KR20230117871A - rs7779989 marker composition for diagnosing cerebral aneurysm and method of use thereof - Google Patents

Abstract

The present invention constructs an updated IA GWAS through genotype correction and high-throughput replacement, discovers six SNPs most significantly associated with the occurrence of cerebral aneurysm, and provides them as SNP markers for cerebral aneurysm diagnosis. The SNP marker of the present invention can provide highly reliable diagnostic results of cerebral aneurysms, and can enable prevention of onset and rapid treatment through early diagnosis of cerebral aneurysms.

Description

rs7779989 marker composition for diagnosing cerebral aneurysm and its use

The present invention was completed with the support of the Korea Health Technology R&D project through the Korea Health Industry Development Institute (KHIDI) with the support of the Ministry of Health and Welfare of the Republic of Korea (Task number: HR21C0198) and the Hanlim Research Fund.

The present invention provides the use of the rs7779989 SNP marker and six SNPs including the rs7779989 marker as biomarkers for diagnosing cerebral aneurysm so as to diagnose the possibility of developing a cerebral aneurysm in advance in an individual.

With the advent of personalized medicine, interest in genetic analysis technology is increasing. On the other hand, Single Nucleotide Polymorphisms (SNPs) of individual genes refer to genetic changes or mutations that show a difference in one nucleotide sequence (A, T, G, C) in a DNA nucleotide sequence. Polymorphism is a part that shows a lot of variation in each individual, so it is mainly used in DNA fingerprint analysis. SNPs can be used to diagnose an individual's current specific disease, predict the occurrence of complications, and predict the likelihood of developing future diseases. The recent development of bioinformatics analysis has made it possible to process large amounts of clinical and genomic data and study diseases with complex phenotypes, and genetic analysis for complex diseases including cerebrovascular diseases is increasing.

Intracranial aneurysm (IA) represents a focal balloon dilatation of a cerebral blood vessel. IA in which a vessel has not ruptured is usually asymptomatic, but if it ruptures, it has a mortality rate of up to 50% within 1 month after the attack. Accordingly, many studies are being conducted to identify the characteristics of patients with a high possibility of developing IA or a high possibility of vascular rupture. Since 2010, genetic studies of IA have been conducted abroad to identify causal variations related to IA. Existing domestic studies had limitations in performing only simple clinical factor analysis for retrospective study design, but simple analysis of candidate gene SNPs, Genome-Wide Association Study (GWAS), whole genome association ( Research is expanding into functions of whole-genome association, next-generation sequencing (NGS), and possible causal variants.

Genetic analysis results may differ depending on race, and results for Koreans may also differ from those of China and Japan, which are Northeast Asian countries. For example, the C allele of rs3900446 located in the lysyl oxidase (LOX) gene is known to be associated with the risk of IA in Koreans, but a Japanese cohort confirmed no association between IA and the LOX gene allele or haplotype. Therefore, race is an essential factor to be considered in disease-related SNP discovery research.

A genome-reference panel based on 1781 Northeast Asians was published in 2019. Compared to the reference panel of the 1000 Genomes Project Consortium based on Caucasians, the robust imputation reference panel for Northeast Asian populations showed better imputation accuracy and lower frequency variants. was

In order to solve the problem of no missing value imputation for Koreans in the previous IA GWAS, the present inventors performed an updated GWAS to identify IA susceptibility variants after genotype correction and high-throughput imputation, resulting in a total of 6 species related to IA. The present invention was completed by discovering SNPs of .

1. Yoo SK, Kim CU, Kim HL, Kim S, Shin JY, Kim N, et al. Nard: Whole-genome reference panel of 1779 northeast asians improves imputation accuracy of rare and low-frequency variants. Genome Med. 2019;11:64 2. Genomes Project C, Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, et al. A global reference for human genetic variation. Nature. 2015;526:68-74

Based on the first IA GWAS targeting Koreans, the present inventors selected single nucleotide polymorphisms (SNPs) candidates associated with cerebral aneurysms, and performed genotype correction and high-throughput imputation on the GWAS genetic information data. Based on the updated GWAS data, the present invention was completed by finally securing a SNP having susceptibility to cerebral aneurysms in Koreans among the SNP candidates.

Accordingly, a technical problem to be achieved by the present invention is to provide a SNP marker for diagnosing a cerebral aneurysm, and to provide a composition and kit for diagnosing a cerebral aneurysm using an agent capable of detecting the SNP marker.

