7 subtype avian influenza virus gene; (f) shows the reaction result of a primer/probe set consisting of H7B_F2, H7B_R2 and H7B_P2 for the detection site at the 5' end of the H7 subtype avian influenza virus gene.
상기 표 2 및 도 2에 나타낸 바와 같이, 본 발명의 프라이머/프로브 세트들을 이용하면, H5 및 H7 아형 조류인플루엔자 바이러스 검출 여부 및 아형 감별 진단에 사용 가능한 조성물 및 이를 포함하는 진단 키트를 제작할 수 있음을 알 수 있었다.As shown in Table 2 and FIG. 2, using the primer/probe sets of the present invention, a composition usable for detecting H5 and H7 subtype avian influenza virus and subtype differential diagnosis and a diagnostic kit including the same can be prepared. Could know.
실시예Example 3: 다중 올리고 혼합 조성물 구성 및 3: Multiple oligo mixture composition composition and 진단 키트의of the diagnostic kit 제작 produce
상기 실시예 2에서 성능이 확인된 프라이머/프로브 세트들을 모두 혼합한 다중 실시간 원스텝 RT-PCR용 다중 올리고 혼합 조성물을 구성하기 위해 조성물 내 개별 프라이머와 프로브의 양을 조정해가면서 단일 프라이머/프로브 세트와의 반응 결과 비교를 통해 다중 동시 검출에 문제가 없는 최적의 조성을 탐색하였다. A single primer/probe set and a single primer/probe set while adjusting the amounts of individual primers and probes in the composition to construct a multiple oligo mixture composition for multiple real-time one-step RT-PCR in which all of the primer/probe sets whose performance was confirmed in Example 2 were mixed By comparing the reaction results of
상기와 같은 방법으로 구성된 H5 및 H7 아형 조류인플루엔자 바이러스 동시 검출을 위한 다중 올리고 혼합 조성물의 최적 조성은 다중 실시간 원스텝 RT-PCR 반응당 H5A_F1 5 pmole, H5A_F2 6 pmole, H5A_R1 5 pmole, H5A_P1 5 pmole, H5B_F3 5 pmole, H5B_F4 5 pmole, H5B_R2 5 pmole, H5B_P2 5 pmole, H7A_F1 5 pmole, H7A_R1 5 pmole, H7A_PS 1.5 pmole, H7B_F2 5 pmole, H7B_R2 3.5 pmole 및 H7B_P2 3.5 pmole이 사용되도록 프라이머 및 프로브들을 혼합한 것이다.The optimal composition of the multi-oligo mixture composition for simultaneous detection of H5 and H7 subtype avian influenza virus configured as described above is 5 pmole of H5A_F1, 6 pmole of H5A_F2, 5 pmole of H5A_R1, 5 pmole of H5A_P1, and H5B_F3 per multiple real-time one-step RT-PCR reaction. Primers and probes were mixed so that 5 pmole,
상기 다중 올리고 혼합 조성물의 성능을 검증하기 위해 시험관 내 전사물 또는 RNA 추출액의 희석액을 주형으로 사용하여 다중 실시간 원스텝 RT-PCR 반응을 수행하였다. 각 반응 혼합물 (15 μL)은 RNA 주형 5 μL (106, 104, 102, 50 또는 20 카피/5 μL), 상기와 같이 제조된 1X 다중 올리고 혼합 조성물, Taq DNA 중합 효소 1.8 U, 역전사 효소 6 U, RNA 분해 효소 억제제 3 U, 0.16 mM dNTPs, 1X 반응 완충 용액 [75 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 50 mM KCl, 0.3% BSA] 및 핵산 분해 효소 제거수 잔량을 포함하였다. 다중 실시간 원스텝 RT-PCR 반응은 CFX96 실시간 PCR 기기를 사용하여 다음과 같은 조건에서 수행하였다: 역전사 단계 50℃ 10분; 전변성 단계 95℃ 10분; (변성 단계 95℃ 20초 -> 어닐링/신장 단계 62℃ 30초) X 45회. 음성 대조군의 경우, 핵산 분해 효소 제거수를 RNA 주형 대신 사용하였다.To verify the performance of the multi-oligo mixture composition, multiple real-time one-step RT-PCR reactions were performed using a dilution of in vitro transcript or RNA extract as a template. Each reaction mixture (15 μL) consists of 5 μL of RNA template (10 6 , 10 4 , 10 2 , 50 or 20 copies/5 μL), 1X multiple oligo mixed composition prepared as above, 1.8 U of Taq DNA polymerase, reverse transcription Enzyme 6 U, RNAase inhibitor 3 U, 0.16 mM dNTPs, 1X reaction buffer [75 mM Tris-HCl (pH 8.0), 5 mM MgCl 2 , 50 mM KCl, 0.3% BSA] and remaining amount of nuclease-removed water included. Multiple real-time one-step RT-PCR reactions were performed using a CFX96 real-time PCR instrument under the following conditions: reverse transcription step 50° C. for 10 min; pre-denaturation step 95° C. 10 min; (denaturation step 95° C. 20 seconds -> annealing/stretching step 62° C. 30 seconds) X 45 times. For the negative control, nuclease-removed water was used instead of the RNA template.
