KR20230099707A - Composition for preventing or relieving hangovers containing extracts from natural materials - Google Patents

Abstract

The present specification provides a composition for preventing or relieving hangover containing natural extracts as an active ingredient, and specifically, the natural materials include Ecklonia cava, rhubarb, quince, water parsley, barley sprout, Schisandra chinensis, abalone, hibiscus, sea cucumber, and gal root. At least one member selected from the group consisting of, the composition has an effect of improving hangover symptoms that occur after ingestion of alcohol, an effect of activating alcohol dehydrogenase (ADH), and acetaldehyde dehydrogenase (ALDH).

Description

Composition for preventing or relieving hangovers containing extracts from natural materials}

The present specification relates to a composition for preventing hangover and/or relieving hangover, which includes a natural extract having an effect of improving hangover symptoms that occur after ingestion of alcohol, activating alcohol dehydrogenase (ADH), and/or acetaldehyde dehydrogenase (ALDH). it's about

Due to frequent drinking and excessive drinking, which are characteristics of Korean drinking culture, many people are showing high interest in drugs or drinks that can remove hangovers.

Hangover refers to symptoms such as headache, diarrhea, anorexia, nausea, vomiting, chills, and cold sweat that appear after drinking alcohol. It is known that the cause of a hangover is dehydration, toxicity of alcohol and alcohol metabolites (acetaldehyde, formaldehyde, acetone, etc.), and nutrient deficiency (blood sugar, vitamin, and mineral deficiency) due to malabsorption. The degree of hangover varies greatly depending on individual variation according to heredity and environmental conditions (nutrition status, exercise status, dehydration level, health status).

After drinking, alcohol is metabolized through three pathways. When the concentration of ethanol is low, alcohol dehydrogenase and acetaldehyde dehydrogenase present in the gastrointestinal tract or liver act. It is metabolized into acetaldehyde and acetic acid by the microsomal ethanol oxidizing system (MEOS) present in the endoplasmic reticulum, and then converted to carbon dioxide (CO ₂ ) through the action of catalase present in the peroxisome. ) and finally decomposed into water (H ₂ O). When an appropriate amount of alcohol is introduced, the above-described metabolic system works smoothly and all symptoms caused by alcohol do not occur. It can cause fatigue, loss of concentration, heartburn and indigestion, and liver dysfunction in the long term.

Recently, as interest in natural materials with relatively few side effects has increased, research on hangover relieving compositions using natural materials is required.

Under this background, the present inventors selected some of the natural materials to develop a hangover reliever using the natural material, and the antioxidant effect of the natural material extract and alcohol dehydrogenase (ADH) known to affect hangover relief ), and acetaldehyde dehydrogenase (ALDH) activation efficacy were confirmed to develop a composition for preventing and/or relieving hangover.

An example of the present specification is a pharmaceutical and/or anti-hangover medicine containing at least one natural extract selected from the group consisting of Ecklonia cava, rhubarb, quince, water parsley, barley sprout, Schisandra chinensis, etc. as an active ingredient. A food composition is provided.

One example of the present specification is one or more selected from the group consisting of Ecklonia, rhubarb, quince, parsley, barley sprout, Schisandra, abalone, hibiscus, sea cucumber, and root (e.g., 1, 2, 3, 4, 5 6 species, 7 species, 8 species, 9 species, or 10 species) of natural material extracts are used to prevent hangovers and/or relieve hangovers.

More specifically, at least one (e.g., one, two, three, four, five, or six) natural material extracts selected from the group consisting of Ecklonia cava, rhubarb, quince, buttercup, barley sprout, and Schizandra chinensis It provides a pharmaceutical and / or food composition for preventing and / or relieving hangover, containing as an active ingredient.

The composition may further include one or more (e.g., one, two, three, or four) natural extracts selected from the group consisting of abalone, hijab, sea cucumber, and kale root, and are limited thereto no.

The composition and/or the natural material extract may have an antioxidant effect, but is not limited thereto.

The composition and/or the natural material extract may have ADH and ALDH activity effects, but is not limited thereto.

The expression level of the gene expression for the ADH and ALDH activities of the composition and/or the natural material extract may increase in proportion to the concentration of the composition, but is not limited thereto.

The natural material extract is one or more selected from the group consisting of Ecklonia cava, rhubarb, quince, water parsley, barley sprout, Schisandra, abalone, hibiscus, sea cucumber, and root (e.g., 1 type, 2 types, 3 types, 4 types, 5 types) , 6 species, 7 species, 8 species, 9 species or 10 species) extracts obtained by extraction treatment of natural materials, filtrates of the extracts, dilutions or concentrates of the extracts, dried products obtained by drying the extracts, and the extracts It may include, but is not limited to, extracts of all formulations that can be formed using the extract itself and the extract, such as a crude product, a purified product, or a mixture thereof.