In addition, the present invention is intended to provide an information providing method for diagnosing a cerebral aneurysm by detecting the SNP from a biological sample of an individual.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

In order to solve the above problems, the present invention provides an rs7779989 SNP marker for diagnosing cerebral aneurysms. The SNP may be included in the nucleotide sequence shown in SEQ ID NO: 3.

In addition, the present invention may further include an agent capable of detecting any one or more SNPs selected from the group consisting of rs3120004, rs1522095, rs12935558, rs3826442, and rs2440154 as SNP markers for diagnosing cerebral aneurysm. For example, rs3120004, rs1522095, rs7779989, rs12935558, rs3826442, and rs2440154 may all be provided as SNP markers for diagnosing cerebral aneurysms.

In addition, the present invention provides a composition for diagnosing cerebral aneurysms and a kit for diagnosing cerebral aneurysm, including an agent capable of detecting one or more SNPs selected from the above SNPs.

As an embodiment of the present invention, the SNP marker composition may be used to diagnose cerebral aneurysms in Koreans or Asians.

In another embodiment of the present invention, the agent capable of detecting the SNP is a polynucleotide having 8-50 consecutive base sequences including the SNP or a base sequence complementary thereto in the genome region where the SNP is located. It may be a probe or primer that specifically binds, or a primer with a length of 8-20 bp that is complementary to a continuous nucleotide sequence of ± 4 to 100 based on the position of the SNP in the genome so as to amplify the polynucleotide.

As another embodiment of the present invention, the agent capable of detecting the SNP can detect thymine at position rs3120004, detect guanine at position rs1522095, or detect guanine at position rs7779989 can be detected at position rs12935558, adenine can be detected at position rs3826442, or guanine can be detected at position rs2440154.

In addition, the present invention provides a method for diagnosing a cerebral aneurysm or a method for providing information for diagnosis, which includes the following steps:

(1) preparing a biological sample from the subject;

(2) obtaining genomic DNA from the biological sample;

(3) detecting a base type of one or more single nucleotide polymorphism positions selected from the group consisting of GenBank SNP database rs3120004, rs1522095, rs7779989, rs12935558, rs3826442, and rs2440154 in the genomic DNA; and

(4) determining the risk and/or susceptibility of developing a cerebral aneurysm of the subject from the detected base type.

As one embodiment of the present invention, the subject in step (1) is not limited as long as it is a human for whom prediction of the possibility of developing a cerebral aneurysm is required, but may preferably be Korean or Asian.

As another embodiment of the present invention, the biological sample is not limited as long as it is isolated from an individual and includes genomic DNA, but may be preferably blood for simple non-invasive diagnosis.

As another embodiment of the present invention, the base type detection in step (3) is performed by sequencing, microarray hybridization, allele specific PCR, and dynamic allele hybridization techniques. It may be performed using one or more methods selected from the group consisting of (dynamic allele-specific hybridization; DASH), fluorescence melting curve analysis (FMCA), and Taqman technique.

As another embodiment of the present invention, in step (3), the base type at position rs3120004 is detected as thymine, the base type at position rs1522095 is detected as guanine, or the base type at position rs7779989 is detected as thymine. When detected as guanine, when the base type at position rs12935558 is detected as adenine, when the base type at position rs3826442 is detected as thymine, or when the base type at position rs2440154 is detected as guanine, the subject in step (4) is at risk of developing a cerebral aneurysm And/or it can be determined that the disease susceptibility is high.

The present invention can provide SNPs susceptible to cerebral aneurysms based on updated IA GWAS genetic information data targeting Koreans through genotype correction and missing value replacement. As a result, it is possible to provide a diagnosis result of a cerebral aneurysm with high reliability, and has an advantage of enabling prevention of onset and rapid treatment through early diagnosis of a cerebral aneurysm.

