JP2005073548A - UTILIZATION OF HNF-1beta FOR INSPECTING AND TREATING OVARIAN CLEAR CELL ADENOMATOUS CARCINOMA AND FOR SCREENING REMEDY - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for inspecting ovarian clear cell adenomatous carcinoma with HNF (hepatocyte nuclear factor)-1β gene and a protein encoding the gene, and to provide a method for screening a remedy for the disease. <P>SOLUTION: A gene giving an expression level difference between ovarian clear cell adenomatous carcinoma (CCC) cells and non-CCC cells was analyzed with an oligonucleotide array, and HNF-1β gene expressing and exasperating only in the CCC cells was found. It was confirmed that the HNF-1β gene expressed and exasperated in both a mRNA level and a protein level by an immunoblot analysis method and by an immune structure dyeing method. When the significance of the expression of the HNF-1β in the CCC cells was examined with RNAi, it was clarified that the decrease of the HNF-1β induced the apoptosis-like cell death of CCC. From the above results, it is shown that the HNF-1β can be used for diagnosing the CCC and screening remedies for treating the disease. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to use of the HNF-1β gene and a protein encoded by the gene as molecular markers in ovarian clear cell adenocarcinoma, and a screening method for a therapeutic agent for the disease.

  Epithelial ovarian cancer has the poorest prognosis among all gynecological malignancies (see Non-Patent Document 1), but since the emergence of platinum-based chemotherapy, the survival of patients with epithelial ovarian cancer The rate was dramatically improved (see Non-Patent Document 2). Currently, debulking surgery and adjuvant chemotherapy (such as a combination of paclitaxel and carboplatin) are used as standard treatments for epithelial ovarian cancer (see Non-Patent Document 3). However, there are still a number of problems with epithelial ovarian cancer treatment. Clear cell adenocarcinoma (CCC) is one of the most difficult diseases. Although the incidence of CCC in epithelial ovarian cancer is not high (approximately 10%), CCC patients have a significantly worse prognosis than ovarian serous cancer patients (see Non-Patent Documents 4 and 5). One reason for the poor prognosis of CCC is low drug responsiveness to standard platinum-based chemotherapy (see Non-Patent Document 6).

  From a pathological point of view, CCC has many features that are different from other epithelial ovarian cancers. The proportion of stage I patients is significantly higher in CCC patients (48.5%) than in serous adenocarcinoma patients (16.6%) (see Non-Patent Document 7), which indicates a difference in invasive capacity between CCC and non-CCC. means. The incidence of p53 mutation differs between CCC (0%) and endometrioid adenocarcinoma (63%) (see Non-Patent Document 8). Further, the loss of heterozygosity (LOH) pattern differs between CCC and non-CCC (see Non-Patent Document 9). Immunohistochemical analysis reveals that CCC has a weaker expression of p53 and cyclin A and a tendency to significantly increase expression of p21 and cyclin E compared to other histological subtypes. (See Non-Patent Document 10). The fact that glutathione peroxidase 3 (GPX3) is overexpressed in CCC may explain the chemoresistance of CCC (see Non-Patent Document 11). Given these facts, CCC should be considered a separate disease rather than just another type of epithelial ovarian cancer, and molecular pathology needs to be identified to improve its prognosis.

  Until several years before the emergence of genome-wide cDNA microarrays (see Non-Patent Documents 12 and 13), the molecular pathology of epithelial ovarian cancer was only known in a fragmentary manner. The molecular pathology of various tumors including ovarian cancer has been extensively studied and rapidly advanced (see Non-Patent Documents 14-20). Studies based on such cDNA microarray analysis have identified a number of novel genes that may be associated with ovarian cancer.