The natural material extract may be an extract obtained by extracting whole plants or parts (eg, fruits, roots, leaves, flowers, and/or stems, etc.) of each plant with an extraction solvent. The whole plant or part of the natural material (eg, fruit, root, leaf, flower, and/or stem, etc.) may be used for extraction as it is or in a dried and/or heated state. The extraction solvent may be water, lower alcohol (a straight-chain or branched-chain alcohol having 1 to 4 carbon atoms, such as ethanol), or a mixture thereof, for example, 30 to 100 (v / v)%, 40 to 100 (v /v)%, 50 to 100 (v/v)%, 60 to 100 (v/v)%, 65 to 100 (v/v)%, 70 to 100 (v/v)%, 30 to 90 (v/v)% /v)%, 40 to 90 (v/v)%, 50 to 90 (v/v)%, 60 to 90 (v/v)%, 65 to 90 (v/v)%, 70 to 90 (v/v)% /v)%, 30 to 80 (v/v)%, 40 to 80 (v/v)%, 50 to 80 (v/v)%, 60 to 80 (v/v)%, 65 to 80 (v/v)% /v)%, 70 to 80 (v/v)%, 30 to 75 (v/v)%, 40 to 75 (v/v)%, 50 to 75 (v/v)%, 60 to 75 (v/v)% /v)%, 65 to 75 (v/v)%, 70 to 75 (v/v)%, 30 to 70 (v/v)%, 40 to 70 (v/v)%, 50 to 70 (v/v)% /v)%, 60 to 70 (v/v)% or 65 to 70 (v/v)%, such as 70 (v/v)% lower alcohol or lower alcohol aqueous solution (e.g., ethanol or aqueous ethanol solution) day may be, but is not limited thereto.

Hereinafter, the present invention will be described in more detail.

In the present specification, “extract” may be used to mean any one of an extract, a dried product obtained by drying the extract, and a concentrate obtained by concentrating the extract, and may be used as a meaning commonly used in the art, and is limited thereto. no.

In the present specification, "Ecklonia cava Kjellman" refers to seaweed with brown algae plant kelp order seaweed.

In the present specification, "rhubarb (Eisenia bicyclis)" refers to a perennial plant belonging to the dicotyledonous bicotyledonous plant group Knobaceae.

In the present specification, “haliotis discus hannai” refers to a generic term for mollusks belonging to the primitive gastropod abalone family.

In the present specification, "Hizikia fusiforme" is a seaweed of the brown algae plant family. It refers to perennial algae that live in the lower intertidal zone and exist only in the meteorite generation.

In the present specification, “sea cucumber (Apostichopus japonicus)” refers to a generic term for sea cucumbers belonging to the class Echinoderm Sea Cucumber.

In this specification, “Pseudocydonia Fruit” refers to the fruit of a quince tree, and is sometimes referred to as a melon-like fruit hanging on a tree, so it is also referred to as a quince or quince.

In the present specification, "Minari (Oenanthe javanica DC.)" is a native plant in Korea and refers to a leafy vegetable that was collected and used to grow in fields or streams mainly in spring and autumn.

In this specification, "Barley Sprout" is also called sprout barley or barley sprout, and means a young sprout about a week after germination by growing sprouts generated from barley seeds.

In this specification, “Schisandra Fruit” refers to the fruit of Schisandra tree, and is called Schisandra Fruit because it is a deep red color with a diameter of about 1 cm and can feel sweet, sour, bitter, salty, and spicy tastes.

In the present specification, “Kudzu Root (Pueraria lobata Ohwi)” refers to the dried root or perianth of Korean, Chinese, and Japanese arrowroot (Pueraria montana var. lobata: also indicated as Pueraria lobata) and dried roots it means)

In the present specification, the “antioxidant” effect inhibits cell oxidation by highly reactive free radicals or reactive oxygen species (ROS) according to intracellular metabolism or oxidative stress caused by the influence of ultraviolet rays. It means that, by removing free radicals or reactive oxygen species, damage to cells caused by them is reduced.

In the present specification, “alcohol dehydrogenase (ADH)” refers to an enzyme that reversibly catalyzes a reaction of releasing hydrogen from alcohol to produce an aldehyde or a ketone, and consists of seven dehydrogenases.

In the present specification, “acetaldehyde dehydrogenase (ALDH)” refers to a type of dehydrogenase that catalyzes a reaction of converting acetaldehyde to acetic acid.