결과는 표 3 및 도 3에 나타내었다.The results are shown in Table 3 and FIG. 3 .
농도template
density
대조군voice
control
그 결과, 본 발명의 다중 올리고 혼합 조성물은 다중 실시간 원스텝 RT-PCR 반응에서 단일 프라이머/프로브 세트를 이용한 개별 실시간 원스텝 RT-PCR 반응과 거의 성능 차이 없이 H5 및 H7 아형 조류인플루엔자 바이러스 유전자를 특이적으로 증폭 검출할 수 있음을 확인하였다 (도 3 및 표 3). As a result, the multi-oligo mixture composition of the present invention specifically targets H5 and H7 subtype avian influenza virus genes with little difference in performance from individual real-time one-step RT-PCR reactions using a single primer/probe set in multiple real-time one-step RT-PCR reactions. It was confirmed that amplification can be detected (FIG. 3 and Table 3).
따라서, 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트를 이용하면, H5 및 H7 아형 조류인플루엔자 바이러스 검출 여부 및 아형 감별 진단을 경제적으로 빠르고 간편하게 할 수 있음을 알 수 있었다.Therefore, it was found that by using the multi-oligo mixture composition of the present invention and a diagnostic kit comprising the same, it was found that the detection and subtype differential diagnosis of H5 and H7 subtype avian influenza virus could be economically and quickly and conveniently.
도 3은 본 발명의 모든 프라이머/프로브 세트들을 혼합한 다중 올리고 혼합 조성물을 이용한 다중 실시간 원스텝 RT-PCR 반응 결과를 나타낸 도면으로서, (a)는 H5A_F1과 상보적인 염기서열이 들어있는 H5 아형 조류인플루엔자 바이러스 유전자의 3'말단쪽 검출 부위를 포함하는 시험관 내 전사물을 주형으로 사용한 반응 결과이며; (b)는 H5A_F2와 상보적인 염기서열이 들어있는 H5 아형 조류인플루엔자 바이러스 유전자의 3'말단쪽 검출 부위를 포함하는 시험관 내 전사물을 주형으로 사용한 반응 결과이며; (c)는 H5 아형 조류인플루엔자 바이러스 (GISAID EPI509704) RNA 추출액을 주형으로 사용한 반응 결과이며; (d)는 H7 아형 조류인플루엔자 바이러스 유전자의 3'말단쪽 검출 부위를 포함하는 시험관 내 전사물을 주형으로 사용한 반응 결과이며; (e)는 H7 아형 조류인플루엔자 바이러스 유전자의 5'말단쪽 검출 부위를 포함하는 시험관 내 전사물을 주형으로 사용한 반응 결과이며; (f)는 H5 아형 조류인플루엔자 바이러스 (GISAID EPI509698) RNA 추출액을 주형으로 사용한 더 낮은 농도까지의 반응 결과이며; (g)는 H7 아형 조류인플루엔자 바이러스 (Genbank FJ750852) RNA 추출액을 주형으로 사용한 더 낮은 농도까지의 반응 결과이다.3 is a view showing the results of multiple real-time one-step RT-PCR reaction using a multi-oligo mixture composition in which all primer/probe sets of the present invention are mixed, (a) is H5 subtype avian influenza containing a nucleotide sequence complementary to H5A_F1; It is a reaction result using an in vitro transcript containing a detection site at the 3' end of a viral gene as a template; (b) is a reaction result using as a template an in vitro transcript containing a detection site at the 3' end of the H5 subtype avian influenza virus gene containing a nucleotide sequence complementary to H5A_F2 as a template; (c) is a reaction result using H5 subtype avian influenza virus (GISAID EPI509704) RNA extract as a template; (d) is the reaction result using the in vitro transcript containing the 3' terminal detection site of the H7 subtype avian influenza virus gene as a template; (e) is a reaction result using an in vitro transcript containing a detection site at the 5' end of the H7 subtype avian influenza virus gene as a template; (f) is a reaction result up to a lower concentration using H5 subtype avian influenza virus (GISAID EPI509698) RNA extract as a template; (g) shows the reaction results up to a lower concentration using the H7 subtype avian influenza virus (Genbank FJ750852) RNA extract as a template.