However, at the stage of exhaustive identification with microarrays, these genes do not actually prove to be related to ovarian cancer, so it is still unclear whether the identified genes can be targets for ovarian cancer testing and treatment. It is.
Scully RE, Young RH, Clement PB: Atlas of Tumor Pathology.Third Series Facile 23. Tumors of the Ovary, Maldeveloped Gonads, Fallopian Tube, and Broad Ligament.Edited by Rosai J.Washington, DC, Armed Forces Institute of Pathology, 1999 , pp. 27-50 Piver MS: Ovarian carcinoma. A decade of progress. Cancer 1984, 54: 2706-2715 The International Collaborative Ovarian Neoplasm (ICON) Group: Paclitaxel plus carboplatin versus standard chemotherapy with either single-agent carboplatin or cyclophosphamide, doxorubicin, and cisplatin in women with ovarian cancer: the ICON3 randomized trial. Lancet 2002, 360: 505-515 Tammela J, Geisler JP, Eskew PN, Jr., Geisler HE: Clear cell carcinoma of the ovary: poor prognosis compared to serous carcinoma. Eur J Gynaecol Oncol 1998, 19: 438-440 O'Brien ME, Schofield JB, Tan S, Fryatt I, Fisher C, Wiltshaw E: Clear cell epithelial ovarian cancer (mesonephroid): bad prognosis only in early stages.Gynecol Oncol 1993, 49: 250-254 Goff BA, Sainz de la Cuesta R, Muntz HG, Fleischhacker D, Ek M, Rice LW, Nikrui N, Tamimi HK, Cain JM, Greer BE, Fuller AF, Jr .: Clear cell carcinoma of the ovary: a distinct histologic type with poor prognosis and resistance to platinum-based chemotherapy in stage III disease.Gynecol Oncol 1996, 60: 412-417 Sugiyama T, Kamura T, Kigawa J, Terakawa N, Kikuchi Y, Kita T, Suzuki M, Sato I, Taguchi K: Clinical characteristics of clear cell carcinoma of the ovary: a distinct histologic type with poor prognosis and resistance to platinum-based chemotherapy. Cancer 2000, 88: 2584-2589 Okuda T, Otsuka J, Sekizawa A, Saito H, Makino R, Kushima M, Farina A, Kuwano Y, Okai T: p53 mutations and overexpression affect prognosis of ovarian endometrioid cancer but not clear cell cancer.Gynecol Oncol 2003, 88: 318 -325 Okada S, Tsuda H, Takarabe T, Yoshikawa H, Taketani Y, Hirohashi S: Allelotype Analysis of Common Epithelial Ovarian Cancers with Special Reference to Comparison between Clear Cell Adenocarcinoma with Other Histological Types.Jpn J Cancer Res 2002, 93: 798-806 Shimizu M, Nikaido T, Toki T, Shiozawa T, Fujii S: Clear cell carcinoma has an expression pattern of cell cycle regulatory molecules that is unique among ovarian adenocarcinomas. Cancer 1999, 85: 669-677 Hough CD, Cho KR, Zonderman AB, Schwartz DR, Morin PJ: Coordinately up-regulated genes in ovarian cancer.Cancer Res 2001, 61: 3869-3876 Schena M, Shalon D, Davis RW, Brown PO: Quantitative monitoring of gene expression patterns with a complementary DNA microarray.Science 1995, 270: 467-470 Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL: Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol 1996, 14: 1675-1680 Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP, Coller H, Loh ML, Downing JR, Caligiuri MA, Bloomfield CD, Lander ES: Molecular classification of cancer: class discovery and class prediction by gene expression monitoring Science 1999, 286: 531-537 Higgins JP, Shinghal R, Gill H, Reese JH, Terris M, Cohen RJ, Fero M, Pollack JR, van de Rijn M, Brooks JD: Gene expression patterns in renal cell carcinoma characterized by complementary DNA microarray. Am J Pathol 2003, 162: 925-932 Varambally S, Dhanasekaran SM, Zhou M, Barrette TR, Kumar-Sinha C, Sanda MG, Ghosh D, Pienta KJ, Sewalt RG, Otte AP, Rubin MA, Chinnaiyan AM: The polycomb group protein EZH2 is involved in progression of prostate cancer Nature 2002, 419: 624-629 Wang K, Gan L, Jeffery E, Gayle M, Gown AM, Skelly M, Nelson PS, Ng WV, Schummer M, Hood L, Mulligan J: Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray. Gene 1999, 229: 101-108 Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, Nakamura Y: Identification by cDNA microarray of genes involved in ovarian carcinogenesis.Cancer Res 2000, 60: 5007-5011 Welsh JB, Zarrinkar PP, Sapinoso LM, Kern SG, Behling CA, Monk BJ, Lockhart DJ, Burger RA, Hampton GM: Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer.Proc Natl Acad Sci USA 2001, 98: 1176-1181 Schwartz DR, Kardia SL, Shedden KA, Kuick R, Michailidis G, Taylor JM, Misek DE, Wu R, Zhai Y, Darrah DM, Reed H, Ellenson LH, Giordano TJ, Fearon ER, Hanash SM, Cho KR: Gene expression in ovarian cancer reflect both morphology and biological behavior, distinguishing clear cell from other poor-prognosis ovarian carcinomas.Cancer Res 2002, 62: 4722-4729

  The present invention has been made in view of such circumstances, the purpose of which is to examine ovarian clear cell adenocarcinoma targeting a gene closely related to ovarian clear cell adenocarcinoma (CCC) and its protein, It is to provide a therapeutic method and a screening method for a therapeutic agent, and a molecule used for the examination and treatment.

  The present inventors clarified genes whose expression levels are different between CCC cells and non-CCC cells, and revealed the relationship with the disease, thereby examining ovarian clear cell adenocarcinoma and We thought we could find new target molecules for treatment.

Based on this idea, the present inventors first used the oligonucleotide array method to comprehensively express genes that are significantly different in expression between 4 CCC cell lines and 7 non-CCC cell lines. Identified.
Subsequently, focusing on the sequence-specific transcription factor HNF-1β among the identified genes, immunoblotting analysis of 11 ovarian cancer cell lines and immunohistochemical staining using 83 surgically resected specimens were performed. As a result, CCC was found to be upregulated at both the mRNA and protein levels of the sequence-specific transcription factor HNF-1β, unlike other epithelial ovarian cancers. HNF-1β is overexpressed in hepatocellular carcinoma (Wang W, et al., J Pathol, 1998, 184: 272-278), but upregulation of HNF-1β has not been reported in other cancers so far .