In this specification, “hangover” refers to an unpleasant physical condition caused by ingesting alcoholic beverages (ethanol) such as alcohol beyond one's metabolic capacity. Alcohol (ethanol) is metabolized to acetaldehyde, which remains in the body and causes hangover symptoms. A hangover may be a noticeable phenomenon after drinking alcohol at night and waking up the next morning. Unlike acute alcohol poisoning, hangover is not a direct threat to life, but it can often be accompanied by significant discomfort such as motion sickness and headache. The ADH decomposes alcohol to generate acetaldehyde, which can be converted to ALDH acetic acid, so when the expression of ADH and ALDH is promoted, alcohol is rapidly decomposed, and acetaldehyde, which is the cause of hangover, is also disappeared by ALDH It can prevent or cure hangovers.

The amount of the extraction solvent used for extraction of the natural material extract provided in the present specification is the weight of the whole plant and / or part (eg, fruit, root, leaf, flower, and / or stem, etc.) of the natural material, for example, the natural material and/or part of the dry weight basis, 1 to 40 times by volume (ie, 1 to 40 ml of solvent per 1 g of dry weight of natural material, hereinafter the same), 1 to 35 times by volume, 1 to 30 times by volume, 1 to 25 times by volume , 1 to 23 times the volume, 10 to 40 times the volume, 10 to 35 times the volume, 10 to 30 times the volume, 10 to 25 times the volume, 10 to 23 times the volume, 15 to 40 times the volume, 15 to 35 times the volume, 15 to 30 times the volume, 15 to 25 times the volume, 15 to 23 times the volume, 17 to 40 times the volume, 17 to 35 times the volume, 17 to 30 times the volume, 17 to 25 times the volume, or 17 to 23 times the volume, For example, it may be 20 times the volume, but is not limited thereto.

The extraction may be performed once, or may be performed two or more times (eg, 2, 3, 4, or 5 times) with the same or different extraction solvents and/or conditions.

The extraction time during the extraction is 1 hour to 60 hours, 1 hour to 48 hours, 1 hour to 42 hours, 1 hour to 36 hours, 1 hour to 30 hours, 1 hour to 27 hours, 12 to 60 hours, 12 to 48 hours, 12 to 42 hours, 12 to 36 hours, 12 to 30 hours, 12 to 27 hours, 18 to 60 hours, 18 to 48 hours, 18 hours to 42 hours, 18 hours to 36 hours, 18 hours to 30 hours, or 18 hours to 27 hours, for example, 24 hours, but is not limited thereto.

The extraction temperature during the extraction is 20 to 100 ℃, 20 to 90 ℃, 20 to 80 ℃, 20 to 75 ℃, 20 to 70 ℃, 20 to 65 ℃, 30 to 100 ℃, 30 ℃ for sufficient extraction of the active ingredient to 90°C, 30 to 80°C, 30 to 75°C, 30 to 70°C, 30 to 65°C, 40 to 100°C, 40 to 90°C, 40 to 80°C, 40 to 75°C, 40 to 70°C, 40°C to 65°C, 50 to 100°C, 50 to 90°C, 50 to 80°C, 50 to 75°C, 50 to 70°C, 50 to 65°C, 55 to 100°C, 55 to 90°C, 55 to 80°C, 55 to 75 °C, 55 to 70 °C, or 55 to 65 °C, for example, 60 °C, but is not limited thereto.

An extraction method for obtaining the extract may be prepared according to a known extraction method commonly used in the art to which the present invention belongs. Specifically, commonly used extraction methods such as reflux extraction, immersion extraction, heat extraction, cold precipitation, hot water extraction, ultrasonic extraction, filtration, pressurized extraction, supercritical extraction, and electrical extraction may be used.

The content of the extract as an active ingredient in the pharmaceutical composition may be appropriately adjusted depending on the type and purpose of use, the condition of the subject to be used, the type and severity of symptoms, etc., and is 0.001 to 99.9% by weight, or 0.1 to 50% by weight based on the solid content. %, but is not limited thereto.

The pharmaceutical composition is suitable for humans, primates such as monkeys, rodents such as mice, rats and rabbits, other mammals including dogs, cats, cows, pigs, sheep, horses, goats, chickens, ducks and geese. It can be administered to a target selected from vertebrates such as birds, snakes, lizards, turtles, reptiles including crocodiles, amphibians, and fish, including the like, by various routes.