상기 H5 및 H7 아형 조류인플루엔자 바이러스 동시 검출을 위한 다중 올리고 혼합 조성물을 포함하는 진단 키트는 다음과 같은 3종의 구성품으로 구성되어진다: 5X 다중 올리고 혼합 조성물; Taq DNA 중합 효소, 역전사 효소 및 RNA 분해 효소 억제제를 포함하는 효소 혼합물 (enzyme mix); dNTPs 및 반응 완충 용액을 포함하는 5X 반응 완충 용액 혼합물 (buffer mix). 상기 진단 키트는 사용자의 편의를 위해 핵산 분해 효소 제거수를 포함하여 4종의 구성품으로 구성될 수도 있다.The diagnostic kit including the multi-oligo mixture composition for simultaneous detection of H5 and H7 subtype avian influenza virus consists of the following three components: 5X multi-oligo mixture composition; an enzyme mix comprising Taq DNA polymerase, reverse transcriptase and RNA degrading enzyme inhibitors; 5X reaction buffer mix containing dNTPs and reaction buffer solution. The diagnostic kit may be composed of four components, including nucleolytic enzyme removal water, for the convenience of the user.
실시예Example 4: 임상적 유용성 확인 - 민감도 4: Confirmation of clinical usefulness - sensitivity
상기 실시예 3에서 구성된 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트의 H5 또는 H7 아형 조류인플루엔자 바이러스 국내 분리주 및 H5 또는 H7 아형 조류인플루엔자 바이러스 양성으로 확인된 야외 분리주에 대한 민감도를 기존 프라이머/프로브 세트와 비교하여 확인하였다. 상기 국내외 분리주는 농림축산검역본부에서 보관 중인 것들을 사용하였으며 (표 4), RNA 핵산을 ㈜제놀루션의 NX-48 Viral NA kit를 사용하여 추출한 다음, 10배 간격으로 연속 희석하여 사용하였다. Sensitivity to the domestic isolate of H5 or H7 subtype avian influenza virus and the outdoor isolate confirmed as positive for H5 or H7 subtype avian influenza virus of the multi-oligo mixture composition constructed in Example 3 and the diagnostic kit comprising the same with the existing primer/probe set It was confirmed by comparison. The domestic and foreign isolates were those stored by the Agriculture, Forestry and Livestock Quarantine Headquarters (Table 4), and RNA nucleic acids were extracted using the NX-48 Viral NA kit of Genolution Co., Ltd., and then serially diluted at 10-fold intervals.
다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트를 이용한 각 반응 혼합물 (15 μL)은 RNA 주형 5 μL (RNA 추출 원액 또는 이의 연속 희석액), 5X 다중 올리고 혼합 조성물 3 μL, 효소 혼합물 1.2 μL, 5X 반응 완충 용액 혼합물 3 μL 및 핵산 분해 효소 제거수 2.8 μL를 포함하였다. Each reaction mixture (15 μL) using the multiplex oligo mixture composition and the diagnostic kit containing the same was prepared by mixing 5 μL of RNA template (RNA extract stock solution or serial dilutions thereof), 3 μL of 5X multiplex oligo mixture composition, 1.2 μL of enzyme mixture, 5X reaction buffer. 3 μL of the solution mixture and 2.8 μL of nuclease-removed water were included.
기존 프라이머/프로브 세트로는 OIE에서 권장하는 유라시아 계통 H5 아형 조류인플루엔자 바이러스 검출용 프라이머/프로브 세트 및 유라시아 계통 H7 아형 조류인플루엔자 바이러스 검출용 프라이머/프로브 세트를 사용하였다. 기존 프라미어/프로브 세트의 염기서열 및 프로브 표지 정보는 다음과 같다: As the existing primer/probe set, the primer/probe set for detecting Eurasian subtype H5 avian influenza virus and the primer/probe set for detecting Eurasian strain H7 subtype avian influenza virus recommended by OIE were used. The base sequence and probe label information of the existing primer/probe set are as follows:
H5 정방향 프라이머, ACATATGACTACCCACARTATTCAG; H5 역방향 프라이머, AGACCAGCTAYCATGATTGC; H5 프로브, [FAM] TCWACAGTGGCGAGTTCCCTAGCA [BHQ-1]; H7 정방향 프라이머, GGCCAGTATTAGAAACAACACCTATGA; H7 역방향 프라이머, GCCCCGAAGCTAAACCAAAGTAT; H7 프로브, [LC Red] CCGCTGCTTAGTTTGACTGGGTCAATCT [BHQ-2]. H5 forward primer, ACATATGACTACCCACARTATTCAG; H5 reverse primer, AGACCAGCTAYCATGATTGC; H5 probe, [FAM] TCWACAGTGGCGAGTTCCCTAGCA [BHQ-1]; H7 forward primer, GGCCAGTATTAGAAACAACACCTATGA; H7 reverse primer, GCCCCGAAGCTAAACCAAAGTAT; H7 probe, [LC Red] CCGCTGCTTAGTTTGACTGGGTCAATCT [BHQ-2].
