KR20230077936A - Biomarker for predicting Cisplatin Resistance for Oral Cancer and Uses thereof - Google Patents

Abstract

The present invention relates to biomarkers for predicting cisplatin resistance of oral cancer, etc., selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and MTMR6 according to the present invention one or more proteins that are; Alternatively, by measuring the expression or activity level of mRNA encoding it, resistance to cisplatin in oral cancer patients can be evaluated in advance, so that more appropriate treatment can be applied to oral cancer patients to increase treatment efficiency, and can be usefully used in determining the direction of treatment. there is. In addition, providing a cisplatin-resistant oral cancer cell line can be usefully used to study the drug resistance mechanism of cisplatin, and can also be usefully used for screening new therapeutic agents capable of treating oral cancer resistant to cisplatin. It is expected that

Description

Biomarker for predicting Cisplatin Resistance for Oral Cancer and Uses thereof}

The present invention relates to biomarkers and the like for predicting cisplatin resistance in oral cancer.

Oral cancer is one of the top 10 most frequent cancers worldwide, and its incidence varies greatly depending on race, region, and socioeconomic conditions. For example, although oral cancer occurs in less than 5% of all cancers in developed countries, it is reported to be the third most common cancer in developing countries after cervical cancer and gastric cancer. In particular, in Europe, 50,000 new patients with oral cancer occurred in 1995, and 20,000 people died from oral cancer. In addition, it has been reported that among oral cancer patients in the United States, males account for 60% and females account for approximately 40%, indicating that males are more likely to develop oral cancer than females. In Korea, oral cancer accounts for about 5% of all cancers, and in terms of mortality, oral cancer is a serious disease that ranks 5th after stomach cancer, lung cancer, liver cancer, and colorectal cancer in men and 7th in women. . In addition, in the Republic of Korea, 1.7 males and 0.7 females per 100,000 people die each year due to oral squamous cell carcinoma (OSCC). In the past, oral cancer tended to occur mainly in older people, but recently, due to an increase in smoking and drinking, it has been reported that oral cancer patients in younger people are increasing.

On the other hand, cisplatin has been an important weapon in the fight against various cancers, including testicular, breast, ovarian, lung, and oral cancer, for decades after it was first approved by the US Food and Drug Administration (FDA) in 1978. However, although cisplatin shows a successful response in the early stages in many patients, its clinical usefulness is ultimately limited by the fact that resistance to cisplatin develops in most cases and induces tumor recurrence. Various side effects have been reported. So far, various attempts have been made to solve cisplatin resistance in major cancers such as lung cancer and breast cancer, but such studies are insufficient in oral cancer.

Therefore, if the efficacy of cisplatin in oral cancer can be evaluated in advance, it is expected to save time to find an effective pharmacotherapy for patients, block the progression of cancer due to resistance, and protect patients from side effects.

Republic of Korea Patent No. 10-1888022

The present inventors established cisplatin-resistant oral cancer cell lines to discover biomarkers that can predict resistance to cisplatin in oral cancer patients, and as a result of intensive research, AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and/or increased expression of SPTLC3; And/or HAT1, HIST1H3D, and/or MTMR6 expression reduction was confirmed to be associated with cisplatin resistance in oral cancer, thereby completing the present invention.

Accordingly, an object of the present invention is to provide a composition for predicting cisplatin resistance in oral cancer.

Another object of the present invention is to provide a kit for predicting oral cancer cisplatin resistance comprising the composition for predicting cisplatin resistance according to the present invention.

Another object of the present invention is to provide a method for providing information necessary for predicting oral cancer cisplatin resistance.

Another object of the present invention is to provide a cisplatin-resistant oral cancer cell line.

Another object of the present invention is to provide a method for screening cisplatin-resistant oral cancer therapeutic agents.

Another object of the present invention is to provide a pharmaceutical composition for overcoming cisplatin resistance.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned can be clearly understood by those skilled in the art from the description below. There will be.

In order to achieve the above object, the present invention AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly protein 1 like 2) , RMI1 (RecQ-mediated genome instability protein 1), HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6) at least one protein selected from the group consisting of; Alternatively, it provides a composition for predicting cisplatin resistance in oral cancer comprising, as an active ingredient, an agent for measuring the expression or activity level of mRNA encoding the same.

In one embodiment of the present invention, the composition for predicting cisplatin resistance is JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), HAT1 (histone At least one protein selected from the group consisting of acetyltransferase 1), and serine palmitoyltransferase (SPTLC3, long chain base subunit 3); Alternatively, an agent for measuring the expression or activity level of mRNA encoding the same may be further included as an active ingredient, but is not limited thereto.

In another embodiment of the present invention, the agent for measuring the mRNA level may be a primer set or a probe that specifically binds to the mRNA, but is not limited thereto.

In another embodiment of the present invention, the agent for measuring the protein level may be an antibody or an aptamer that specifically binds to the protein, but is not limited thereto.

In addition, the present invention provides a kit for predicting oral cancer cisplatin resistance comprising the composition for predicting cisplatin resistance according to the present invention.

In addition, the present invention (S1) AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly) in a biological sample isolated from the subject protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6) at least one protein selected from the group consisting of; or measuring the expression or activity level of mRNA encoding the same; And (S2) determining that the protein or mRNA expression or activity level measured in step (S1) is significantly changed compared to the control group as having resistance to cisplatin, which is necessary for predicting cisplatin resistance in oral cancer Provides a way to present information.

In one embodiment of the present invention, in step (S1), JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), HAT1 (histone acetyltransferase) 1), and at least one protein selected from the group consisting of serine palmitoyltransferase (SPTLC3, long chain base subunit 3); Alternatively, the expression or activity level of the mRNA encoding the same may be further measured, but is not limited thereto.

In another embodiment of the invention, the change is one or more proteins selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3; or the expression or activity level of the mRNA encoding it is increased compared to the control group; or one or more proteins selected from the group consisting of HAT1, HIST1H3D, and MTMR6; Alternatively, the expression or activity level of the mRNA encoding the same may be reduced compared to the control group, but is not limited thereto.

In another embodiment of the present invention, the biological sample is blood, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration specimen, core needle biopsy specimen, and vacuum aspiration biopsy specimen. It may be one or more selected from the group consisting of, but is not limited thereto.

In another embodiment of the present invention, the control group may be a biological sample isolated from an oral cancer patient without cisplatin resistance, but is not limited thereto.

In another embodiment of the present invention, the protein level is measured by Western blot, ELISA, radioimmunoassay, radioimmunoassay, Ouchterlony immunodiffusion, Rocket immunoelectrophoresis, immunostaining, immunoassay It may be measured by one or more methods selected from the group consisting of precipitation assay, complement immobilization assay, mass spectrometry, FACS, and protein chip, but is not limited thereto.

In another embodiment of the present invention, the mRNA level is measured from the group consisting of PCR, RNase protection assay, northern blotting, southern blotting, in situ hybridization, DNA chip, and RNA chip. It may be measured by one or more selected methods, but is not limited thereto.

In addition, the present invention is a cisplatin-resistant oral cancer cell line, which is AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly protein 1) like 2), and at least one protein selected from the group consisting of RecQ-mediated genome instability protein 1 (RMI1); Or the expression or activity level of the mNRA encoding it is increased; or at least one protein selected from the group consisting of HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6); Or it provides a cell line, characterized in that the expression or activity level of the mRNA encoding it is reduced.

In one embodiment of the present invention, the cell line is JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base subunit 3) at least one protein selected from the group consisting of; Or the expression or activity level of the mNRA encoding it is increased; or HAT1 (histone acetyltransferase 1) protein; Alternatively, the expression or activity level of the mRNA encoding the same may be reduced, but is not limited thereto.

In another embodiment of the present invention, the cell line may have a reduced expression or activity level of at least one protein selected from the group consisting of collagen type IV alpha 1 (COL4A1) and cadherin 1 (CDH1) or mRNA encoding the same. , but not limited thereto.

In another embodiment of the present invention, the cell line may be one in which epithelial-mesenchymal transition (EMT) has occurred, but is not limited thereto.

In addition, the present invention comprises the steps of (a) processing a candidate substance to the cisplatin-resistant oral cancer cell line according to the present invention; (b) measuring the cell viability of the cisplatin-resistant oral cancer cell line treated with the candidate substance of step (a); and (c) comparing the level of cell viability measured in step (b) with the level of cell viability of a cisplatin-resistant oral cancer cell line not treated with the candidate substance.

In one embodiment of the present invention, when the cell viability of the cisplatin-resistant oral cancer cell line treated with the candidate material identified in step (b) is lower than the cell viability level of the cisplatin-resistant oral cancer cell line not treated with the candidate material, the candidate material can be judged as a treatment for cisplatin-resistant oral cancer.

In addition, the present invention comprises the steps of (a) processing a candidate substance to the cisplatin-resistant oral cancer cell line according to the present invention; (b) AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 in cisplatin-resistant oral cancer cell lines treated with the candidate substance of step (a) above (nucleosome assembly protein 1 like 2), and at least one protein selected from the group consisting of RMI1 (RecQ-mediated genome instability protein 1); or measuring the expression or activity level of mRNA encoding the same; and (c) the protein measured in step (b); Alternatively, the expression or activity level of the mRNA encoding the protein of a cisplatin-resistant oral cancer cell line not treated with the candidate substance; Or it provides a screening method for a cisplatin-resistant oral cancer treatment comprising the step of comparing the expression or activity level of the mRNA encoding the same.