Figure 1 is the genotyping protocol recommended by the Axiom™ Genotyping Array. Axiom™ Analysis Suite v1.1.1, Applied Biosystems™ (APT) v1.18, and SNPolisher™ module of R package v3.0. All commands used for each step executed through APT generated appropriate QC metrics. Sample filtering in steps 3 and 5 was performed with R script implemented by SNPolisher™ module.
Figure 2 is a schematic diagram summarizing the method for constructing the updated GWAS for cerebral aneurysms and the results derived from each step. In Figure 2, R ² means imputation score, GCR is an abbreviation for genotype call rate, MAF means minor allele frequency, and HWE p means Hardy-Weinberg equilibrium p-value.
Figure 3(A) is a plot of the multi-dimensional scaled principal component (MDS PC) of 546 Korean adults and 2,504 subjects in the 1000 Genome (1KG) reference panel (Phase 3 version 5). K represents 2,504 subjects from the 1KG reference panel (number of Europeans = 503 [red circles], Hispanic or mixed-race Americans = 347 [orange circles], Africans = 661 [gray circles], East Asians = 504 [dark green]). Red circles indicate regions of Korean adults marked with the letter “H” in panel A.
Figure 3 (B) is a MDS PC plot of 546 Korean adults in MDS PC. Among 546 Korean adults, the genetic pedigree cluster between PC1 and PC2 indicates superior variance of 546 adults compared to 504 East Asian subjects in the 1KG reference panel.
3(C) is a GWAS Manhattan plot for cerebral aneurysms in 250 patients and 296 controls. The X-axis and Y-axis represent the number of chromosomes and the p-value converted to -log10, respectively. The red lower line represents the genome-wide significance threshold (p = 5×10 ^-8 ).
Figure 4 is a regional association plot of the rs3120004 (1q31.2) SNP ± 500 kb region of the present invention, a triangle or inverted triangle represents a positive effect size and a negative effect size, respectively, each color represents pairwise LD, and the upper purple Triangles represent the most significant associations with IA formation.
Figure 5 is a regional association plot of the rs1522095 (4q12) SNP ± 500 kb region of the present invention, triangles or inverted triangles represent positive and negative effect sizes, respectively, each color represents pairwise LD, and the purple upper triangle represents It represents the most important association with IA formation.
Figure 6 is a regional association plot of the rs7779989 (7p15.3) SNP ± 500 kb region of the present invention, triangles or inverted triangles represent positive and negative effect sizes, respectively, each color represents pairwise LD, and the upper purple Triangles represent the most significant associations with IA formation.
Figure 7 is a regional association plot of the rs12935558 (18q) SNP ± 500 kb region of the present invention, triangles or inverted triangles represent positive and negative effect sizes, respectively, each color represents pairwise LD, and the purple upper triangle represents It represents the most important association with IA formation.
8 is a regional association plot of the rs3826442 (17p13.1) SNP ± 500 kb region of the present invention, triangles or inverted triangles represent positive effect sizes and negative effect sizes, respectively, each color represents pairwise LD, and the upper purple Triangles represent the most significant associations with IA formation.
Figure 9 is a regional association plot of the rs2440154 (17p11.2) SNP ± 500 kb region of the present invention, triangles or inverted triangles represent positive and negative effect sizes, respectively, each color represents pairwise LD, and the upper purple Triangles represent the most significant associations with IA formation.

Unlike Europe, Japan, and China, genetic studies on cerebral aneurysm (IA) targeting Koreans are lacking. The present inventors completed the present invention by constructing an updated GWAS through genotype correction and replacement rather than the first GWAS targeting Koreans, and discovering the final six SNPs that can predict the onset of cerebral aneurysm based on this.

Specifically, the present inventors used the genetic information data of 250 IA patients and 296 healthy controls, adjusted clinical variables and four principal component analysis (PCA) values, and performed high-throughput replacement of SNPs and genotype missing values. imputation) was performed. Among a total of 73,33,746 sites with an imputation R ² score of ≥ 0.5, 6,105,212 SNPs were analyzed, and a total of 38 SNPs that reached a genome-wide significant threshold ( p = 5 × 10 ^-8 ) were selected, and pairwise LD ( After performing pruning by linkage disequilibrium (r ² < 0.8), it was confirmed that 11 SNPs consistently showed association with IA. Furthermore, the six labeled SNPs of rs3120004, rs1851347, rs1522095, rs7779989, rs12935558, rs3826442, and rs2440154 form a haplotype structure with a strong LD tower. In particular, rs3120004 has LOC440704 and R 1q31.2( OR = 2.34, 95% CI: 1.74-3.14; p = 1.4 × 10 -8) It was confirmed that a large and strong haplotype structure was formed at the position. The rs2440154 SNP showed the highest correlation with the increased risk of IA, and it was confirmed that the region including rs3826442 ( MYH13 , 17p13.1) showed a high recombination rate of about 70 cM/Mbp.

From the above, the present inventors derived 11 new SNPs related to IA in Koreans from the updated GWAS using a high-throughput imputation approach, and among the SNPs, 6 SNPs constituting the haplotype structure (rs3120004, rs1522095 , rs7779989, rs12935558, rs3826442 and rs2440154) were selected as the final SNP markers for diagnosis of IA. Among the final SNP markers, rs2440154 ( SLC47A1 , 17p11.2) is most strongly associated with the occurrence of IA.