기존 프라이머/프로브 세트를 이용한 각 반응 혼합물 (15 μL)은 RNA 주형 5 μL (RNA 추출 원액 또는 이의 연속 희석액), 정방향 프라이머 5 pmole, 역방향 프라이머 5 pmole, 프로브 4 pmole (H5 프로브의 경우) 또는 2.5 pmole (H7 프로브의 경우), Taq DNA 중합 효소 1.8 U, 역전사 효소 6 U, RNA 분해 효소 억제제 3 U, 0.16 mM dNTPs, 1X 반응 완충 용액 [75 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 50 mM KCl, 0.3% BSA] 및 핵산 분해 효소 제거수 잔량을 포함하였다. Each reaction mixture (15 µL) using the existing primer/probe set was prepared with 5 µL of RNA template (RNA extraction stock or serial dilutions thereof), 5 pmoles of forward primer, 5 pmoles of reverse primer, 4 pmoles of probe (for H5 probes) or 2.5 pmole (for H7 probe), Taq DNA polymerase 1.8 U, reverse transcriptase 6 U, RNAse inhibitor 3 U, 0.16 mM dNTPs, 1X reaction buffer [75 mM Tris-HCl (pH 8.0), 5 mM MgCl 2 , 50 mM KCl, 0.3% BSA] and the remaining amount of nuclease-removed water.
실시간 원스텝 RT-PCR 반응은 CFX96 실시간 PCR 기기를 사용하여 다음과 같은 조건에서 수행하였다: 역전사 단계 50℃ 10분; 전변성 단계 95℃ 10분; (변성 단계 95℃ 20초 -> 어닐링/신장 단계 60℃ 30초) X 45회. 형광 검출은 첫 5회를 제외하고 나머지 40회에서만 진행되었으며, Ct값은 5회를 더해 표기되었다.Real-time one-step RT-PCR reaction was performed using a CFX96 real-time PCR instrument under the following conditions: reverse transcription step 50° C. for 10 minutes; pre-denaturation step 95° C. 10 min; (denaturation step 95° C. 20 seconds -> annealing/stretching step 60° C. 30 seconds) X 45 times. Fluorescence detection was performed only in the remaining 40 times except for the first 5 times, and the Ct value was expressed by adding 5 times.
(Clade)HA genotype
(Clade)
그 결과, 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트는 기존 프라이머/프로브 세트 대비 동등 이상의 높은 민감도를 나타냄을 확인하였다. 구체적으로 H5 아형 조류인플루엔자 바이러스 양성 시료 10개 중 5개에서 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트가 상대적으로 더 좋은 결과를 나타냈으며 (도 4 및 표 5), H7 아형 조류인플루엔자 바이러스 양성 시료 5개 중 4개에서 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트가 상대적으로 더 좋은 결과를 나타냈다 (도 5 및 표 6). 따라서, 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트를 이용하면, H5 및 H7 아형 조류인플루엔자 바이러스 검출 여부 및 아형 감별 진단을 상당히 정확하게 할 수 있음을 알 수 있었으며, 각 아형에 대해 프라이머/프로브 2 세트씩을 사용하는 것의 긍정적인 영향을 간접적으로 알 수 있었다.As a result, it was confirmed that the multi-oligo mixture composition of the present invention and the diagnostic kit including the same exhibited higher sensitivity than the existing primer/probe set. Specifically, in 5 out of 10 samples positive for H5 subtype avian influenza virus, the multi-oligo mixture composition of the present invention and a diagnostic kit comprising the same showed relatively better results (FIGS. 4 and 5), and H7 subtype avian influenza virus In 4 out of 5 positive samples, the multi-oligo mixture composition of the present invention and a diagnostic kit including the same showed relatively better results ( FIGS. 5 and 6 ). Therefore, it was found that by using the multi-oligo-mix composition of the present invention and a diagnostic kit comprising the same, it was found that detection of H5 and H7 subtype avian influenza virus and subtype differential diagnosis could be fairly accurately performed, and primers/probes for each subtype The positive effect of using 2 sets each was found indirectly.