The method of administration of the pharmaceutical composition may be any method commonly used, for example, oral administration, intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, topical administration at the lesion site, or parenteral administration such as intraperitoneal injection. It can be administered by route. All modes of administration can be envisaged, eg oral, or parenteral administration (intraperitoneal, rectal, intravenous, intramuscular or subcutaneous injection, or transdermal administration). At this time, the parenteral route is preferably transdermal administration, and among them, topical application may be the most preferable. A preferred dosage of the pharmaceutical composition according to the present invention varies depending on the condition and body weight of the patient, the severity of the disease, the drug type, the route and period of administration, but can be appropriately selected by those skilled in the art. However, for desirable effects, the pharmaceutical composition according to the present invention may be administered in an amount of 0.1 to 100 mg/kg once or several times a day, but is not limited thereto.

In addition to the above active ingredients, the pharmaceutical composition is generally selected from the group consisting of pharmaceutically and/or physiologically acceptable carriers, excipients, and diluents selected in consideration of the method of administration and standard pharmaceutical practice. It may be administered in admixture with one or more adjuvants. For example, the pharmaceutically and/or physiologically acceptable carrier may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, It may contain at least one selected from the group consisting of cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. However, it is not limited thereto, and may be any carrier commonly used in the pharmaceutical field.

The pharmaceutical composition may be administered in a pharmaceutically effective amount. The dosage of the pharmaceutical composition is variously prescribed by factors such as formulation method, administration method, patient's age, weight, sex, disease condition, food, administration time, administration interval, administration route, excretion rate, and reaction sensitivity. It can be. The dosage may vary depending on the patient's age, weight, sex, dosage form, health condition, and degree of disease, and may be divided into once or several times a day at regular time intervals according to the judgment of a doctor or pharmacist.

For example, the one-time or daily dosage of the pharmaceutical composition is 0.001 to 0.001 based on the weight of the solid content of the active ingredient (natural material such as Ecklonia, rhubarb, quince, water parsley, barley sprout, Schisandra chinensis, abalone, hijab, sea cucumber, and root). 10000 mg/kg, specifically, 0.01 to 10000 mg/kg, 0.01 to 5000 mg/kg, 0.01 to 3000 mg/kg, 0.01 to 2500 mg/kg, 0.01 to 2000 mg/kg, 0.01 to 1800 mg/kg, 0.1 to 10000 mg/kg, 0.1 to 5000 mg/kg, 0.1 to 3000 mg/kg, 0.1 to 2500 mg/kg, 0.1 to 2000 mg/kg, 0.1 to 1800 mg/kg, 1 to 10000 mg/kg, 1 to 5000 mg/kg, 1 to 3000 mg/kg, 1 to 2500 mg/kg, 1 to 2000 mg/kg, 1 to 1800 mg/kg, 10 to 10000 mg/kg, 10 to 5000 mg/kg, 10 to 3000 mg/kg, 10 to 2500 mg/kg, 10 to 2000 mg/kg, 10 to 1800 mg/kg, 100 to 10000 mg/kg, 100 to 5000 mg/kg, 100 to 3000 mg/kg, 100 to 2500 It may range, but is not limited to, mg/kg, 100 to 2000 mg/kg, or 100 to 1800 mg/kg. The one-time or daily dose may be formulated as a single formulation in unit dose form, formulated in appropriate portions, or prepared by placing it in a multi-dose container. The above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences.

The pharmaceutically and / or physiologically acceptable diluent and / or excipient is selected from the group consisting of all fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, etc. commonly used in the proper formulation of pharmaceutical compositions It may be one or more.

For example, in the case of solid preparations for oral administration such as tablets, pills, powders, granules, or capsules, the excipient is at least one material for formulating such solid preparations, such as starch, calcium carbonate , sucrose, lactose, and may be one or more selected from the group consisting of gelatin. In addition, lubricants such as magnesium styrate, talc, and the like may also be used. In addition, in the case of formulation of liquid preparations for oral administration such as suspensions, internal solutions, emulsions, syrups, etc., at least one selected from the group consisting of commonly used simple diluents such as water, liquid paraffin, etc. may be used. , Various excipients commonly used, for example, wetting agents, sweeteners, aromatics, and / or preservatives may be included, but are not limited thereto.

For example, the pharmaceutical composition may be in the form of a tablet containing starch or lactose, or in the form of a capsule containing suitable excipients, or in the form of an elixir or suspension containing a flavoring or coloring chemical, orally, orally. It can be administered intra- or sublingually. Such liquid formulations may be prepared by suspending agents (e.g. methylcellulose, semi-synthetic glycerides such as Witepsol, or mixtures of Apricot kernel oil and PEG-6 esters or PEG-8 and caprylic/capric acid). It can be formulated with pharmaceutically acceptable excipients such as mixtures of glycerides).