Accordingly, the present invention provides the six SNPs as biomarkers for diagnosing IA.

Specific information of the biomarkers for diagnosis of IA of the present invention is shown in Table 1 below.

order
number gene chromosome SNPs Position P-value SNP sequence information
(Location of base sequence [] notation) One LOC440704, RGS18 1q31.2 rs3120004 191221672 1.4E-08 AAGTATTTGGTAAAATTCAGCAGTAAATTCACCAGGTCCTTGGCTATTCTTTGATGGGAGACATTTTATTCATAGTTCTATCTTGTTACTTAATATTGAT[C/T]GATTCAGGTTTTATATTTCTTCATGGTTCATTCTTGGTAGGTGGTATGTGTTTAGAAATTTATCCATTACCTCTAAGTTTTCAAATTTAGTGGTACATAG 2 LOC101928851, NONE 4q12 rs1522095 59222703 2.6E-09 TCCCTAAAAAGGGAGAAATTACAAACATTTTTTCCTAGAAATGGAGAGGACATAATATTTAATGCTATTCTGATGGCTTTGCATTGAAATTGGTCAAGCT[A/G]ACTAGGCTGAGATTATTTTCCAAAATTTTCTTTCAAGTTACAGTGGGACACAAGAAATTCTTGTGTGAGTTTTGGAGGGCAGAGGTGATACTCATACT 3 LINC01162, SP4 7p15.3 rs7779989 21265984 4.6E-09 TTCTGCTCTTTGAACCCATCTCTCCAGGTTGAAACCATCTTGGCAAAGTATTATCAGCCGGTGTCTTCGGCTAGATGGACCTTTCAAGCCCTCCTAAGGT[A/G]AGAAAATGTTATTTTTCCCTTTTATGTGTTGTGGTTCATTGGATAGTATTTGTCATCTTGTCACATAATAGGAATGACGTTCACAATGTTGAAATACGCC 4 LOC101928880, ZNF469 16q24.2 rs12935558 88336978 2.6E-08 CAAGGTAACAATTCACTTCATCCCATGTATCATTGCATAAGTTCTCCTGGGCCCCGTTGGCTGGGGACGTGGACACGTGTGATTTCTGCTCTGCACCCTC[G/A]CCAGCGCTGTTCTTTCCAGTGGGCCTTTCCAGCCGGGATCCTGCCCACTTCCTTGTGCCCAGCTTTCCAGAGCCCCTCAGCCCCTCCAAGGGCCCACCA 5 MYH13 17p13.1 rs3826442 10227708 3.1E-09 TTGATTGGCCTCTTTGAAAATGCTACAAAGAAAGGGTATCACCCTCTAAAAGCTTATTATCTACACCTAAGCCAAGAAATGGGTCATGCACACACATGCA[C/T]GCACATGTGCACACACTGCACACACACGTGTACATAAACTTAGATATCACCCATAAACACATTTTTTCTTTTTAGATGGAGTTTCTCTCTGTGGCCCAGG 6 SLC47A1 17p11.2 rs2440154 19444987 8.2E-10 AGGCGTTCAGCAGGCCTGTAATGTTTCACCCTGAGAGTCCGGATCCCGCTGGGACTCCAAGTGGACGATCTCATCGCTACCTCCAGCTCCTCCTGTCTAC[A/G]GACTTCCTTGCTGGAATGTGTTCTTGTTGTTGAAGGCTGTATTCTCTCCAGTCCTCACTAGGAATCTTGGATAACAAGGGGGTTATCCCAGAAGGCAGCC

The rs2440154 SNP, which showed the strongest association with the onset of IA, is located on the SLC47A1 gene , which is called solute carrier family 47 member 1 and is involved in ATP efflux of organic cations through bile and urine, which is related to drug response and toxicity. However, the association with the onset of cerebrovascular disease has not been known.

On the other hand, haplotype analysis ensures a stronger association between SNPs and phenotypes. Since genotypes within the same block tend to be inherited together, LD occurs. Haplotypes include a combination of adjacent loci that are relatively inherited, and the higher the LD value, the higher the possibility of disease association. All six SNP markers of the present invention showed a haplotype structure, and among them, rs3120004 showed a large and strong haplotype structure with a high LD of 0.8 or more. In addition, rs3826442 showed a high recombination rate in the region surrounding it, suggesting heritability to the next generation.