In one embodiment of the present invention, in step (b), JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine at least one protein selected from the group consisting of palmitoyltransferase, long chain base subunit 3); Alternatively, the expression or activity level of the mRNA encoding the same may be further measured, but is not limited thereto.

In another embodiment of the present invention, at least one protein selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3 in step (b); Alternatively, when the expression or activity level of the mRNA encoding the same is decreased compared to the cisplatin-resistant oral cancer cell line not treated with the candidate substance, the candidate substance may be determined as a cisplatin-resistant oral cancer therapeutic agent, but is not limited thereto.

In addition, the present invention is AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), JMY, MAP3 JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base at least one protein selected from the group consisting of subunit 3); Alternatively, a pharmaceutical composition for overcoming cisplatin resistance comprising as an active ingredient an agent that inhibits the expression or activity of a gene encoding the same is provided.

In one embodiment of the present invention, the agent may be one or more selected from the group consisting of compounds, peptides, peptide mimics, substrate analogs, aptamers, and antibodies that specifically bind to the protein, but is not limited thereto. .

In another embodiment of the present invention, the agent is composed of siRNA, shRNA, miRNA, antisense oligonucleotide, ribozyme, DNAzyme, and PNA (peptide nucleic acids) that specifically bind to the gene encoding the protein. It may be one or more selected from the group, but is not limited thereto.

In addition, the present invention is AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), JMY, MAP3 JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base at least one protein selected from the group consisting of subunit 3); Alternatively, it provides a method for overcoming cisplatin resistance comprising administering to a subject in need of a composition comprising, as an active ingredient, an agent that inhibits the expression or activity of a gene encoding the same.

In addition, the present invention is AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), JMY, MAP3 JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base at least one protein selected from the group consisting of subunit 3); Alternatively, it provides a use for overcoming cisplatin resistance of a composition comprising, as an active ingredient, an agent that inhibits the expression or activity of a gene encoding the same.

In addition, the present invention is AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), JMY, MAP3 JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base at least one protein selected from the group consisting of subunit 3); Alternatively, it provides a use for preparing a drug used for overcoming cisplatin resistance of an agent that inhibits the expression or activity of a gene encoding the same.

AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, MTMR6 proteins according to the present invention; Alternatively, by measuring the expression or activity level of mRNA encoding it, resistance to cisplatin in oral cancer patients can be evaluated in advance, so that more appropriate treatment can be applied to oral cancer patients to increase treatment efficiency, and can be usefully used in determining the direction of treatment. It is expected that there will be

In addition, providing a cisplatin-resistant oral cancer cell line can be usefully used to study the drug resistance mechanism of cisplatin, and can also be usefully used for screening new therapeutic agents capable of treating oral cancer resistant to cisplatin. It is expected that

Figure 1 confirms the characteristics of the cisplatin-resistant cell line UM-Cis, (a) is a view of the parental cell lines UMSCC1 and UM-Cis observed under a phase contrast microscope, and (b) is a view of UMSCC1 and UM-Cis without treatment with cisplatin. (c) is a diagram showing the result of comparing cell viability of UMSCC1 and UM-Cis after cisplatin treatment; (d) is a diagram showing apoptosis in cisplatin-treated UMSCC1 and UM-Cis It is a drawing showing the result of confirming the effect of cisplatin on
2a and 2b confirm the effect of cisplatin on UMSCC1 and UM-Cis, and FIG. 2a shows the size change of spheroids of UMSCC1 and UM-Cis for 14 days under cisplatin-treated 3D spheroid culture conditions by cisplatin concentration. Figure 2b is a diagram showing the results of comparing the sizes of tumors formed in a xenograft mouse model injected with UM-Cis or UMSCC1.
3a to 3c confirm the epithelial-mesenchymal transition (EMT) state of UM-Cis, and FIG. 3a shows the results of observing colony formation of UM-Cis and UMSCC1 for 48 hours, Figure 3b is a diagram showing the results confirming the decrease in mRNA and protein expression of the epithelial markers COL4A1 and CDH1 in UM-Cis, and Figure 3c is a diagram showing the mRNA and protein of mesenchymal markers VIM, TWIST1, ZEB1, CDH2, and ALDH1A1 in UM-Cis It is a drawing showing the result of confirming the increase in expression.
4a and 4b show the results of observing the size of 3D spheroid rods derived from oral squamous cell carcinoma (OSCC) patients for 14 days, and FIG. 4a shows cisplatin-sensitive OSCC Figure 4b is a diagram showing the results of confirming the cisplatin-resistant (cisplatin-resistant) OSCC is a diagram showing the results.
5a and 5b show the results of DNA microarray analysis to identify genes differentially expressed in UMSCC1 and UM-Cis, and FIG. 5a shows fold change among genes showing differential mRNA expression in the two cell lines. (fold change) > 2 and p-value < 0.05 is a diagram showing a heat map, and FIG. 5B shows the results of performing biological function and cell compartment analysis in cells for selected genes. it is a drawing
6 shows mRNA expression of genes AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and MTMR6 selected as differentially expressed in UMSCC1 and UM-Cis as a result of DNA microarray analysis cisplatin-sensitive OSCC tissues and cisplatin-resistant OSCC tissues.
7 is a diagram showing the results of confirming mRNA and protein expression of MTMR6 in UMSCC1 and UM-Cis cell lines.
8 is a view showing the results of confirming in 2D and 3D spheroids that resistance to cisplatin is reduced when MTMR6 is overexpressed in a UM-Cis cell line with low MTMR6 expression.
9 is a view showing the results of confirming in 2D and 3D spheroids that resistance to cisplatin increases when MTMR6 expression is inhibited using MTMR6-specific siRNA in the UMSCC1 cell line with high MTMR6 expression.
10a and 10b confirm the association between cisplatin resistance and HIST1H3D, FIG. 10a is a diagram showing the results of confirming the mRNA and protein expression of HIST1H3D in UMSCC1 and UM-Cis cell lines, and FIG. This diagram shows the results of confirming in 2D and 3D spheroids that resistance to cisplatin increases when HIST1H3D expression is inhibited using HIST1H3D-specific siRNA.
11a and 11b confirm the association between genes HIST3H2A, NAP1L2, and HIST3H2BB with increased expression in cisplatin-resistant cell lines, UM-Cis, and cisplatin resistance. FIG. 11a shows HIST3H2A, NAP1L2, and HIST3H2BB in UMSCC1 and UM-Cis cell lines. Figure 11b is a diagram showing the results of confirming the mRNA and protein expression of HIST3H2A, NAP1L2, and HIST3H2BB in the UM-Cis cell line with high expression, when each gene-specific siRNA is treated to inhibit expression, sensitivity to cisplatin This is a diagram showing the results of confirming this increase in 2D and 3D spheroids,
Figure 12 shows the results of confirming in 2D and 3D spheroids that resistance to cisplatin is reduced when SPTLC3, AREL1, and RMI1-expressing UM-Cis cell lines are treated with each gene-specific siRNA to inhibit expression. is the drawing shown,
13 is a diagram showing the results of confirming the expression of MTMR6, HIST1H3D, and HIST3H2A proteins in cisplatin-sensitive tissues (Cis-S1 and Cis-S2) and cisplatin-resistant tissues (Cis-R1 and Cis-R2) by an immunostaining method. .

The present invention relates to a method for providing information for predicting cisplatin resistance of oral cancer, a cisplatin-resistant oral cancer cell line, etc. , HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and/or MTMR6 expression levels and cisplatin resistance in oral cancer patients.

Specifically, in one embodiment of the present invention, it was confirmed that epithelial-mesenchymal conversion related to drug resistance occurred in the established cisplatin-resistant oral cancer cell line UM-Cis, and UM-Cis was resistant to cisplatin in vitro and in vivo was confirmed (see Examples 1 and 2).

In another embodiment of the present invention, tissue sensitivity was classified according to the cisplatin response in 3D spheroids using oral squamous cell carcinoma (OSCC) patient-derived spheroids (see Example 3).

In another embodiment of the present invention, genes related to nucleosome assembly (HIST3H2A, HIST3H2BB, NAP1L2, and HIST1H3D) and cisplatin among candidate genes differentially expressed in UMSCC1 and UM-Cis by DNA microarray analysis - Genes (AREL1, JMY, MAP3K9, RMI1, SLIT2, SPTLC3, HAT1, and MTMR6) whose expression patterns in sensitive OSCC tissues and cisplatin-resistant OSCC tissues and DNA microarray analysis results are consistent with are involved in cisplatin resistance in oral cancer Genes were finally selected (see Example 4).

In another embodiment of the present invention, the selected genes AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3 showed increased expression in cisplatin-resistant OSCC tissues, and HAT1, HIST1H3D, and MTMR6 confirmed that the expression increased in cisplatin-sensitive OSCC tissues (see Example 5).