도 4는 H5 아형 조류인플루엔자 바이러스 양성 시료들로부터의 핵산 추출액의 연속 희석액에서 본 발명의 다중 올리고 혼합 조성물의 기존 프라이머/프로브 세트와의 민감도 비교 테스트 결과를 나타낸 도면으로서, 각 핵산 추출액의 연속 희석액들 중 마지막 2개씩의 결과만을 나타낸 것이다. 도 4에서 (a)는 시료 1에 대한 비교 결과이며; (b)는 시료 2에 대한 비교 결과이며; (c)는 시료 3에 대한 비교 결과이며; (d)는 시료 4에 대한 비교 결과이며; (e)는 시료 5에 대한 비교 결과이며; (f)는 시료 6에 대한 비교 결과이며; (g)는 시료 7에 대한 비교 결과이며; (h)는 시료 8에 대한 비교 결과이며; (i)는 시료 9에 대한 비교 결과이며; (j)는 시료 10에 대한 비교 결과로서, (a) 내지 (j)에 있어 상단의 그래프는 다중 올리고 혼합 조성물을 이용한 결과이며, 하단의 그래프는 기존 프라이머/프로브 세트를 이용한 결과이다.4 is a view showing the sensitivity comparison test results of the multiple oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H5 subtype avian influenza virus positive samples with the existing primer/probe sets, serial dilutions of each nucleic acid extract Only the last two results are shown. In FIG. 4 (a) is a comparison result for
도 5는 H7 아형 조류인플루엔자 바이러스 양성 시료들로부터의 핵산 추출액의 연속 희석액에서 본 발명의 다중 올리고 혼합 조성물의 기존 프라이머/프로브 세트와의 민감도 비교 테스트 결과를 나타낸 도면으로서, 각 핵산 추출액의 연속 희석액들 중 마지막 2개씩의 결과만을 나타낸 것이다. 도 5에서 (a)는 시료 11에 대한 비교 결과이며; (b)는 시료 12에 대한 비교 결과이며; (c)는 시료 13에 대한 비교 결과이며; (d)는 시료 14에 대한 비교 결과이며; (e)는 시료 15에 대한 비교 결과로서, (a) 내지 (e)에 있어 상단의 그래프는 다중 올리고 혼합 조성물을 이용한 결과이며, 하단의 그래프는 기존 프라이머/프로브 세트를 이용한 결과이다.5 is a view showing the sensitivity comparison test results of the multiple oligo mixture composition of the present invention in serial dilutions of nucleic acid extracts from H7 subtype avian influenza virus positive samples with the existing primer/probe sets, serial dilutions of each nucleic acid extract Only the last two results are shown. In Figure 5 (a) is a comparison result for sample 11; (b) is a comparison result for
실시예Example 5: 임상적 유용성 확인 - 특이도 5: Confirmation of clinical usefulness - specificity
상기 실시예 3에서 구성된 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트의 H5 및 H7 아형 조류인플루엔자 바이러스 이외 다른 아형들에 대한 특이도를 확인하였다. H5 및 H7 아형 각 2주를 포함하여 조류인플루엔자 바이러스 총 32주를 사용하였다 (표 7). 각 반응 혼합물 (15 μL)은 조류인플루엔자 바이러스 양성 시료로부터 추출된 RNA 주형 5 μL, 5X 다중 올리고 혼합 조성물 3 μL, 효소 혼합물 1.2 μL, 5X 반응 완충 용액 혼합물 3 μL 및 핵산 분해 효소 제거수 2.8 μL를 포함하였다. 다중 실시간 원스텝 RT-PCR 반응은 CFX96 실시간 PCR 기기를 사용하여 다음과 같은 조건에서 수행하였다: 역전사 단계 50℃ 10분; 전변성 단계 95℃ 10분; (변성 단계 95℃ 20초 -> 어닐링/신장 단계 60℃ 30초) X 45회.The specificity of the multiple oligo mixture composition constructed in Example 3 and the diagnostic kit comprising the same to subtypes other than H5 and H7 subtype avian influenza virus was confirmed. A total of 32 strains of avian influenza virus including 2 strains each of H5 and H7 subtypes were used (Table 7). Each reaction mixture (15 µL) was prepared by adding 5 µL of RNA template extracted from avian influenza virus positive sample, 3 µL of 5X multiple oligo mixture composition, 1.2 µL of enzyme mixture, 3 µL of 5X reaction buffer mixture, and 2.8 µL of nuclease-removed water. included. Multiple real-time one-step RT-PCR reactions were performed using a CFX96 real-time PCR instrument under the following conditions: reverse transcription step 50° C. for 10 min; pre-denaturation step 95° C. 10 min; (denaturation step 95° C. 20 seconds -> annealing/stretching step 60° C. 30 seconds) X 45 times.