The present invention improved statistical power by adding an imputation based on the Northeast Asian population to the conventional IA GWAS results of Korean subjects, and performed genotyping correction integrating more than 1000 cerebrovascular disease patients to eliminate missing values. The number was reduced, and it can be seen that the six SNPs of the present invention are inherited to the next generation with high probability under pairwise LD construction.

The term "polymorphism" as used herein refers to the placement in sequence of genes that vary within a population. A polymorphism consists of different “alleles”. The placement of these polymorphisms can be identified by their position in the gene and the different amino acids or bases found therein. This amino acid variation is the result of two different alleles, two possible variant bases, C and T. Since the genotype consists of two distinct alleles, any one of several possible variants may be observed in any one individual (eg CC, CT or TT in this example). Individual polymorphisms are also known to those skilled in the art and are designated unique, such as those used in, for example, the Single Nucleotide Polymorphism Database (dbSNP) of Nucleotide Sequence Variation available on the NCBI website. It can be an identifier ("reference SNP", "refSNP" or "rs#").

As used herein, "genetic polymorphism" refers to the case in which two or more alleles exist in one locus, and the case in which a genetic mutation occurs at a frequency of at least 1% or more in a population say The insertion, deletion, or substitution of a single nucleotide in DNA is called a single nucleotide polymorphism (SNP).

As used herein, "single nucleotide polymorphism (SNP)" refers to a single nucleotide (A, T, C, or G) in the genome that occurs when members of a species or paired chromosomes of an individual differ. Diversity of DNA sequences. For example, if it contains a difference in a single base, such as three DNA fragments from different individuals (e.g., AAGT[A/A]AG, AAGT[A/G]AG, AAGT[G/G]AG), They are called two alleles (C or T), and generally almost all SNPs have two alleles. Within a population, a SNP can be assigned a minor allele frequency (MAF; the lowest allele frequency at a locus found in a particular population). A single base may be changed (replaced), removed (deleted), or added (inserted) to a polynucleotide sequence. SNPs can cause changes in the translational frame.

On the other hand, when expressing the mutation of a gene in this specification, [base one letter/base one letter] means that the base one letter written on the left is replaced with the base one letter written on the right .

As used herein, “polynucleotide” or “nucleic acid” refers to deoxyribonucleotides (DNA) or ribonucleotides (RNA) in single- or double-stranded form. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides are also included. In general, DNA is composed of four bases: adenine (A), guanine (G), cytosine (C), and thymine (T), and RNA uses uracil (U) instead of thymine. ) has In a nucleic acid duplex, A forms a hydrogen bond with T or U, and C with G base, and the relationship between these bases is called 'complementary'. On the other hand, in the present specification, 'polynucleotide' means a polynucleotide having 8 to 100 consecutive nucleotide sequences including the SNP in the genome region where the SNP of the present invention is located, unless otherwise specified.

In the present specification, “genomic DNA (gDNA)” refers to DNA containing almost complete genetic information as a total nucleotide sequence of a gene of an individual.

On the other hand, intracranial aneurysm (IA) refers to a disease in which a part of a cerebral artery supplying blood to the brain is weakened and the part swells like a balloon or a balloon.

As used herein, "diagnosis" includes any type of analysis used to predict the occurrence of a disease and to determine or derive a risk or susceptibility to develop a disease.

In the present specification, the term "individual" is not limited to any mammal requiring diagnosis, such as predicting the possibility of developing a cerebral aneurysm, but may be an individual concerned about the occurrence of a cerebral aneurysm due to a genetic predisposition.

Meanwhile, the step of detecting the base type in the present invention can be used without limitation as long as it is commonly used in the art to analyze and determine base sequences. More specifically, sequencing, exome sequencing, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization (DASH) ), fluorescence melting curve analysis (FMCA), and Taqman technique.

In the present invention, "an agent capable of detecting a SNP" means a primer capable of specifically amplifying a polynucleotide having 8 to 100 consecutive base sequences including the SNP in the genome region where the SNP is located, or the polynucleotide It means a probe capable of specifically binding to a nucleotide. The primers used to amplify the polynucleotide containing the SNP are prepared in an appropriate buffer under appropriate conditions (eg, four different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) and at an appropriate temperature. It can be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Shorter primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be perfectly complementary to the polynucleotide of the SNP region, but must be sufficiently complementary to hybridize with the polynucleotide.