In another embodiment of the present invention, some of the selected genes (MTMR6, HIST1H3D, SPTLC3, AREL1, RMI1, HIST3H2A, NAP1L2, and HIST3H2BB) were used to confirm that the genes selected were associated with cisplatin resistance in oral cancer ( see Example 6).

Hereinafter, the present invention will be described in detail.

The present invention is AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), at least one protein selected from the group consisting of HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6); Alternatively, it provides a composition for predicting cisplatin resistance in oral cancer comprising, as an active ingredient, an agent for measuring the expression or activity level of mRNA encoding the same.

In addition, in the present invention, the composition for predicting cisplatin resistance is JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), HAT1 (histone acetyltransferase 1), and at least one protein selected from the group consisting of serine palmitoyltransferase (SPTLC3, long chain base subunit 3); Alternatively, an agent for measuring the expression or activity level of mRNA encoding the same may be further included as an active ingredient, but is not limited thereto.

In the present invention, the AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and MTMR6 are human, cow, goat, sheep, pig, mouse, and rat ), all eukaryotic proteins having AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and/or MTMR6, including mammalian; Or it may be mRNA encoding it, and according to an embodiment of the present invention, AREL1 (NM_001039479.2, NP_001034568.1), HIST3H2A (NM_033445.3, NP_254280.1), HIST3H2BB (NM_175055.3, NP_778225.1) , JMY (NM_152405.5, NP_689618.4), MAP3K9 (NM_001284230.2, NP_001271159.1), NAP1L2 (NM_021963.4, CAG33376.1), RMI1 (NM_024945.2, AAH39999.1), SL IT2 (NM_004787.4 , NP_004778.1), SPTLC3 (NM_018327.4, AAH20656.1), HAT1 (NM_003642.4, NP_003633.2), HIST1H3D (NM_001376937.1, NP_001363866.1), or MTMR6 (NM_004685.5 , NP_004676.3) was used, but is not limited thereto.

The term "tolerance" used in the present invention may mean that sensitivity to a specific drug decreases as a result of continued use of the specific drug. If the same effect is not obtained even if the amount of the drug is the same as before, and a larger amount of the drug is gradually required to obtain the same effect as before, it can be regarded as resistant or resistant to a specific drug.

The term “susceptibility” used in the present invention may mean being easily affected by a specific drug and showing a change in the state of disease progression when exposed to a specific drug.

As used herein, the term "prediction" is used to refer to the likelihood that an oral cancer patient will respond favorably or unfavorably to cisplatin. According to one embodiment of the present invention, the prediction relates to the degree of response to cisplatin, for example, the prediction is whether or not an oral cancer patient will survive cisplatin treatment without cancer recurrence and/or the probability or occurrence of side effects It may be about whether Therefore, in the present invention, predicting oral cancer patients' resistance to cisplatin can be used clinically to determine treatment by selecting the most appropriate treatment method for oral cancer patients.

When the composition is for measuring the level of mRNA, the agent for measuring the level of mRNA may be a primer set or a probe that specifically binds to mRNA. The composition of the present invention including a primer set or probe specific for the mRNA of the genes may further include an agent required for a method for detecting a known RNA. The mRNA level of the protein markers can be measured in a subject by using a known method for detecting RNA using the composition of the present invention without limitation.

As used herein, the term “primer” refers to a nucleic acid sequence having a short free 3-terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for template strand copying. . A primer can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and different four nucleoside triphosphates in an appropriate buffer and temperature.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding with mRNA, and is labeled, so that a specific mRNA existence can be checked. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. Selection of suitable probes and hybridization conditions can be modified based on those known in the art.

The “primer” or “probe” may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods, and include all functional equivalents. In addition, primers or probes may be variously modified according to methods known in the art to the extent that hybridization with mRNA is not hindered. Examples of such modifications are methylation, capping, substitution of one or more homologs of the natural nucleotide, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc. ) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.), and binding of fluorescent or enzymatic labeling materials.

When the composition of the present invention is for measuring the level of a protein, the agent for measuring the level of the protein may be an antibody or an aptamer specific to the protein.

As used herein, the term “antibody” refers to a specific protein molecule directed against an antigenic site. For the purposes of the present invention, an antibody means an antibody that specifically binds to a marker protein, and includes both polyclonal antibodies, monoclonal antibodies and recombinant antibodies. In addition, as long as they have antigen-antibody binding properties, a part of the entire antibody is also included in the antibody of the present invention, and all types of immunoglobulin antibodies that specifically bind to the protein of the present invention are included. For example, complete antibodies with two full-length light chains and two full-length heavy chains, as well as functional fragments of antibody molecules, i.e. Fab, F(ab'), F(ab') with antigen-binding function 2 and Fv; Furthermore, antibodies of the present invention include special antibodies such as humanized antibodies and chimeric antibodies and recombinant antibodies as long as they can specifically bind to the protein of the present invention.

As used herein, the term “aptamer” refers to a substance that can specifically bind to an analyte to be detected in a sample, and is a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) having a stable tertiary structure in itself. nucleic acid), it is possible to specifically confirm the presence of a target protein in a sample. The aptamer is synthesized by determining the sequence of an oligonucleotide that is selective for the target protein to be identified and has high binding ability according to the general aptamer preparation method, and then the 5' or 3' end of the oligonucleotide is applied. It can be made by modification with -SH, -COOH, -OH or NH ₂ so that it can bind to the functional group of the timer chip, but is not limited thereto.

The composition of the present invention comprising an antibody specific to the protein may additionally include an agent required for a method for detecting a known protein, and a method for detecting a known protein using the present composition may be used without limitation to test a subject. (In the present invention, the expression level of a protein can be measured in a biological sample obtained from a subject described below).

In addition, the present invention provides a kit for predicting oral cancer cisplatin resistance comprising the composition according to the present invention.

In the present invention, “kit” means AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and/or MTMR6 mRNA or It means a screening device capable of predicting cisplatin resistance of oral cancer by measuring the amount of protein, and there is no limitation as long as it can measure the expression level of the genes from a biological sample isolated from a patient. Accordingly, the kit of the present invention may include an antibody recognizing a target protein as a marker, a primer set recognizing mRNA as a marker, or a probe, as well as one or more other component compositions, solutions, or devices suitable for an analysis method.

In addition, the present invention provides a method for providing information necessary for predicting oral cancer cisplatin resistance comprising the following steps:

(S1) AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome protein assembly 1 like 2) in biological samples isolated from the subject , RMI1 (RecQ-mediated genome instability protein 1), HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6) at least one protein selected from the group consisting of; or measuring the expression or activity level of mRNA encoding the same; and

(S2) Determining that the protein or mRNA expression or activity level measured in step (S1) has significantly changed compared to the control group as having resistance to cisplatin.

In addition, in the present invention, the method for providing the information includes JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2) in the step (S1). ), at least one protein selected from the group consisting of HAT1 (histone acetyltransferase 1), and SPTLC3 (serine palmitoyltransferase, long chain base subunit 3); Alternatively, the expression or activity level of the mRNA encoding the same may be further measured, but is not limited thereto.

In the present invention, the change is one or more proteins selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3; or the expression or activity level of the mRNA encoding it is increased compared to the control group; or

At least one protein selected from the group consisting of HAT1, HIST1H3D, and MTMR6; Alternatively, the expression or activity level of the mRNA encoding the same may be reduced compared to the control group, but is not limited thereto.

In the present invention, a “biological sample” may be included without limitation as long as it is collected from a subject for which cisplatin resistance of oral cancer is to be predicted. For example, the biological sample may be selected from blood, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration specimen, core needle biopsy specimen, and vacuum aspiration biopsy specimen. However, preferably, the biological sample may be a tissue and/or cell.

In addition, the biological sample may be pretreated before being used for detection or diagnosis. For example, it may include homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like. The sample can be prepared to increase the detection sensitivity of protein markers, for example, a sample obtained from a patient can be subjected to anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, It may be pretreated using a method such as sequential extraction or gel electrophoresis.

In the present invention, "method for providing information" is a method for providing information on the possibility that an oral cancer patient responds favorably or unfavorably to cisplatin, AREL1, HIST3H2A in a biological sample , when the expression level of HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and / or SPTLC3 genes increased; or when the expression level of HAT1, HIST1H3D, and / or MTMR6 genes decreased, oral cancer patients were unfavorably treated with cisplatin It means a method of acquiring information that can be predicted with a high probability of response.

In the present invention, the “control” may be a biological sample isolated from an oral cancer patient without cisplatin resistance. Also, in the present invention, a “subject” may be a mammal, including a human, and may be an individual suffering from or suspected of suffering from oral cancer, and may not have started anticancer treatment.

As used herein, the term “measurement” refers to the target substance (AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and/or MTMR6 mRNA or protein in the case of the present invention) It is meant to include both measuring and confirming the presence (expression) of, or measuring and confirming changes in the presence (expression level) of the target substance. That is, measuring the expression level of the protein means measuring whether or not it is expressed (that is, measuring whether or not it is expressed) or measuring the level of qualitative or quantitative change of the protein. The measurement can be performed without limitation including both qualitative methods (assays) and quantitative methods. Types of qualitative and quantitative methods for measuring protein levels are well known in the art, and include the experimental methods described herein. Specific protein level comparison methods for each method are well known in the art. Accordingly, the detection of the target protein may include detecting the presence or absence of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and/or MTMR6 protein, or increasing (upregulating) the protein level, or This is meant to include confirming a decrease (downregulation).