In the food composition, the term "food" means an edible natural product or processed product containing one or more nutrients, and as a general meaning, any one of various foods, health functional foods, beverages, food additives, and beverage additives It may be used to mean, and the term "food composition" may mean a combination of ingredients for preparing the food. Examples of the food include various foods, beverages, gum, candy, tea, pills, and functional foods. In one example, the food may be a hangover relief drink or pill formulation.

The content of the extract as an active ingredient in the food composition may be appropriately adjusted depending on the type of food use, purpose, etc., and may be, for example, 0.00001 to 99.9% by weight, or 0.001 to 50% by weight based on the solid content, but is not limited thereto. don't

The food composition includes humans, primates such as monkeys, rodents such as mice, rats, rabbits, other mammals including dogs, cats, cows, pigs, sheep, horses, goats, chickens, ducks, geese, etc. It may be applied to a target selected from vertebrates such as reptiles, amphibians, and fish, including birds, snakes, lizards, turtles, and crocodiles.

The present invention relates to a composition for preventing hangover and/or relieving hangover, comprising a natural extract as an active ingredient, and is effective in improving hangover symptoms after alcohol intake, alcohol dehydrogenase (ADH), and acetaldehyde dehydrogenase (ALDH). have an activating effect.

1 is a graph showing the results of measuring the measured extraction yield of natural extracts.
Figure 2 is a graph showing the polyphenol content in the natural material extract.
Figure 3 is a graph showing the results of measuring the DPPH radical scavenging ability of natural extracts. Vit.C means 100 ppm of vitamin C used as a control.
Figure 4 is a graph showing the results of measuring the ABTS radical scavenging ability of the natural material extract. Vit.C means 100 ppm of vitamin C used as a control.
5 to 7 are the results of measuring the cell regeneration rate when the natural material extract is treated. Con denotes a control group not treated with the extract, EtOH denotes a case treated with ethanol, and SM denotes a positive control group treated with silymarin.
8 to 12 are the results of measuring the amount of ADH expression and ALDH expression when the natural material extract was treated. Con denotes a control group not treated with the extract, EtOH denotes a case treated with ethanol, and SM denotes a positive control group treated with silymarin.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are intended to illustrate the present invention and do not limit the scope of the present invention.

Example 1. Production of extracts from marine materials and medicinal materials

Ecklonia cava Kjellman, rhubarb (Eisenia bicyclis), abalone (Haliotis discus hannai), Hizikia fusiforme, sea cucumber (Apostichopus japonicus), quince (Pseudocydonia Fruit), water parsley (Oenanthe javanica DC.), barley sprout (Barley) Sprout), omija (Schisandra Fruit), and 40 g of marine and medicinal materials of Pueraria lobata Ohwi were prepared, and 70 (v/v) with a volume (800ml) that is 20 times the weight of each material After adding % ethanol, the extract was prepared by stirring and extraction at 120 rpm for 24 hours at 60 ° C, concentrated using a vacuum concentrator and frozen at -80 ° C. Then, it was dried using a lyophilizer and powdered to prepare a 70% ethanol extract of each material.

The extraction yield of the prepared extract was obtained by measuring the powdered weight by freeze-drying each sample and dividing it by the weight of the original material used in the preparation of the extract to obtain a percentage (e.g. Ecklonia - (freeze-dried weight 10.7 / extraction sample amount) 40 g) X 100 = 26.74), and the results are shown in Table 1 and FIG. 1 below.

sample name Extraction sample amount (g) 70% EtOH
Solvent amount (ml) Weight after drying (g) Extraction yield (%) Ecklonia 40 800 10.70 26.74 rhubarb 6.14 15.34 abalone 4.44 11.09 seaweed 14.35 35.88 Sea cucumber 7.97 19.93 Quince 13.45 33.63 water parsley 10.50 26.25 sprout barley 9.12 22.81 Schisandra 17.60 44 Arrowroot (Kudzu root) 12.03 30.07

The powdered extract was dissolved in 70 (v / v)% ethanol to prepare an extract having a concentration of 500ug / ml, and DPPH and ABTS measurement experiments of Examples 3 and 4 were performed.

Example 2. Antioxidant effect test 1 of marine material and medicinal material extract 1 (polyphenol)

In Example 1, the antioxidant effect of the extract prepared by stirring and extraction without freeze-drying was partially modified by the Folin-Denis method to convert free radicals (free radicals) in the body into harmless substances. It was confirmed by measuring the content of phenol.