In the present specification, "primer" is a base sequence having a short free 3' terminal hydroxyl group, which can form a base pair with a complementary template and is a starting point for template strand copying. refers to a short sequence that functions as A primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR amplification can be performed to predict atopic dermatitis through whether the desired product is produced. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, "capping", substitution of one or more homologs of a natural nucleotide, and modifications between nucleotides, such as uncharged linkages such as methylphosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) or to charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments will be illustrated in the drawings and described in detail in the detailed description. However, it should be understood that this is not intended to limit the present invention to specific embodiments, and includes all transformations, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of related known technologies may obscure the gist of the present invention, the detailed description will be omitted.

[Experiment method]

1. Study subject and GWA data set

This study used bioinformatics data based on the first IA GWAS for Koreans in 2019 (J Clin Med. 2019 Feb; 8(2): 275.). More specifically, the genetic information data of 250 IA patients and 296 healthy controls were used, and the criteria for IA patients classified in this study are as follows:

1) saccular cerebral aneurysm;

2) adult patients over 18 years of age;

3) No other vascular malformations in the brain.

Pre-stage genotyping of SNPs in each individual using Eagle v2.4 and Minimac4 programs, and 512,575 genotyped SNPs using Axiom ^TH Asian Precision Medicine Research Array (APMRA) (Thermo Fisher Scientific, MA, USA) Massive SNP and genotype missing values were estimated for 250 patients and 296 controls, including .

2. Genotyping, high-throughput imputation, and quality control (QC)

Since the first GWAS obtained in Method 1 is not randomized control study data, the genome-wide genotype data was corrected through the “Batch Allele Consistency (BAC)” function. In the genotyping of each individual, irregular SNPs may be included in the data due to intensity changes caused by separately processing each sample, and BAC may be used to identify and remove irregular SNPs from the genotype.

Accordingly, the first genotype data obtained in Method 1 was corrected using Axiom™Analysis Suite v1.1.1, Applied Biosystems™ (APT) v1.18, and SNPolisher™R package v3.0 (FIG. 1).

Subsequently, the Asian-specific reference panel (GRCh37hg19) produced by the GenomeAsia 100K project supported by the National Institutes of Health (NIH) National Heart, Lung and Blood Institute (NHLBI) was applied.

In addition, high-throughput variation was supplemented with Michigan Imputation Server v1.5.7 ( https://imputationserver.sph.umich.edu/index.html#!run/minimac4 ).

This study was conducted with the approval of The Institutional Review Board and Ethics Committee (No. 2016-3 and 2019-06-006).

3. Statistical analysis

High-throughput GWAS (high-throughput GWAS) was performed after adjusting for variables such as gender, age, underlying disease, and four principal component analysis (PCA) values. An inheritance model was established from the additive effective model, and a large-scale GWAS was performed with the PLINK v1.9 program ( https://www.cog-genomics.org/plink/ ). Manhattan plots and region-related plots are from “qqman” in the R package v3.6.0 ( https://cran.r-project.org/web/packages/qqman ) and modified Python and R scripts ( http://locuszoom.org /) of LocusZoom v1.3 .

[Experiment result]

A schematic diagram of the experiment and a summary of the results are shown in FIG. 2 .

The first GWAS identified 29 SNPs, which may be due to Mendelian variants. Despite the lack of Linkage Disequilibrium (LD) tower, 8 loci of GBA , TCF24 , OLFML2A , ARHGAP32 , CD163L1 , CUL4A , LOC102724084 , and LRRC3 showed sufficient statistical power of 80%, which was previously reported. BOLL and EDNRA loci were also validated. The updated GWAS based on high-throughput imputation provided 6,105,212 SNPs out of a total of 7,333,746 sites, showing an imputation R ² score of ≥ 0.5, a genotyping call rate of ≥ 95%, and a minor allele frequency (MAF) of ≥ 0.01. , and Hardy-Weinberg equilibrium (HWE) p-value of ≥ 0.001 passed the QC test.

PC1 and PC2 of 546 study subjects (250 IA patients and 296 controls) showed good variance in the East Asian population (dark green) (Fig. 3A) and showed an expanded distribution without heterogeneity between subjects (Fig. 3B) . Among the 6M markers, 39 SNPs reached the genome-wide significant threshold ( p = 5×10 ^-8 ) (Fig. 3C).

After pruning treatment by LD pairs ( r ² <0.8), 11 SNPs consistently associated with IA, defined as MAF and HWE p-value (≥0.05), were identified (Table 2).