As used herein, the term "analysis" may preferably mean "measurement", and the qualitative analysis may mean measuring and confirming the presence or absence of a target substance, and the quantitative analysis may mean It may mean measuring and confirming changes in the presence level (expression level) or amount of the desired substance. In the present invention, analysis or measurement may be performed without limitation including both qualitative and quantitative methods, and preferably, quantitative measurement may be performed.

The method for measuring the protein level is not particularly limited as long as it is by a protein measurement method known in the art, but Western blot, ELISA, radioimmunoassay, radioimmunoassay, Ouchterlony immunodiffusion, rocket immunization It can be measured by methods such as electrophoresis (Rocket immunoelectrophoresis), immunostaining, immunoprecipitation analysis, complement fixation analysis, mass spectrometry, FACS, and/or protein chip.

The method for measuring the mRNA level of the gene is not particularly limited as long as it is by an mRNA measurement method known in the art, but PCR, RNase protection assay, Northern blotting, Southern blotting, In situ It can be measured by methods such as hybridization, DNA chip, and/or RNA chip.

In the present specification, "the level is increased" means that the undetected is detected, or the detected amount is relatively higher than the normal level. For example, a level "increased" means that the level in the experimental group is at least 1%, 2%, 3%, 4%, 5%, 10% or more, such as 5%, compared to that in the control group. , 10%, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% or higher, and/or 0.5x, 1.1x, 1.2x, 1.4x, 1.6x , 1.8 times higher or higher. Specifically, compared to that of the control group, 1 to 1.5 times, 1.5 to 2 times, 2 to 2.5 times, 2.5 to 3 times, 3 to 3.5 times, 3.5 to 4 times, 4 to 4.5 times, 4.5 to 5 times, 5 to 5 times. 5.5 times, 5.5 to 6 times, 6 to 6.5 times, 6.5 to 7 times, 7 to 7.5 times, 7.5 to 8 times, 8 to 8.5 times, 8.5 to 9 times, 9 to 9.5 times, 9.5 to 10 times, or 10 times It may mean an increase of more than double, but is not limited thereto. The meaning of the opposite term can be understood as having the opposite meaning according to the above definition by those skilled in the art.

In addition, the present invention is a cisplatin-resistant oral cancer cell line,

The cell lines are AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly protein 1 like 2), and RMI1 (RecQ-mediated genome at least one protein selected from the group consisting of instability protein 1); Or the expression or activity level of the mNRA encoding it is increased; or

At least one protein selected from the group consisting of HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6); Or it provides a cell line, characterized in that the expression or activity level of the mRNA encoding it is reduced.

In addition, in the present invention, the cell line is JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain At least one protein selected from the group consisting of base subunit 3); Or the expression or activity level of the mNRA encoding it is increased; or

HAT1 (histone acetyltransferase 1) protein; Alternatively, the expression or activity level of the mRNA encoding the same may be reduced, but is not limited thereto.

The term "cell line" used in the present invention refers to a cultured cell line having a specific trait or genetic marker as a lineage of cells established by isolation or selection and cloning from tissues. In addition, “resistant cell line” refers to a cell line in which sensitivity to a drug is reduced by acquiring resistance to a specific drug.

In the present invention, since the oral cancer cell line undergoes epithelial-mesenchymal transition (EMT), according to an embodiment of the present invention, the epithelial markers COL4A1 (collagen type IV alpha 1) and CDH1 (Cadherin 1) at least one protein selected from the group consisting of; Alternatively, the expression or activity level of mRNA encoding it is reduced, or mesenchymal markers VIM (vimentin), TWIST1 (twist family bHLH transcription factor 1), ZEB1 (zinc finger E-box binding homeobox 1), CDH2 (cadherin 2) ), and one or more proteins selected from the group consisting of ALDH1A1 (aldehyde dehydrogenase 1 family member A1); Alternatively, the expression or activity level of mRNA encoding the same may be increased.

The COL4A1, CDH1, VIM, TWIST1, ZEB1, CDH2, and ALDH1A1 include COL4A1, CDH1, VIM, TWIST1, including mammals such as humans, cows, goats, sheep, pigs, mice, and rats. any eukaryotic protein having ZEB1, CDH2, and/or ALDH1A1; Or it may be mRNA encoding it, and according to an embodiment of the present invention, COL4A1 (NM_001845.6, NP_001836.3), CDH1 (NM_004360.5, NP_004351.1), VIM (NM_003380.5, NP_003371.2) , TWIST1 (NM_000474.4, NP_000465.1), ZEB1 (NM_001174096.2, NP_001167567.1), CDH2 (NM_001792.5, NP_001783.2), or ALDH1A1 (NM_000689.5, NP_000680. 2) was used, but Not limited.

As used herein, the term “epithelial-mesenchymal transition (EMT)” means that cancer cells formed in epithelial cells lose their epithelial cell phenotype and switch to a highly mobile mesenchymal cell phenotype. When EMT occurs, epithelial cells lose their polarity, which distinguishes the upper and lower sides of the cell, and the cell shape changes from a square to a spindle shape, and epithelial cell markers decrease and mesenchymal cell markers increase. Cancer cells grow while continuously replicating RNA through epithelial-mesenchymal transition, and the possibility of metastasis increases, as well as decreasing drug sensitivity and increasing drug resistance.

In addition, the present invention provides a screening method for a cisplatin-resistant oral cancer treatment comprising the following steps:

(a) processing a candidate substance to a cisplatin-resistant oral cancer cell line according to the present invention;

(b) measuring the cell viability of the cisplatin-resistant oral cancer cell line treated with the candidate substance of step (a); and

(c) comparing the level of cell viability measured in step (b) with the level of cell viability of a cisplatin-resistant oral cancer cell line not treated with the candidate substance.

As used herein, the term “candidate” refers to an unknown candidate substance used for screening to examine whether or not it affects the cell viability of cisplatin-resistant oral cancer cell lines.

In the present invention, when the cell viability of the cisplatin-resistant oral cancer cell line treated with the candidate material identified in step (b) is lower than the cell viability level of the cisplatin-resistant oral cancer cell line not treated with the candidate material, the candidate material is cisplatin-resistant It can be judged as a treatment for oral cancer.

In addition, the present invention provides a screening method for a cisplatin-resistant oral cancer treatment comprising the following steps:

(a) processing a candidate substance to a cisplatin-resistant oral cancer cell line according to the present invention;

(b) AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 in cisplatin-resistant oral cancer cell lines treated with the candidate substance of step (a) above (nucleosome assembly protein 1 like 2), and at least one protein selected from the group consisting of RMI1 (RecQ-mediated genome instability protein 1); or measuring the expression or activity level of mRNA encoding the same; and

(c) the protein measured in step (b); Alternatively, the expression or activity level of the mRNA encoding the protein of a cisplatin-resistant oral cancer cell line not treated with the candidate substance; Or it provides a screening method for a cisplatin-resistant oral cancer treatment comprising the step of comparing the expression or activity level of the mRNA encoding the same.

In addition, in the present invention, the screening method for the cisplatin-resistant oral cancer treatment includes, in step (b), JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance) ligand 2), and at least one protein selected from the group consisting of serine palmitoyltransferase (SPTLC3, long chain base subunit 3); Alternatively, the expression or activity level of the mRNA encoding the same may be further measured, but is not limited thereto.

In the present invention, the screening method for the cisplatin-resistant oral cancer treatment includes at least one protein selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3 in step (c); Alternatively, when the expression or activity level of the mRNA encoding the same is decreased compared to the cisplatin-resistant oral cancer cell line not treated with the candidate substance, the candidate substance may be determined as a cisplatin-resistant oral cancer therapeutic agent, but is not limited thereto.

In addition, the present invention is AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), JMY, MAP3 JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base at least one protein selected from the group consisting of subunit 3); Alternatively, a pharmaceutical composition for overcoming cisplatin resistance comprising as an active ingredient an agent that inhibits the expression or activity of a gene encoding the same is provided.

In the present invention, the agent may be one or more selected from the group consisting of compounds, peptides, peptide mimics, substrate analogs, aptamers, and antibodies that specifically bind to the protein, but is not limited thereto.

The compound is not limited as long as it is any compound that can specifically bind to and inhibit the activity of one or more proteins selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3 can be included

In addition, in the present invention, the agent is a group consisting of siRNA, shRNA, miRNA, antisense oligonucleotide, ribozyme, DNAzyme, and PNA (peptide nucleic acids) that specifically bind to the gene encoding the protein It may be one or more selected from, and according to an embodiment of the present invention, it may be siRNA, but is not limited thereto.