그 결과, 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트는 목적하는 아형들 이외 다른 아형들에 대한 특이도에 전혀 문제가 없음을 확인하였다 (도 6 및 표 7). 따라서, 민감도 테스트 결과와 함께 종합적으로 볼 때, 본 발명의 다중 올리고 혼합 조성물 및 이를 포함하는 진단 키트를 이용하면, H5 및 H7 아형 조류인플루엔자 바이러스 검출 여부 및 아형 감별 진단을 매우 높은 신뢰도를 가지고 할 수 있음을 알 수 있었다.As a result, it was confirmed that the multi-oligo mixture composition of the present invention and the diagnostic kit including the same had no problem in specificity for subtypes other than the desired subtypes ( FIGS. 6 and 7 ). Therefore, when viewed comprehensively with the sensitivity test results, using the multi-oligo mixture composition of the present invention and a diagnostic kit comprising the same, detection of H5 and H7 subtype avian influenza virus and subtype differential diagnosis can be performed with very high reliability. was found to be
도 6은 본 발명의 다중 올리고 혼합 조성물의 다른 아형들에 대한 특이도 테스트 결과를 나타낸 도면이다. 양성 대조군으로 사용된 시료 11, 12, 17 및 18을 제외하고는 증폭 신호가 확인되지 않는다.6 is a view showing the specificity test results for different subtypes of the multi-oligo mixture composition of the present invention. No amplification signal was observed except for
<110> REPUBLIC OF KOREA(Animal and Plant Quarantine Agency) <120> Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus <130> PN190297 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5A_F1 <400> 1 agagaggaaa taagtggrgt aa 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5A_F2 <400> 2 agrgaagaaa taagcggrgt ga 22 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> H5A_R1 <400> 3 cacatccata aagataracc agc 23 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> H5A_P1 <400> 4 accaaatact gtcaatttat tcaacag 27 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> H5B_F3 <400> 5 tttgcattgg ttaycatgca 20 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> H5B_F4 <400> 6 ggagaaaata gtgcttctty ttgc 24 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5B_R2 <400> 7 gggcatgtgt aacagtracg tt 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> H5B_P2 <400> 8 gcaggttgac acrataatgg a 21 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> H7A_F1 <400> 9 gctayaaaga tgtgatactt tggtttag 28 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> H7A_R1 <400> 10 acacatatga agacaaggcc cat 23 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> H7A_PS <400> 11 catcatgttt catacttctk gccat 25 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H7B_F2 <400> 12 gaaaaggacr gttgacctcg gt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H7B_R2 <400> 13 aracatcact yccttctcgc ct 22 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> H7B_P2 <400> 14 tggggacrat cactggacca ccyca 25 <110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus <130> PN190297 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5A_F1 <400> 1 agagaggaaa taagtggrgt aa 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5A_F2 <400> 2 agrgaagaaa taagcggrgt ga 22 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> H5A_R1 <400> 3 cacatccata aagataracc agc 23 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> H5A_P1 <400> 4 accaaatact gtcaatttat tcaacag 27 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> H5B_F3 <400> 5 tttgcattgg taycatgca 20 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> H5B_F4 <400> 6 ggagaaaata gtgcttctty ttgc 24 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H5B_R2 <400> 7 gggcatgtgt aacagtracg tt 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> H5B_P2 <400> 8 gcaggttgac acrataatgg a 21 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> H7A_F1 <400> 9 gctayaaaga tgtgatactt tggtttag 28 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> H7A_R1 <400> 10 acacatatga agacaaggcc cat 23 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> H7A_PS <400> 11 catcatgttt catacttctk gccat 25 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H7B_F2 <400> 12 gaaaaggacr gttgacctcg gt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> H7B_R2 <400> 13 aracatcact yccttctcgc ct 22 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> H7B_P2 <400> 14 tggggacrat cactggacca ccyca 25
Claims (15)
(a) 서열번호 1의 염기서열로 표시되는 프라이머 및 서열번호 2의 염기서열로 표시되는 프라이머; 및 서열번호 3의 염기서열로 표시되는 프라이머; 및
(b) 서열번호 5의 염기서열로 표시되는 프라이머 및 서열번호 6의 염기서열로 표시되는 프라이머; 및 서열번호 7의 염기서열로 표시되는 프라이머.