Gene Function Chr SNPs Position M m MAF HWE p OR L95 U95 P LOC440704, RGS18 intergenic 1q31.2 rs3120004 191221672 C T 0.374/0.218 0.865 2.34 1.74 3.14 1.4E-08 LOC101928851, NONE intergenic 4q12 rs1851347 59220726 A G 0.438/0.279 0.564 2.26 1.70 3.01 1.9E-08 LOC101928851, NONE intergenic 4q12 rs1522095 59222703 A G 0.344/0.188 0.848 2.66 1.93 3.66 2.6E-09 LINC01162, SP4 intergenic 7p15.3 rs7779989 21265984 A G 0.378/0.221 0.065 2.49 1.83 3.37 4.6E-09 IGSF9B intronic 11q25 rs191300 133800017 T C 0.192/0.074 1.000 3.14 2.08 4.72 4.4E-08 C12orf5 Near UTR-5 12p13.32 rs4766232 4430018 A G 0.292/0.451 0.196 0.44 0.33 0.59 1.1E-08 LINC00433, LINC00440 intergenic 13q31.2 rs1571056 89306589 T C 0.18/0.323 0.425 0.42 0.31 0.57 3.7E-08 ATP11A intronic 13q34 rs2297801 113532224 C T 0.48/0.323 1.000 2.22 1.68 2.95 3.0E-08 LOC101928880, ZNF469 intergenic 16q24.2 rs12935558 88336978 A G 0.34/0.186 0.254 2.47 1.80 3.40 2.6E-08 MYH13 intronic 17p13.1 rs3826442 10227708 C T 0.242/0.416 0.634 0.42 0.32 0.56 3.1E-09 SLC47A1 intronic 17p11.2 rs2440154 19444987 G A 0.282/0.125 0.791 2.90 2.07 4.08 8.2E-10

^a M and m indicate major and minor allele types, respectively. Minor allele frequency (MAF) shows in case (left) and control (right). ^b Hardy-Weinberg equilibrium p-value (HWE p) was estimated under the control group composed of 296 subjects.

^c Odds ratio (OR), 95% confidence intervals (Cis: L95, lower level of 95% CI; U95, upper level of 95% CI), and p-values were estimated `by multivariate generalized linear model.

^d One tagging SNP is presented, which shows a strong pairwise linkage disequilibrium (LD, r ² > 0.8) in multiple SNPs.

Among the 11 SNPs, 6 SNPs formed a haplotype structure with an LD tower (FIGS. 4, 5, 6, 7, 8 and 9). The labeled rs3120004 SNP formed a large haplotype structure between the LOC440704 and RGS18 genes at position 1q31.2 ((odds ratio (OR) = 2.34, 95% confidence interval (CI): 1.74-3.14; p = 1.4 × 10 However, rs1522095, an intergenic SNP ⁽ LOC101928851 , 4q12), showed complete LD with rs1851347 and rs1996807 SNPs (OR = 2.28, 95% CI: 1.70-3.01; p = 1.9 × 10 ^-8 ). , confirming that rs1522095 is a single common SNP representing a LD( r ² ) pair of 0.64 with rs1851347 and labeled rs1522095 (OR = 2.66 95% CI: 1.93-3.66; p = 2.8 × 10 ^-9 ). Dog SNPs were located in the gene desert region.

On the other hand, the rs2440154 SNP ( SLC47A1 , 17p11.2) showed the most significant association with the increased risk of IA ((OR = 2.90, 95% CI: 2.07-4.08; p = 8.2 × 10 ^-10 ). In addition, 7p15 The three regions of .3, 16q24.2 and 17p13.1 also showed significant relevance in predicting the risk of IA occurrence.In particular, the region around rs3826442 SNP ( MYH13 , 17p13.1) was about 70 centi-morgan (cM) It showed high recombination rate of /mega base-pair (Mbp).

rs191300 ( IGSF9B , 11q25), rs4766232 ( C12orf5 , 12p13.32), rs1571056 ( LINC00433-LINC00440 , 13q31.2), and the other four SNPs in rs2297801 ( ATP11A , 13q34) represented a single segregating SNP in the current GWAS and LD could not be confirmed around the labeled SNP.