The "antisense oligonucleotide" binds (hybridizes) to the complementary base sequence of DNA, immature-mRNA or mature mRNA, as defined in Watson-Crick base pairing, and flows genetic information from DNA to protein means to hinder

The "siRNA (small interference RNA)" is a nucleic acid molecule capable of mediating RNA interference or gene silencing, and refers to a small RNA fragment of 21 to 25 nucleotides in size. The siRNA of the present invention may have a structure in which the sense strand (sequence corresponding to the mRNA sequence) and the antisense strand (sequence complementary to the mRNA sequence) are positioned opposite each other to form a double strand, and self-complementary (self-complementary) -complementary) It may have a single-chain structure with sense and antisense strands. The siRNA of the present invention is not limited to complete pairing of double-stranded RNA parts paired with each other, but by mismatch (corresponding bases are not complementary), bulge (no base corresponding to one chain), etc. Unpaired parts may be included.

The "shRNA (short hairpin RNA)" is to overcome disadvantages such as high cost of biosynthesis of siRNA and short-term maintenance of RNA interference effect due to low cell transfection efficiency, and is used for adenovirus and lentivirus from the promoter of RNA polymerase III. and a method of introducing and expressing the plasmid into cells using a plasmid expression vector system. These shRNAs can be converted into siRNAs having precise structures by siRNA processing enzymes (Dicer or Rnase III) present in cells to induce silencing of target genes.

The “miRNA (microRNA)” is a single-stranded RNA molecule of 21-25 nucleotides, and is a regulatory substance that controls gene expression in eukaryotes by inhibiting the destruction or translation of target mRNA. These miRNAs consist of two steps of processing. The first miRNA transcript (primary miRNA) is made into a stem-loop structure of about 70-90 bases, that is, pre-miRNA, by an RNase III type enzyme called Drosha in the nucleus, and then moves to the cytoplasm to form an enzyme called Dicer is cleaved into mature miRNAs of 21–25 bases. The miRNA thus produced complementarily binds to the target mRNA, acts as a post-transcriptional gene suppressor, and induces translational suppression and mRNA destabilization.

In the present specification, “pharmaceutical composition” may be in the form of capsules, tablets, granules, injections, ointments, powders, or beverages, and the pharmaceutical composition may be intended for humans. can The pharmaceutical compositions are not limited to these, but may be formulated and used in the form of oral formulations such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories and sterile injection solutions, respectively, according to conventional methods. . The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, flavors, etc. for oral administration, and buffers, preservatives, and painless agents for injections. A topical, solubilizing agent, isotonic agent, stabilizer, etc. may be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. may be used. The formulation of the pharmaceutical composition of the present invention may be variously prepared by mixing with the above-described pharmaceutically acceptable carrier. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in unit dosage ampoules or multiple dosage forms. there is. In addition, it may be formulated into solutions, suspensions, tablets, capsules, sustained-release preparations, and the like.

On the other hand, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used. In addition, fillers, anti-coagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, and the like may be further included.

The route of administration of the pharmaceutical composition according to the present invention is, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred. As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrabursal, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

The pharmaceutical composition of the present invention depends on various factors including the activity of the specific compound used, age, body weight, general health, sex, diet, administration time, route of administration, excretion rate, drug combination and severity of the specific disease to be prevented or treated. It can vary widely, and the dosage of the pharmaceutical composition varies depending on the patient's condition, weight, disease severity, drug form, administration route and period, but can be appropriately selected by those skilled in the art, and is 0.0001 to 500 mg per day. /kg or 0.001 to 500 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated into pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.

Hereinafter, preferred experimental examples and examples are presented to aid understanding of the present invention. However, the following experimental examples and examples are provided to more easily understand the present invention, and the contents of the present invention are not limited by the following experimental examples and examples.

[Experimental example]

Experimental Example 1. Securing patient samples

Patient tissue specimens were used following the basic principles of the Helsinki Declaration, with written consent from the patient and approval from the Research Ethics Committee of Kyungpook National University Hospital (KNUH201704011, May 11, 2017).

Experimental Example 2. Experimental Materials

Dulbecco's Modified Eagle's Medium (DMEM), fetal bovine serum (FBS), and penicillin-streptomycin solution were purchased from Invitrogen (Carlsbad, CA, USA). Qiazol was purchased from Qiagen (Valencia, CA, USA), and PCR Master Mix was purchased from Takara Bio (Otsu City, Japan). Mouse anti-HIST1H3D, anti-β-actin (HRP conjugate) and mouse anti-N-cad antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit anti-caspase 3 and rabbit anti-PARP antibodies were purchased from Cell Signaling Technology (MA, USA). Mouse anti-E-cadherin and mouse anti-ALDH1A1 antibodies were purchased from BD Biosciences (USA). Anti-HIST3H2A antibody was purchased from Proteintech (Rosmont, IL, USA). Rabbit anti-NAP1L2 antibody was purchased from Bioss (Wuburn, MA, USA). Cisplatin was purchased from Sigma-Aldrich.

Experimental Example 3. Establishment of cisplatin-resistant cell lines

The cisplatin-resistant cell line UM-Cis was established by continuously exposing the oral cancer cell line UMSCC1 to stepwise increasing concentrations of cisplatin. Specifically, initially, exponentially growing cells were exposed to cisplatin at a concentration of 1 μg/mL in DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin, and subcultured upon reaching 70-80% confluency and the above process was repeated with increasing concentration. Aliquots of cell sublines were cryopreserved at each increasing concentration. The concentration of cisplatin was increased up to about 1.5 times, and the final concentration of cisplatin treated with UM-Cis cells was 5 μg/mL, which is the IC ₅₀ of UMSCC1 cells. Finally, a UM-Cis cell line with an IC ₅₀ value of nearly 3-fold (14.5 μg/mL) increased over 2 years was established.

On the other hand, the vehicle-treated parental cell line was maintained in culture as a control cell line during the establishment of a resistant cell line.

Experimental Example 4. Oral squamous cell carcinoma (OSCC) tissue samples and primary culture

In order to confirm whether the genes associated with cisplatin resistance in UM-Cis cells are clinically meaningful, cancer cells derived from OSCC tissues were classified as sensitive or resistant according to the degree of response to cisplatin. Epithelial cancer cells were cultured by primary culture of OSCC tissue samples obtained from 9 patients. Patient information is summarized in Table 1 below. Fresh oral tumor biopsies were obtained through routine resection from patients at Kyungpook National University Hospital, and patients who had already received chemotherapy or radiation therapy were excluded. The obtained tumor samples were primary cultured, and tumor biopsies were transferred to sample collection tubes containing RNAlater stabilization reagent for cisplatin resistance-related gene expression studies. After 4 weeks of culture, primary cells were obtained as adherent colonies in DMEM medium containing 5% FBS.

Cisplatin sensitivity No. age gender Primary site Differentiation lymph node metastasis TMN step smoking Drinking tolerance One 73 M Rt. Buccal　cheek well Y T2N1M0 3 N N 2 79 M Lt. Mn. Post. area well N T1N0M0 One N N 3 61 F Lt. palatal　area middle
(moderate) N T2N0M0 2 N N sensitivity 4 50 F Rt. Lateral　border　of　tongue moderate Y T2N1M0 3 N N 5 67 F Lt. lateral　border　of　tongue moderate N T1N0M0 One N Y 6
60 M Mn. Ant. Area moderate Y T4aN2bM0 4A Y N 7 77 M Lt. Mn. Post. Area moderate N T4aN0M0 4A N Y 8 50 M Lt. lat. Border　of　tongue moderate Y T2N2bM0 4A N N 9 70 M Lt. Mn. Post. area moderate N T4aN0M0 4A N N

Experimental Example 5. 2D cell culture and 3D cell culture

UMSCC1 (SCC070, mouth floor) cells purchased from Merck KGaA (Darmstadt, Germany) were cultured in RPMI medium containing 10% FBS and 1% penicillin/streptomycin solution at 37°C in a humidified environment of 5% CO ₂ . . Cell lines were tested for contamination every 2 months using the CellSafe Mycoplasma PCR detection kit (CellSafe Co., Yongin, Korea). In order to compare the effect of cisplatin on OSCC tumor tissues, OSCC patient-derived tumor tissues were primary cultured. After 4 weeks of culture, primary cells were obtained as adherent colonies in DMEM medium containing 5% FBS. To obtain spheroids, cells were seeded at 4000 cells per well in a 96-well U-bottom Ultra-Low Attachment plate (Corning Inc., New York, USA) after subculture three times. It was cultured for 2 to 3 days until about 400 μm spheroids were formed. Spheroid size was determined using a Cell iMager scanner CC-5000 (SCREEN Holdings Co., Kyoto, Japan). The diameter and surface area of each spheroid were the same within the error range of 5%. After treating the spheroids with trypsin, the number of cells constituting the spheroids was counted.

Experimental Example 6. Cell viability after cisplatin treatment

Cisplatin sensitivity was determined in a parental sensitive cell line (UMSCC1) and an established resistant subline cell line (UM-Cis) using 2D MTT assay and 3D spheroid assay.

To evaluate cell viability in 2D conditions, cells were seeded in 96-well plates at 10,000 cells per well, and the next day, cells were treated with cisplatin in fresh medium and cultured for 48 hours. 0.1% (v/v) dimethyl sulfoxide (DMSO) was used as a control, cell viability was evaluated by MTT assay, and absorbance was measured using an ELISA microplate reader (Molecular Devices, Sunnyvale, California, USA). was used to read at 540 nm. All experiments were repeated 3 times.