A composition for detecting a target sequence of H5 subtype avian influenza virus, comprising:
(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; and
(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a primer represented by the nucleotide sequence of SEQ ID NO: 6; and a primer represented by the nucleotide sequence of SEQ ID NO: 7.
The composition of claim 1, wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, and (b) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 8.
The composition of claim 2, wherein the probes are labeled with the same marker.
A diagnostic kit for H5 subtype avian influenza virus gene test comprising the composition of any one of claims 1 to 3.
(a) 서열번호 1의 염기서열로 표시되는 프라이머 및 서열번호 2의 염기서열로 표시되는 프라이머; 및 서열번호 3의 염기서열로 표시되는 프라이머; 및
(b) 서열번호 5의 염기서열로 표시되는 프라이머 및 서열번호 6의 염기서열로 표시되는 프라이머; 및 서열번호 7의 염기서열로 표시되는 프라이머, 및
(c) 서열번호 9의 염기서열로 표시되는 프라이머; 및 서열번호 10의 염기서열로 표시되는 프라이머; 및
(d) 서열번호 12의 염기서열로 표시되는 프라이머; 및 서열번호 13의 염기서열로 표시되는 프라이머.
A composition for detecting a target sequence of H5 and H7 subtype avian influenza virus, comprising:
(a) a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; and a primer represented by the nucleotide sequence of SEQ ID NO: 3; and
(b) a primer represented by the nucleotide sequence of SEQ ID NO: 5 and a primer represented by the nucleotide sequence of SEQ ID NO: 6; and a primer represented by the nucleotide sequence of SEQ ID NO: 7, and
(c) a primer represented by the nucleotide sequence of SEQ ID NO: 9; and a primer represented by the nucleotide sequence of SEQ ID NO: 10; and
(d) a primer represented by the nucleotide sequence of SEQ ID NO: 12; and a primer represented by the nucleotide sequence of SEQ ID NO: 13.
The method of claim 5, wherein (a) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 4, wherein (b) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 8, (c) A composition further comprising a probe represented by the nucleotide sequence of SEQ ID NO: 11, wherein (d) further comprises a probe represented by the nucleotide sequence of SEQ ID NO: 14.
The method of claim 6, wherein the probes added to (a) and (b) are labeled with a first marker, the probes added to (c) and (d) are labeled with a second marker, and The first marker and the second marker are different from each other.
A diagnostic kit for genetic testing of H5 and H7 subtypes avian influenza virus comprising the composition of any one of claims 5 to 7.
The diagnostic kit according to claim 8, wherein the diagnostic kit simultaneously detects H5 subtype avian influenza virus and H7 subtype avian influenza virus in a single tube.
(b) 상기 분리된 RNA를 대상으로, 제1항 내지 제3항 중 어느 한 항의 조성물을 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H5 아형 조류인플루엔자 바이러스 검사 방법.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) H5 subtype comprising the step of specifically amplifying and detecting a target sequence through a multiple real-time one-step RT-PCR reaction using the composition of any one of claims 1 to 3 for the isolated RNA Avian influenza virus testing method.
(b) 상기 분리된 RNA를 대상으로, 제4항의 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H5 아형 조류인플루엔자 바이러스 검사 방법.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) H5 subtype avian influenza virus testing method comprising the step of specifically amplifying and detecting the isolated RNA through a multi-real-time one-step RT-PCR reaction using the diagnostic kit of claim 4 .
(b) 상기 분리된 RNA를 대상으로, 제5항 내지 제7항 중 어느 한 항의 조성물을 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스 검사 방법.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) using the composition of any one of claims 5 to 7 for the isolated RNA, H5 and H7 subtype avian influenza virus test method.
The method according to claim 12, wherein, as a result of the detection in step (b), when the signal of the first marker is confirmed, it is determined that the gene of the H5 subtype avian influenza virus is detected, and when the signal of the second marker is confirmed, the H7 subtype avian influenza virus H5 and H7 subtype avian influenza virus testing method to determine that the gene is detected.
(b) 상기 분리된 RNA를 대상으로, 제8항의 진단 키트를 이용하여 다중 실시간 원스텝 RT-PCR 반응을 통해 표적 서열을 특이적으로 증폭 검출하는 단계를 포함하는 H5 및 H7 아형 조류인플루엔자 바이러스 검사 방법.