Specifically, 200 μl of 2% Na ₂ CO ₃ solution was added to 10 μl of the extract prepared in Example 1, 10 μl of Folin &Ciocalteu's phenol reagents were mixed, and reacted at room temperature for 30 minutes, followed by a spectrophotometer (microplate reader (TECAN / SPARK)). ) was used to measure the absorbance at 760 nm. Galic acid (Sigma co., USA) was used as a standard material, and the total polyphenol content was calculated with a calibration curve prepared by analyzing in substantially the same way as the extract, and the results are shown in FIG. 2 .

As a result, the polyphenol content of Ecklonia cava, rhubarb, quince, water parsley, barley sprout, Schisandra chinensis, and kudzu root was measured to be high.

Example 3. Antioxidant effect test 2 of marine material and medicinal material extract 2 (DPPH)

The antioxidant effect of the extract prepared in Example 1 was confirmed by modifying Blois' method (1958) to evaluate based on the scavenging ability for DPPH (1,1-diphenyl-2-picrylhydrazyl) free radicals.

Specifically, 20 μl of the extract prepared in Example 1 and 180 μl of a 200 μM DPPH solution were mixed, reacted for 30 minutes at 37 ° C in the dark, and then measured by using a spectrophotometer (microplate reader (TECAN / SPARK)). The change was measured at 517 nm, and the DPPH antioxidant capacity was obtained by Equation 1 below, and the results are shown in Table 2 and FIG. 3 below. As a control, 100 ppm of vitamin C prepared by dissolving 1 mg of L-ascorbic acid manufactured by JUNSEI Chemical in 10 ml of distilled water was used instead of the above extract.

sample Ecklonia rhubarb Quince Vitamin C density 500ug/ml 100ug/ml activation(%) 67.41 67.52 46.88 67.05 Standard Deviation(%) 1.70 1.21 1.51 0.79

[Equation 1]

DPPH radical scavenging activity (%) = [1-(A ₅₁₇ (sample)/A ₅₁₇ (blank))]×100%

(A ₅₁₇ (sample) refers to the 517 nm absorbance of the sample solution added group, and A ₅₁₇ (blank) refers to the 517 nm absorbance of the non-added group in which the extract is not mixed with the DPPH solution)

As a result, it was confirmed that the DPPH radical scavenging ability of Ecklonia cava extract and rhubarb extract was similar to or higher than that of 100 ppm of vitamin C, showing high antioxidant effect.

Example 3. Antioxidant effect test 3 of marine material and medicinal material extract 3 (ABTS)

The antioxidant effect of the extract prepared in Example 1 was modified according to Blois' method (1958) to measure the free radical scavenging activity of ABTS (2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)). .

Specifically, after dissolving ABTS in distilled water at a concentration of 7.4 mM, mixing 2.6 mM potassium persulfate 1:1, reacting for 24 hours in the dark at room temperature, and diluting the mixed ABTS solution with PBS solution to obtain 0.7 (±0.02) at 732 nm. adjusted to be. 180 μl of the adjusted ABTS solution and 20 μl of the extract prepared in Example 1 were mixed and reacted for 5 minutes, and then the absorbance at 732 nm was measured using a spectrophotometer (microplate reader (TECAN/SPARK)). Vitamin C of Example 2 was used, and based on the measured absorbance, the antioxidant capacity of ABTS was obtained by Equation 2 below, and the results are shown in Table 3 and FIG. 4 below.

sample Ecklonia rhubarb Quince kudzu root Vitamin C density 500ug/ml 25ug/ml activation(%) 99.29 99.47 99.44 97.04 63.09 Standard Deviation(%) 0.20 0.03 0.84 0.11 0.70

[Equation 2]

ABTS radical scavenging activity (%) = [1-(A ₇₃₂ (sample)/A ₇₃₂ (blank))] × 100%

(A ₇₃₂ (sample) refers to the 732 nm absorbance of the sample solution added group, and A ₇₃₂ (blank) refers to the 732 nm absorbance of the ABTS solution without the addition of extract)

As a result, it was confirmed that the ABTS radical scavenging activity of Ecklonia cava, rhubarb, quince and kudzu root extracts was higher than that of 100 ppm of vitamin C, showing a high antioxidant effect.

Example 4. Experiment to confirm hangover improvement effect of marine material and medicinal material extract

Example 4-1. Cell culture and cell regeneration rate calculation

He La[Chang Liver] Cells (purchased from American Type Culture Collection (ATCC)) were cultured in DMEM (Dulbecco Modified Eagle) containing 10% FBS (Fetal Bovine Serum) and 1% Penicillin/streptomycin at a concentration of 1×10 ⁵ Cells/mL. Medium) After dispensing 500 μL each into 24 wells, the culture was incubated for 24 hours at 37℃ and 5% CO ₂ conditions.