To confirm the 2D MTT results, the effect of cisplatin on cell viability was evaluated in 3D spheroid conditions. Specifically, cells were seeded at 4000 cells per well in a 96-well U-bottom Ultra-Low Attachment plate (Corning Inc., New York, USA), and cultured for 4 days to obtain uniformly sized spheroids (> diameter 500 μm) was formed. After removing the medium, fresh medium containing cisplatin was added to each well. DMSO was used as a control (vehicle control). Spheroid growth was monitored for 14 days with a phase contrast microscope (5X magnification) and quantified by measuring the total surface area of each group.

Experimental Example 7. DNA microarray analysis

To analyze gene expression differences between the UMSCC1 cell line and the UM-Cis cell line, the Affymetrix GeneChip ^® Human Gene 2.0 ST array (Affymetrix, Santa Clara, CA, USA) containing 40,716 gene-level probe sets was used for each gene expression difference. Microarray analysis was performed with 3 samples per cell line (6 total). Total RNA was isolated from the parent UMSCC1 cell line and the UM-Cis cell line cultured without cisplatin using Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA quality was analyzed with an Agilent 2100 bioanalyzer (Agilent Technologies, USA) and quantified with an ND-1000 spectrophotometer (NanoDrop Technologies, USA). RNA samples were used as input to the Affymetrix procedure according to the recommended protocol (http://www.affymetrix.com). Briefly, the total RNA of each sample was converted to double-stranded cDNA using a random hexamer containing the T7 promoter. RNA was amplified (cRNA) with a double-stranded cDNA template through an in vitro transcription (IVT) reaction and purified using the Affymetrix sample cleanup module. Then, the cDNA was digested with UDG and APE1 restriction enzymes, and the ends were labeled through a terminal transferase reaction that polymerizes biotinylated dideoxynucleotide. End-labeled cDNA fragments were hybridized to an Affymetrix array and stained using streptavidin-phycoerythrin conjugate. The Affymetrix array was scanned using an Affymetrix Model 3000 G7 scanner, and image data was extracted with Affymetrix Command Console Software 1.1. Data mining and graphical visualization were performed with ExDEGA software (Ebiogen Inc., Korea). The list of genes identified as being differentially expressed was uploaded to the online software DAVID for molecular function and biological process analysis.

Experimental Example 8. Real-time polymerase chain reaction

RNA extraction, cDNA synthesis, and gene expression normalization were performed following standard protocols. Primers used in real-time quantitative polymerase chain reaction (qPCR) are summarized in Table 2 below.

gene Forward primer sequence (5'→3') Reverse primer sequence = (5'→3') AREL1 GGCCTGTGGGACTAAGAGTT (SEQ ID NO: 1) TACGTTGGAATTGGGCTCCT (SEQ ID NO: 2) JMY GTGTTACCAGCTCCAGGTCT (SEQ ID NO: 3) TCATCGGTCTCGGTGAAGAG (SEQ ID NO: 4) MAP3K9 AGGGAGCAGCAGACAGATTT (SEQ ID NO: 5) ACCCTCCACAGTCTTCCTTG (SEQ ID NO: 6) NAP1L2 TCCTGTGGAGGTTGGTCTC (SEQ ID NO: 7) CCAGCCTCTTCTTGACTGGA (SEQ ID NO: 8) RMI1 CAGGGTATTGCTCTGTTGCC (SEQ ID NO: 9) GCAACTCAAGAGGCTAAGGC (SEQ ID NO: 10) SLIT2 CCCGATTAGAGTGCAGAGGT (SEQ ID NO: 11) TCAACCTCGTCCACAAAGGA (SEQ ID NO: 12) SPTLC3 TGCAGACCCTTTCAGGGATT (SEQ ID NO: 13) TGCCTGGAACTTCCCATGAT (SEQ ID NO: 14) MTMR6 TCATGAGGTCCAGCCTTCAG (SEQ ID NO: 15) ATGCACCAACACACTTGCAT (SEQ ID NO: 16) HAT1 GGCCACGTGTAAGTCAGATG (SEQ ID NO: 17) TTGGATGGATCTTCCGCTGT (SEQ ID NO: 18) HIST1H3D GTGTTCTGCCCAACATCCAG (SEQ ID NO: 19) GTACGAGCCATTGCGAACTT (SEQ ID NO: 20) HIST3H2A ATGTCCGGTCGTGGTAAGC (SEQ ID NO: 21) GCTCCGAATAGTTGCCCTTG (SEQ ID NO: 22) HIST3H2BB ATGCCAGACCCGTCCAAATC (SEQ ID NO: 23) TCTTGCCGTCCTTCTTCTGT (SEQ ID NO: 24)

qPCR was performed using an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). Gene expression levels were expressed normalized to that of GAPDH. The fold change of the gene expression level was determined based on the Δ(Δcycle threshold) value determined by normalizing the average Ct value of each sample to the average Ct value of the endogenous GAPDH control and then calculating the 2 ^-ΔΔCt value of each sample. Calculated.

Experimental Example 9. Western blot analysis

Total protein was extracted and the concentration was measured. Equal amounts of protein (20-40 μg) were separated by 8-10% SDS-PAGE and transferred to a nitrocellulose membrane. After blocking with 5% skim milk for 60 minutes, the membrane was incubated with the primary antibody overnight at 4°C. β-actin was used as a loading control. The HRP-conjugated secondary antibody was diluted 1:5000 and treated at room temperature for 1 hour. Blots were washed three times with Tris-buffered saline containing 0.1% Tween 20. Protein bands were observed by chemiluminescence.

Experimental Example 10. Transduction of small interfering RNA (siRNA)

UMSCC1 cells, UM-Cis cells, or 3D spheroids were transiently transfected with siRNA mixtures containing 2-3 oligonucleotides targeting specific gene transcripts (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Injected. First, in the cell experiment, 1 × 10 ⁴ cells were seeded in a 96-well plate, and the next day, specific siRNA or control siRNA was transduced using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, Massachusetts, USA) at a final concentration of 10 nM. Right before doing so, the medium was changed to serum-free medium. After 30 hours, after treatment with cisplatin for 2 days, MTT cell viability assay was performed. To evaluate the effect of specific siRNAs on the cisplatin sensitivity of 3D spheroids derived from UMSCC1 or UM-Cis cells, siRNAs were applied to spheroids in 96-well plates at a final concentration of 10 nM/well. After 30 hours, cisplatin was treated and monitored for 14 days, and DMSO was used as a control (vehicle control).

Experimental Example 11. Mouse xenograft model

Cisplatin efficacy between UMSCC1 cells and UM-Cis cells was compared in xenograft mice (6-week-old female BALB/c; Hyochang Science, Daegu, Korea). 2 × 10 ⁶ cells of each cell line were subcutaneously injected into the right and left dorsal flanks of mice, respectively. After 27 days, tumor formation was observed, and from day 28 cisplatin was injected for 4 weeks. The UMSCC1 cell group and the UM-Cis cell group consisted of 4 mice each. After tumor formation, each cell group was divided into a cisplatin injection group (bilateral transplantation, n=4) and a PBS vehicle injection control group (both flank transplantation, n=4), and cisplatin (2.5 mg/kg) or PBS vehicle was injected at week 2. Recovery was intraperitoneal injection, and sacrificed on the 28th day after cisplatin administration. After administration of cisplatin until sacrifice, tumor volume was measured using calipers. Results are expressed as mean ± standard deviation (** p < 0.01).

Experimental Example 12. Immunohistochemical (IHC) analysis of clinical specimens

Paraffin-embedded tissue blocks were obtained from patients with oral squamous cell carcinoma (OSCC) who underwent tumor resection for oral cancer treatment at the Dental Hospital of Kyungpook National University from 2018 to 2020. After dewaxing, sections were blocked for 5 minutes and then incubated with antibodies specific for HIST1H3D, HIST3H2A, and MTMR6 (1:500) at room temperature for 2 hours. After that, the degree of staining was confirmed using an optical microscope at a magnification of 40.

IHC staining was performed using the UltraTek Horseradish Peroxidase (HRP) Anti-olyvalent Kit (ScyTek Laboratories, Logan, UT, USA). 3,3-diaminobenzidine (Dako, Carpinteria, California, USA) was used as the chromogen. Nuclei were counterstained with hematoxylin.

Experimental Example 13. Statistical Analysis

All in vitro ( in vitro ) experiments were performed 2 to 3 times. Statistical parameters including in vivo animal analysis are indicated in the figure legend. All statistical analyzes were performed with Origin v.8.0 software (OriginLab, Northampton, MA, USA), and R software. One-way ANOVA and unpaired t-test were used for statistical tests. The Mann-Whitney U test was used to compare mRNA expression between the cisplatin-sensitive tissue group and the cisplatin-resistant tissue group. A p-value of 0.05 or less was considered statistically significant. Significant p values are indicated in the figure.

[Example]

Example 1. Characteristics of cisplatin-resistant UMSCC cell lines

The characteristics of the UM-Cis cell line established by continuously treating the oral cancer cell line UMSCC1 with cisplatin were confirmed.