As above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry Academic Cooperation Foundation Hallym University <120> rs7779989 marker composition for diagnosing cerebral aneurysm and method of use <130> P214510 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 201 <212> DNA <213> Homo sapiens <220> <221> <222> (101) <223> y = c or t <400> 1 aagtatttgg taaaattcag cagtaaattc accaggtcct tggctattct ttgatggggag 60 acattttatt catagttcta tcttgttact taatattgat ygattcaggt tttatatttc 120 ttcatggttc attcttggta ggtggtatgt gtttagaaat ttatccatta cctctaagtt 180 ttcaaattta gtggtacata g 201 <210> 2 <211> 201 <212> DNA <213> Homo sapiens <220> <221> <222> (101) <223> r = a or g <400> 2 tccctaaaaa gggagaaatt acaaacattt tttcctagaa atggagagga cataatattt 60 aatgctattc tgatggcttt gcattgaaat tggtcaagct ractaggctg agattatttt 120 ccaaaatttt ctttcaagtt acagtgggac acaagagaaa ttcttgtgg agttttggag 180 ggcagaggtg atactcatac t 201 <210> 3 <211> 201 <212> DNA <213> Homo sapiens <220> <221> <222> (101) <223> r = a or g <400> 3 ttctgctctt tgaacccatc tctccaggtt gaaaccatct tggcaaagta ttatcagccg 60 gtgtcttcgg ctagatggac ctttcaagcc ctcctaaggt ragaaaatgt tatttttccc 120 ttttatgtgt tgtggttcat tggatagtat ttgtcatctt gtcacataat aggaatgacg 180 ttcacaatgt tgaaatacgc c 201 <210> 4 <211> 200 <212> DNA <213> Homo sapiens <220> <221> <222> (101) <223> r = a or g <400> 4 caaggtaaca attcacttca tcccatgtat cattgcataa gttctcctgg gccccgttgg 60 ctggggacgt ggacacgtgt gatttctgct ctgcaccctc rccagcgctg ttctttccag 120 tgggcctttc cagccgggat cctgccccact tccttgtgcc cagctttcca gagcccctca 180 gcccctccaa gggcccacca 200 <210> 5 <211> 201 <212> DNA <213> Homo sapiens <220> <221> <222> (101) <223> y = c or t <400> 5 ttgattggcc tctttgaaaa tgctacaaag aaagggtatc accctctaaa agcttattat 60 ctacacctaa gccaagaaat gggtcatgca cacacatgca ygcacatgtg cacacactgc 120 acacacacgt gtacataaac ttagatatca cccataaaca cattttttct ttttagatgg 180 agtttctctc tgtggcccag g 201 <210> 6 <211> 201 <212> DNA <213> Homo sapiens <220> <221> <222> (101) <223> r = a or g <400> 6 aagtatttgg taaaattcag cagtaaattc accaggtcct tggctattct ttgatggggag 60 acattttatt catagttcta tcttgttact taatattgat ygattcaggt tttatatttc 120 ttcatggttc attcttggta ggtggtatgt gtttagaaat ttatccatta cctctaagtt 180 ttcaaattta gtggtacata g 201

Claims (10)

A SNP marker composition for diagnosing cerebral aneurysm, including rs7779989 single nucleotide polymorphism (SNP).
A composition for diagnosing a cerebral aneurysm, comprising an agent capable of detecting rs7779989 single nucleotide polymorphism (SNP).
According to claim 2,
rs3120004, rs1522095, rs12935558, rs3826442, and rs2440154 further comprising an agent capable of detecting any one or more SNPs selected from the group consisting of, a composition for diagnosing a cerebral aneurysm.
According to claim 2,
The agent capable of detecting the SNP is a probe or primer that specifically binds to a polynucleotide having 8 to 50 consecutive base sequences including the SNP or a base sequence complementary thereto in the genomic region where the SNP is located. Characterized in that, the diagnostic composition.
According to claim 2,
The composition is for diagnosing cerebral aneurysms in Koreans or Asians, diagnostic composition.
A kit for diagnosing a cerebral aneurysm comprising the composition of claim 2.
Information provision method for diagnosing cerebral aneurysm comprising the following steps:
(1) preparing a biological sample from the subject;
(2) obtaining genomic DNA from the biological sample;
(3) detecting the base type of the GenBank SNP database rs7779989 single nucleotide polymorphism (SNP) position in the genomic DNA; and
(4) determining the risk or susceptibility of developing a cerebral aneurysm of an individual from the detected base type.
According to claim 7,
Characterized in that the individual in step (1) is Korean or Asian, information providing method.
According to claim 7,
Base type detection in step (3) is performed by sequencing, microarray hybridization, allele specific PCR, and dynamic allele-specific hybridization (DASH). , Fluorescence Melting Curve Analysis (FMCA) and Taqman technique, characterized in that carried out by any one method selected from the group consisting of, information providing method.
According to claim 7,
In step (3), when the base type at position rs7779989 is detected as Guanine,
Characterized in that the individual in step (4) is determined to have a high risk or susceptibility to the occurrence of a cerebral aneurysm, an information providing method.