After removing the cell culture medium, 50% cell death was induced by culturing for 1 hour with Serum Free DMEM media in 10 (v/v)% EtOH. Then, after washing with PBS (phosphate buffered saline), each cell was treated with Ecklonia cava, Hijiki, Schizandra chinensis, and arrowroot extracts among the extracts prepared in Example 1 at concentrations of 25μg/mL, 50μg/mL, and 100μg/mL, respectively. Abalone, quince, buttercup, and barley sprout extracts were treated at concentrations of 3.125 μg/mL, 6.25 μg/mL, and 12.5 μg/mL, respectively, and rhubarb extracts were treated at concentrations of 6.25 μg/mL, 12.5 μg/mL, and 25 μg/mL, respectively. , and sea cucumber extract was treated at concentrations of 12.5 μg/mL, 25 μg/mL, and 50 μg/mL, and after 24 hours of incubation, 20 μL of 5 mg/mL MTT solution was dispensed into each well, followed by a reduction reaction for 3 hours. induced. Remove the supernatant, add 100 μL of dimethyl sulfoxide (DMSO) solution to completely dissolve the purple formazan crystals, and measure the absorbance at 570 nm using a spectrophotometer (microplate reader (TECAN/SPARK)) to measure the degree of color development. was calculated by Equation 3 below, and the results are shown in FIGS. 5 to 7. For comparison, a control group (Con) in which cell culture was performed without treating the extract, a case in which ethanol was treated as a negative control group (EtOH), and a positive control group in which ethanol treatment was followed by silymarin and cell culture were performed prepared.

[Equation 3]

Cell regeneration rate (%) = (A ₅₇₀ (sample)/A ₅₇₀ (Con)) × 100%

(A ₅₇₀ (sample) refers to the 570 nm absorbance of the sample solution added group, and A ₅₇₀ (Con) refers to the 570 nm absorbance of the non-added group not treated with the sample)

As a result, Ecklonia cava extract inhibited alcohol-induced apoptosis at 100 μg/mL or less and regenerated hepatocytes with a significant difference from 25 μg/mL, and rhubarb extract inhibited alcohol-induced apoptosis at 25 μg/mL or less. Cells were regenerated with a significant difference from 12.5μg/mL, Quince extract inhibited apoptosis caused by alcohol below 12.5μg/mL, and hepatocytes were regenerated with a significant difference from 6.25μg/mL, and water parsley extract inhibited alcohol-induced apoptosis at 12.5 μg/mL or less, and a significant difference was confirmed from 6.25 μg/mL, and barley sprout extract inhibited alcohol-induced apoptosis at 12.5 μg/mL or less and 6.25 μg/mL The regeneration of hepatocytes was confirmed with a significant difference from the concentration of Schisandra chinensis Schisandra chinensis extract inhibited apoptosis caused by alcohol at 100 μg/mL or less, and regenerated hepatocytes with a significant difference.

On the graph, the trend of increase according to each sample treatment was confirmed, and significant differences were marked with *. It is judged that there is no difference between the interpretation of the experimental results and the graph.

Example 4-2. ADH and ALDH gene expression confirmation

After dispensing in 24 wells of DMEM (Dulbecco Modified Eagle Medium) medium in Example 4-1, the supernatant of the cells cultured for 24 hours was removed, and trizol reagent was dispensed by 1mL and reacted for 10 minutes. Recovered after the reaction, 200 μL of Chloroform was dispensed and lightly shaken. Thereafter, centrifugation was performed at 4° C. and 12,000 rpm for 15 minutes. After centrifugation, only the clear supernatant was taken, the same amount of isopropyl alcohol was dispensed, left for 10 minutes, and centrifuged again at 4℃ and 12,000 rpm for 15 minutes. After removing the supernatant, it was washed twice using 75% DEPC (25% (0.1% Diethyl pyrocarbonate (GENERAY, RD054) treatment water in Ethanol) ethanol), and after washing, the supernatant was completely removed and dried until the remaining RNA became transparent. After dispensing 10~30μL of DEPC water and dissolving it, quantification was performed and cDNA was synthesized using TaKaRa kit. Second, 72 ℃ 20 seconds, 40 times were performed to confirm the ADH and ALDH gene expression levels The synthesized cDNA and primer information are shown in Table 2, and the gene expression level confirmation results are shown in Figures 8 to 12.