As a result of observation with a phase contrast microscope, as shown in (a) of FIG. 1, UM-Cis cells grow in a more dispersed form than UMSCC1 cells, and the shape of the cells becomes more spindle-shaped, resulting in epithelial-mesenchymal transition (epithelial-mesenchymal transition). It suggested that mesenchymal transition (EMT) had occurred. The status of EMT was confirmed again after cDNA microarray. As a result of performing MTT assay to compare the viability of the two cells not treated with cisplatin, as shown in FIG. 1 (b), the proliferation of UM-Cis was significantly reduced compared to that of UMSCC1.

The sensitivity of UMSCC1 cells and UM-Cis cells to cisplatin was compared in 2D and 3D cell conditions. IC ₅₀ and relative cisplatin resistance were calculated using the ratio of IC ₅₀ of UM-Cis cells and IC ₅₀ of UMSCC1 cells. As shown in (c) of FIG. 1, as a result of performing the MTT assay in 2D cell culture conditions, when cisplatin 5 μg / mL was treated for 2 days, the proliferation of UMSCC1 and UM-Cis was inhibited by 41% and 19%, respectively When cisplatin was treated with 10 μg/mL, it was confirmed that the proliferation of UMSCC1 and UM-Cis was inhibited by 69% and 37%, respectively. In addition, in order to compare the degree of apoptosis in the two cell lines after cisplatin treatment, the degree of caspase-3 and PARP cleavage was compared by western blot analysis. As a result, as shown in (d) of FIG. 1, it was confirmed that the cleavage of caspase 3 and PARP was significantly increased in UMSCC1 cells compared to UM-Cis cells. To further evaluate the cisplatin resistance of UM-Cis cells, cell viability was compared for 14 days under cisplatin-treated 3D spheroid culture conditions. As shown in Figure 2a, in the case of UMSCC1, when treated with cisplatin at a concentration of 5 μg/ml or 10 μg/ml, the spheroid size significantly decreased after 14 days, whereas in the case of UM-Cis, after 14 days , It was confirmed that the size of the spheroids increased more (5 μg/ml) or had no significant difference (10 μg/ml) compared to the control group (vehicle control). In addition, as shown in FIG. 2B , it was confirmed that mouse xenograft tumors derived from UM-Cis cells showed significant resistance to cisplatin compared to UMSCC1-derived tumors.

Example 2. Epithelial-mesenchymal transition (EMT) status of UM-Cis cells

Epithelial-mesenchymal conversion is known to be closely related to drug resistance, and the morphological changes of UM-Cis shown in FIG. As shown in Figure 3a, which shows the degree of colony formation in a non-adherent 24-well plate, it was confirmed that UM-Cis cells formed significantly more colonies than UMSCC1 cells. To further compare the epithelial-mesenchymal transition status of UM-Cis cells with UMSCC1, the expression of genes related to epithelial-mesenchymal transition was confirmed through qPCR and/or Western blot analysis. As a result, as shown in FIG. 3B, the expression of epithelial markers such as COL4A1 and CDH1 decreased in the UM-Cis cell line, while some representative mesenchymal markers (VIM, TWIST1, ZEB1, CDH2, It was confirmed that the expression of ALDH1A1) was increased.

Example 3. Classification of tissue sensitivity according to cisplatin response in OSCC tissue-derived 3D spheroids

After culturing primary epithelial cancer cells from OSCC tissue samples, 3D spheroids were formed to improve the accuracy of drug response by simulating in vivo conditions as much as possible. The formed 3D spheroids were treated with cisplatin at each concentration and the size of the spheroids was observed for 14 days. As shown in Figure 4a, the tissue group in which the size of spheroids was significantly reduced by cisplatin was classified as cisplatin-sensitive (Cis-S). On the other hand, as shown in Figure 4b, the tissue group showing a tendency to increase the size of spheroids even when treated with cisplatin was classified as cisplatin-resistant (Cis-R).

Example 4. DNA microarray analysis

To identify differentially expressed genes between the cisplatin-resistant cell line (UM-Cis) and the parental cell line (UMSCC1), the average fold change for gene expression in the two cell lines was compared, p-value < 0.05. In addition, 797 genes that were differentially expressed more than twice were identified. A heatmap of these genes is shown in Figure 5a. The 797 genes consisted of 526 up-regulated genes and 271 down-regulated genes, and the list of identified genes was uploaded to the online software DAVID for biological function and cellular compartment analysis, the results are shown in Fig. 5b shown in Enrichment analysis related to biological function and cell compartment indicated that nucleosome assembly was an important functional annotation term (p < 5.17E-05; gene count, 16). In the same context as nucleosome assembly, telomere organization appeared as the third most important pathway in biological function (p < 4.69E-04; gene count, 7). Since the mechanism of cisplatin resistance related to histone protein or nucleosome assembly has not yet been reported, the following experiments were conducted mainly on the study of cisplatin resistance related to histone protein, and although not directly related to nucleosome assembly, the above examples Expression patterns in OSCC patient tissues of the cisplatin-sensitive group and cisplatin-resistant group classified in 3 were consistent with the microarray analysis results, and genes that were not known to be related to cisplatin resistance were also included as candidate genes. As a result, 12 genes, AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, SPTLC3, HAT1, HIST1H3D, and MTMR6, were finally selected as genes associated with cisplatin resistance in oral cancer.

Example 5. Comparison of Gene Expression in Cisplatin Sensitive and Cisplatin Resistant OSCC Tissues

The mRNA expression of the genes selected in Example 4 was confirmed in OSCC tissues showing cisplatin-resistance (Cis-R) and cisplatin-sensitivity (Cis-S) of Example 3.

As a result, as shown in FIG. 6, AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3 showed increased expression in cisplatin-resistant OSCC tissues, and HAT1, HIST1H3D, and MTMR6 It was confirmed that the expression increased in cisplatin-sensitive OSCC tissue.

Example 6. Confirmation of association between cisplatin resistance and selected genes

6-1. Genes with reduced expression in UM-Cis

The correlation between the genes selected in Example 4 and cisplatin resistance was confirmed using the genes MTMR6 and HIST1H3D whose expression was reduced in UM-Cis.

In the case of MTMR6, as shown in FIG. 7 , it was confirmed that the mRNA and protein expression of MTMR6 was decreased in the cisplatin-resistant cell line UM-Cis compared to the parent cell line UMSCC1. In addition, as shown in FIG. 8, when MTMR6 was overexpressed using a vector in the UM-Cis cell line with low MTMR6 expression in 2D and 3D spheroid environments, it was confirmed that resistance to Cisplatin was reduced. Furthermore, as shown in FIG. 9, it was confirmed that resistance to cisplatin increased when MTMR6 expression was inhibited using siRNA in the UMSCC1 cell line with high MTMR6 expression in 2D and 3D spheroid environments.

In addition, in the case of HIST1H3D, as shown in FIG. 10a, the mRNA and protein expression of HIST1H3D was reduced in the cisplatin-resistant cell line UM-Cis compared to the parent cell line UMSCC1, and as shown in FIG. 10b, 2D and 3D spheroids When HIST1H3D expression was suppressed using siRNA in the UMSCC1 cell line with high HIST1H3D expression in the environment, it was confirmed that resistance to cisplatin increased.

6-2. Genes with increased expression in UM-Cis

The correlation between the genes selected in Example 4 and cisplatin resistance was confirmed using genes SPTLC3, AREL1, RMI1, HIST3H2A, NAP1L2, and HIST3H2BB whose expression was increased in UM-Cis.

As a result, as shown in FIG. 11a, it was confirmed that mRNA and protein expressions of HIST3H2A, NAP1L2, and HIST3H2BB were increased in the cisplatin-resistant cell line UM-Cis compared to the parent cell line UMSCC1. In addition, as shown in Figure 11b, when the expression of HIST3H2A, NAP1L2, and HIST3H2BB in the UM-Cis cell line with high expression of HIST3H2A, NAP1L2, and HIST3H2BB in 2D and 3D spheroid environments is inhibited using each siRNA, It was confirmed that the sensitivity to cisplatin increased. Furthermore, as shown in FIG. 12, when the expression of SPTLC3, AREL1, and RMI1 is suppressed using each siRNA in the UM-Cis cell line with high expression of SPTLC3, AREL1, and RMI1 in 2D and 3D spheroid environments, cisplatin resistance It was confirmed that this decrease

6-3. Immunohistochemical analysis

Immunohistochemical analysis of MTMR6, HIST1H3D, and HIST3H2A among the genes selected in Example 4 was performed in cisplatin-sensitive tissues (Cis-S1 and Cis-S2) and cisplatin-resistant tissues (Cis-R1 and Cis-R2). .

As a result, as shown in FIG. 13 , it was confirmed that expression of MTMR6 and HIST1H3D was higher in cisplatin-sensitive tissues, and expression of HIST3H2A was higher in cisplatin-resistant tissues.

As described above, the present inventors found that oral cancer patients' resistance to cisplatin was increased by AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and/or SPTLC3 expression and/or HAT1, HIST1H3D, and/or It was confirmed through specific experiments that the expression of MTMR6 resulted from a decrease.