(a) isolating RNA from a specimen previously isolated from birds, livestock other than birds, or humans; and
(b) H5 and H7 subtype avian influenza virus testing method comprising the step of specifically amplifying and detecting the isolated RNA target sequence through multiple real-time one-step RT-PCR reaction using the diagnostic kit of claim 8 .
15. The method of claim 14, wherein as a result of the detection in step (b), when the signal of the first marker is confirmed, it is determined that the gene of the H5 subtype avian influenza virus is detected, and when the signal of the second marker is confirmed, the H7 subtype avian influenza virus H5 and H7 subtype avian influenza virus testing method to determine that the gene is detected.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190140549A KR102306883B1 (en) | 2019-11-05 | 2019-11-05 | Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190140549A KR102306883B1 (en) | 2019-11-05 | 2019-11-05 | Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20210054417A KR20210054417A (en) | 2021-05-13 |
KR102306883B1 true KR102306883B1 (en) | 2021-09-29 |
Family
ID=75913506
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190140549A KR102306883B1 (en) | 2019-11-05 | 2019-11-05 | Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102306883B1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102007951B1 (en) * | 2018-08-21 | 2019-08-07 | 대한민국(농림축산식품부 농림축산검역본부장) | Primer and probe set for detection of type A avian influenza virus and the avian H5 and H7 subtype and uses thereof |
-
2019
- 2019-11-05 KR KR1020190140549A patent/KR102306883B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102007951B1 (en) * | 2018-08-21 | 2019-08-07 | 대한민국(농림축산식품부 농림축산검역본부장) | Primer and probe set for detection of type A avian influenza virus and the avian H5 and H7 subtype and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
KR20210054417A (en) | 2021-05-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP4786548B2 (en) | Method for detecting H5 avian influenza virus | |
US20080261198A1 (en) | Diagnostic Primers and Method for Detecting Avian Influenza Virus Subtype H5 and H5n1 | |
CN101460632B (en) | Nucleic acid primers and probes for detecting human and avian influenza viruses | |
US20100297630A1 (en) | Method for the simultaneous detection of multiple nucleic acid sequences in a sample | |
US20210285061A1 (en) | Compositions and methods for detecting severe acute respiratory syndrome coronavirus 2 (sars-cov-2), influenza a and influenza b | |
CN112176112A (en) | Triple fluorescent quantitative RT-PCR detection kit for avian influenza virus H5, H7 and H9 subtypes and application thereof | |
KR102007951B1 (en) | Primer and probe set for detection of type A avian influenza virus and the avian H5 and H7 subtype and uses thereof | |
US20090088331A1 (en) | Influenza virus nucleic acid microarray and method of use | |
Elizalde et al. | Rapid molecular haemagglutinin subtyping of avian influenza isolates by specific real-time RT-PCR tests | |
KR102231338B1 (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
KR102306883B1 (en) | Real-time PCR Diagnostic Kit for Simultaneous Detection of H5 and H7 Subtype Avian Influenza Virus | |
JP5561708B2 (en) | Primer set for NA subtype determination of avian influenza virus | |
WO2006132601A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
KR101705577B1 (en) | Primer set for selecting necrotic spot virus resistant and or susceptible melon cultivar and selection method by using same | |
CN106636475B (en) | Primer group for detecting North American H3N8 subtype canine influenza virus and application thereof | |
KR102516022B1 (en) | Detection and Differentiation of African Swine Fever Virus and Classical Swine Fever Virus by One Step Duplex Reverse Transcriptase Quantitative PCR Assay | |
US20180080091A1 (en) | Detection of influenza b viruses | |
KR101618435B1 (en) | Composition for multi-detecting avian influenza virus and uses thereof | |
CN111172242B (en) | Kit for combined detection of influenza A and B virus based on double amplification technology and application thereof | |
KR102276396B1 (en) | A composition and RT-qPCR based chip for detecting avian influenza viruses and method for detecting avian influenza viruses using the same | |
JP2011078389A (en) | Method and reagent for detecting sapovirus rna | |
KR20230118753A (en) | Diagnostic kit and diagnostic method capable of distinguishing HA and NA genotypes of Swine influenza virus | |
KR20230118752A (en) | Diagnostic kit and diagnostic method capable of distinguishing major genotypes of Swine influenza virus | |
CN1066199C (en) | Method for detecting virus associated with hemorrhagic fever with renal syndrome | |
KR101809721B1 (en) | Primers for Detecting Avian Influenza Virus Hemagglutinin Subtype and Uses Thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AMND | Amendment | ||
E601 | Decision to refuse application | ||
AMND | Amendment | ||
X701 | Decision to grant (after re-examination) | ||
GRNT | Written decision to grant |