Gene Primer base sequence (5’ → 3’) Tm (℃) Accession No. of each gene cDNA. sequence number GAPDH_For accagaagactgtggatgg 59.3 NM_001357943 One GAPDH_Rev ttctagacggcaggtcaggt 59.3 2 ADH_For ccttcaccatcgaggacatagaag 62.7 NM_000673 3 ADH_Rev gccaccatcttaatgcgaactt 58.4 4 ALDH_For cgcaccatggatgcttca 56.0 NM_000689 5 ALDH_Rev cgcgatctctctccattaagtca 60.6 6

(In Table 2, Tm means melting temperature, that is, the lowest temperature at which a double strand is separated into a single strand) For comparison, a control (Con) in which cell culture was performed without treating the extract, and ethanol as a negative control In the case of treatment (EtOH), a positive control group was prepared in which ethanol treatment was followed by silymarin treatment and cell culture was performed.

As a result, in all cases where the extract was treated, it was confirmed that the ADH and ALDH expression rates increased in a concentration-dependent manner, confirming that all extracts had the hangover improvement effect. In the case of the extract, the ALDH expression rate was measured high, and in the case of Schisandra chinensis extract, it was confirmed that the ALDH expression rate was measured high.

Among the extracts, extracts with excellent cell regeneration rate and ADH/ALDH expression rate are extracts of rhubarb, Schizandra, Ecklonia cava, quince, water parsley and barley sprout, and among them, the extracts of rhubarb and Schisandra chinensis are measured higher than silymarin used as a positive control. It was confirmed that it was effective in relieving hangover.

<110> Marine Industry Research institute for East sea rim (MIRE) <120> Composition for preventing or relieving hangovers containing extracts from natural materials <130> DPP20215877KR <160> 6 <170> enPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH_For? <400> 1 acccagaaga ctgtggatgg 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH_Rev <400> 2 ttctagacgg caggtcaggt 20 <210> 3 <211> 24 <212> DNA <213> artificial sequence <220> <223> ADH_For <400> 3 ccttcaccat cgaggacata gaag 24 <210> 4 <211> 22 <212> DNA <213> artificial sequence <220> <223> ADH_Rev <400> 4 gccaccatct taatgcgaac tt 22 <210> 5 <211> 18 <212> DNA <213> artificial sequence <220> <223> ALDH_For <400> 5 cgcaccatgg atgcttca 18 <210> 6 <211> 23 <212> DNA <213> artificial sequence <220> <223> ALDH_Rev <400> 6 cgcgatctctctccattaag tca 23

Claims (15)

A pharmaceutical composition for preventing or relieving a hangover, comprising at least one natural extract selected from the group consisting of Ecklonia cava, rhubarb, quince, water parsley, barley sprout, and Schisandra chinensis as an active ingredient. The pharmaceutical composition for preventing or relieving a hangover according to claim 1, further comprising at least one natural extract selected from the group consisting of abalone, hijiki, sea cucumber, and kale root. The pharmaceutical composition for preventing or relieving a hangover according to claim 1, which has an antioxidant effect. The pharmaceutical composition for preventing or relieving hangover according to claim 1, wherein the composition has ADH and ALDH activity. According to claim 4, wherein the expression level of the gene expression for the ADH and ALDH activity is increased in proportion to the concentration of the composition, hangover prevention or hangover relief pharmaceutical composition. According to any one of claims 1 to 5, wherein the natural material extract is obtained by extracting the natural material with water, a straight or branched chain alcohol having 1 to 4 carbon atoms, or a mixture thereof, preventing or relieving a hangover. pharmaceutical composition for use. [Claim 7] The pharmaceutical composition for preventing or relieving a hangover according to claim 6, wherein the natural material extract is obtained by extracting the natural material with 50 to 100 (v/v)% ethanol. A food composition for preventing or relieving hangovers, comprising at least one natural extract selected from the group consisting of Ecklonia cava, rhubarb, quince, buttercup, barley sprout, and Schisandra chinensis as an active ingredient. [Claim 9] The food composition for preventing or relieving hangover according to claim 8, further comprising at least one natural extract selected from the group consisting of abalone, hijiki, sea cucumber, and kale root. The food composition for preventing or relieving hangover according to claim 8, which has an antioxidant effect. The food composition according to claim 8, wherein the composition has an effect of promoting ADH and ALDH expression. According to claim 11, wherein the expression of ADH and ALDH increases in proportion to the concentration of the composition, hangover prevention or hangover relief food composition. The method of any one of claims 8 to 12, wherein the natural material extract is obtained by extracting the natural material with water, a straight or branched chain alcohol having 1 to 4 carbon atoms, or a mixture thereof, preventing or relieving a hangover. food composition for use. The food composition according to claim 13, wherein the natural material extract is obtained by extracting the natural material with 50 to 100 (v/v)% ethanol. The food composition for preventing or relieving hangover according to any one of claims 8 to 12, which is in the form of a drink or a pill.

Images