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the experimental examples and embodiments described above are illustrative in all respects and not limiting.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Biomarker for predicting Cisplatin Resistance for Oral Cancer and Uses it <130> MP21-204 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> AREL1_F <400> 1 ggcctgtggg actaagagtt 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> AREL1_R <400> 2 tacgttggaa ttgggctcct 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> JMY_F <400> 3 gtgttaccag ctccaggtct 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> JMY_R <400> 4 tcatcggtct cggtgaagag 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> MAP3K9_F <400> 5 agggagcagc agacagattt 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> MAP3K9_R <400> 6 accctccaca gtcttccttg 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> NAP1L2_F <400> 7 tcctgtggag gtttggtctc 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> NAP1L2_R <400> 8 ccagcctctt cttgactgga 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> RMI1_F <400> 9 cagggtattg ctctgttgcc 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> RMI1_R <400> 10 gcaactcaag aggctaaggc 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> SLIT2_F <400> 11 cccgattaga gtgcagaggt 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> SLIT2_R <400> 12 tcaacctcgt ccacaaagga 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> SPTLC3_F <400> 13 tgcagaccct ttcagggatt 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> SPTLC3_R <400> 14 tgcctggaac ttcccatgat 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> MTMR6_F <400> 15 tcatgaggtc cagccttcag 20 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> MTMR6_R <400> 16 atgcaccaac acacttgcat 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> HAT1_F <400> 17 ggccacgtgt aagtcagatg 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> HAT1_R <400> 18 ttggatggat cttccgctgt 20 <210> 19 <211> 20 <212> DNA <213> artificial sequence <220> <223> HIST1H3D_F <400> 19 gtgttctgcc cacacatccag 20 <210> 20 <211> 20 <212> DNA <213> artificial sequence <220> <223> HIST1H3D_R <400> 20 gtacgagcca ttgcgaactt 20 <210> 21 <211> 19 <212> DNA <213> artificial sequence <220> <223> HIST3H2A_F <400> 21 atgtccggtc gtggtaagc 19 <210> 22 <211> 20 <212> DNA <213> artificial sequence <220> <223> HIST3H2A_R <400> 22 gctccgaata gttgcccttg 20 <210> 23 <211> 20 <212> DNA <213> artificial sequence <220> <223> HIST3H2BB_F <400> 23 atgccagacc cgtccaaatc 20 <210> 24 <211> 20 <212> DNA <213> artificial sequence <220> <223> HIST3H2BB_R <400> 24 tcttgccgtc cttcttctgt 20

Claims (22)

AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability 1) At least one protein selected from the group consisting of HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6); Or a composition for predicting cisplatin resistance of oral cancer comprising an agent for measuring the expression or activity level of mRNA encoding the same as an active ingredient.
According to claim 1,
The composition for predicting cisplatin resistance is JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), HAT1 (histone acetyltransferase 1), and SPTLC3 (serine at least one protein selected from the group consisting of palmitoyltransferase, long chain base subunit 3); Or a composition for predicting cisplatin resistance in oral cancer, further comprising an agent for measuring the expression or activity level of mRNA encoding the same as an active ingredient.
According to claim 1,
The agent for measuring the mRNA level is a composition for predicting cisplatin resistance in oral cancer, characterized in that a primer set or a probe that specifically binds to the mRNA.
According to claim 1,
The agent for measuring the protein level is a composition for predicting cisplatin resistance in oral cancer, characterized in that an antibody or an aptamer that specifically binds to the protein.
A kit for predicting oral cancer cisplatin resistance, comprising the composition of any one of claims 1 to 4.
(S1) AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome protein assembly 1 like 2) in biological samples isolated from the subject , RMI1 (RecQ-mediated genome instability protein 1), HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6) at least one protein selected from the group consisting of; or measuring the expression or activity level of mRNA encoding the same; and
(S2) Information necessary for predicting cisplatin resistance in oral cancer, including the step of determining that the expression or activity level of the protein or mRNA measured in step (S1) has significantly changed compared to the control group, as having resistance to cisplatin How to provide.
According to claim 6,
The method, in the step (S1), JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), HAT1 (histone acetyltransferase 1), and At least one protein selected from the group consisting of serine palmitoyltransferase (SPTLC3, long chain base subunit 3); Or further measuring the expression or activity level of the mRNA encoding the same, the method.
According to claim 7,
The change is at least one protein selected from the group consisting of AREL1, HIST3H2A, HIST3H2BB, JMY, MAP3K9, NAP1L2, RMI1, SLIT2, and SPTLC3; or the expression or activity level of the mRNA encoding it is increased compared to the control group; or
At least one protein selected from the group consisting of HAT1, HIST1H3D, and MTMR6; Or characterized in that the expression or activity level of the mRNA encoding it is reduced compared to the control group.
According to claim 6,
The biological sample is at least one selected from the group consisting of blood, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration specimen, core needle biopsy specimen, and vacuum aspiration biopsy specimen. How to do it.
According to claim 6,
Wherein the control group is a biological sample isolated from an oral cancer patient without cisplatin resistance.
According to claim 6,
The protein level was measured by Western blot, ELISA, radioimmunoassay, radioimmunodiffusion method, Ouchterlony immunodiffusion, Rocket immunoelectrophoresis, immunostaining, immunoprecipitation assay, complement fixation assay, mass spectrometry (Mass spectrometry), FACS, characterized in that measured by one or more methods selected from the group consisting of, and a protein chip, a method.
According to claim 6,
The mRNA level is measured by one or more methods selected from the group consisting of PCR, RNase protection assay, northern blotting, southern blotting, in situ hybridization, DNA chip, and RNA chip. How to do it.
As a cisplatin-resistant oral cancer cell line,
The cell lines are AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 (nucleosome assembly protein 1 like 2), and RMI1 (RecQ-mediated genome at least one protein selected from the group consisting of instability protein 1); Or the expression or activity level of the mNRA encoding it is increased; or
At least one protein selected from the group consisting of HIST1H3D (histone cluster 1, H3d), and MTMR6 (myotubularin related protein 6); Or a cell line, characterized in that the expression or activity level of the mRNA encoding it is reduced.
According to claim 13,
The cell line is a group consisting of JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base subunit 3) One or more proteins selected from; Or the expression or activity level of the mNRA encoding it is increased; or
HAT1 (histone acetyltransferase 1) protein; Or a cell line, characterized in that the expression or activity level of the mRNA encoding it is reduced.
According to claim 13,
The cell line is characterized in that the expression or activity level of at least one protein selected from the group consisting of COL4A1 (collagen type IV alpha 1) and CDH1 (Cadherin 1) or mRNA encoding the same is reduced.
According to claim 13,
The cell line, characterized in that the epithelial-mesenchymal transition (epithelial-mesenchymal transition; EMT) has occurred, the cell line.
(a) treating the cisplatin-resistant oral cancer cell line according to any one of claims 13 to 16 with a candidate substance;
(b) measuring the cell viability of the cisplatin-resistant oral cancer cell line treated with the candidate substance of step (a); and
(c) comparing the level of cell viability measured in step (b) with the level of cell viability of a cisplatin-resistant oral cancer cell line that is not treated with the candidate substance.
(a) treating the cisplatin-resistant oral cancer cell line according to any one of claims 13 to 16 with a candidate substance;
(b) AREL1 (apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), NAP1L2 in cisplatin-resistant oral cancer cell lines treated with the candidate substance of step (a) above (nucleosome assembly protein 1 like 2), and at least one protein selected from the group consisting of RMI1 (RecQ-mediated genome instability protein 1); or measuring the expression or activity level of mRNA encoding the same; and
(c) the protein measured in step (b); Alternatively, the expression or activity level of the mRNA encoding the protein of a cisplatin-resistant oral cancer cell line not treated with the candidate substance; Or a screening method for a cisplatin-resistant oral cancer treatment comprising the step of comparing the expression or activity level of mRNA encoding the same.
According to claim 18,
The method, in step (b), JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase kinase 9), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain At least one protein selected from the group consisting of base subunit 3); Or further measuring the expression or activity level of the mRNA encoding the same, the method.
AREL1 (Apoptosis-resistant E3 ubiquitin protein ligase 1), HIST3H2A (histone cluster 3, H2a), HIST3H2BB (histone cluster 3, H2bb), JMY (junction mediating and regulatory protein, p53 cofactor), MAP3K9 (mitogen-activated protein kinase kinase kinase 9), NAP1L2 (nucleosome assembly protein 1 like 2), RMI1 (RecQ-mediated genome instability protein 1), SLIT2 (slit guidance ligand 2), and SPTLC3 (serine palmitoyltransferase, long chain base subunit 3) selected from the group consisting of one or more proteins; Or a pharmaceutical composition for overcoming cisplatin resistance comprising, as an active ingredient, an agent that inhibits the expression or activity of a gene encoding the same.
According to claim 20,
The pharmaceutical composition, characterized in that the agent is at least one selected from the group consisting of compounds, peptides, peptide mimics, substrate analogs, aptamers, and antibodies that specifically bind to the protein.
According to claim 20,
The agent is at least one selected from the group consisting of siRNA, shRNA, miRNA, antisense oligonucleotide, ribozyme, DNAzyme, and peptide nucleic acids (PNA) that specifically bind to the gene encoding the protein. To be, a pharmaceutical composition.

Images