  Since it became clear that the expression of HNF-1β is strongly associated with CCC, the present inventors further investigated RNA interference (RNAi) (a novel gene silencing technology (Fire A, et al., Nature, 1998, 391: 806-811, Kennerdell JR & Carthew RW, Cell, 1998, 95: 1017-1026 and Elbashir SM, et al., Nature, 2001, 411: 494-498)) The significance of HNF-1β expression in cell adenocarcinoma cells was examined. Ovarian clear cell adenocarcinoma cells were transfected with siRNA (short interference RNA) to HNF-1β gene, and TUNEL analysis and FACS analysis showed that suppression of HNF-1β was an apoptotic property of ovarian clear cell adenocarcinoma It was found to induce cell death. These results imply that HNF-1β is not only a CCC specific molecule but also an essential molecule for the survival of ovarian clear cell adenocarcinoma. Therefore, the HNF-1β gene and its protein can be used as excellent targets for diagnosis of ovarian clear cell adenocarcinoma and screening of therapeutic agents.

The present invention relates to a method for examining ovarian clear cell adenocarcinoma and a method for screening a therapeutic agent for the disease, which have been completed based on the above findings, and more specifically, the following [1] to [16] are provided. It is.
[1] A method for examining ovarian clear cell adenocarcinoma,
(1) collecting a cell suspected of having ovarian clear cell adenocarcinoma from a subject, and (2) measuring the expression level of the HNF-1β gene in the cell collected in step (1),
A subject whose HNF-1β gene expression level measured in step (2) is higher than the HNF-1β gene expression level in the control cells for determining the risk of ovarian clear cell adenocarcinoma is designated as ovarian clear cell adenocarcinoma. A method of determining that you are at risk of being affected.
[2] The testing method according to [1], wherein the gene expression level is measured at the transcription level.
[3] The method according to [2], wherein the transcription level is measured by real-time quantitative RT-PCR.
[4] The method according to [1], wherein the gene expression level is measured at the translation level.
[5] The test method according to [4], wherein the translation level is measured by immunoblot analysis.
[6] The test method according to [4], wherein the translation level is measured by immunohistochemical staining.
[7] The method according to [1], wherein the control cells for determining the risk of ovarian clear cell adenocarcinoma are ovarian cancer cells other than ovarian clear cell adenocarcinoma or normal ovarian surface epithelium.
[8] A test for ovarian clear cell adenocarcinoma comprising the following (a) or (b):
(A) a polynucleotide comprising at least 15 consecutive nucleotide sequences of the sense strand of the HNF-1β gene or its complementary strand; (b) an antibody that binds to the HNF-1β protein [9] an ovarian clear cell gland comprising the following steps: A screening method for a therapeutic drug for cancer.
(1) The step of bringing the HNF-1β protein into contact with the candidate compound (2) The step of measuring the binding activity between the protein and the candidate compound (3) The step of selecting the compound that binds to the protein [10] The next step A screening method for a therapeutic agent for ovarian clear cell adenocarcinoma, comprising:
(1) The step of contacting a candidate compound with a cell that expresses the HNF-1β gene (2) The step of measuring the expression level of the HNF-1β gene (3) Compared with the case where the candidate compound is not contacted, the HNF-1β gene [11] The method according to [10], wherein the cell that expresses the HNF-1β gene is a clear cell adenocarcinoma cell.
[12] A screening method for a therapeutic agent for ovarian clear cell adenocarcinoma, comprising the following steps.
(1) A step of bringing a candidate compound into contact with a cell into which a vector containing a transcription regulatory region of the HNF-1β gene and a reporter gene expressed under the control of this transcriptional regulatory region is brought into contact (2) Measuring the activity of the reporter gene (3) A step of selecting a compound that reduces the expression level of the reporter gene as compared with a control not brought into contact with a candidate compound [13] A screening method for a therapeutic agent for clear cell adenocarcinoma, comprising the following step.
(1) A step of contacting a compound identified by the screening method according to any one of [9] to [12] with ovarian clear cell adenocarcinoma cells (2) a step of detecting apoptosis of ovarian clear cell adenocarcinoma cells ( 3) Step of selecting a compound that induces apoptosis of ovarian clear cell adenocarcinoma cells [14] An ovary comprising a compound obtainable by the screening method according to any one of [9] to [13] as an active ingredient A treatment for clear cell adenocarcinoma.
[15] A therapeutic agent for ovarian clear cell adenocarcinoma comprising, as an active ingredient, a compound having the ability to reduce the expression level or activity of the HNF-1β gene.
[16] The therapeutic agent according to [15], wherein the compound having the ability to reduce the expression level or activity of the HNF-1β gene is any one of the following (a) to (c).
(A) RNA complementary to the transcript of the HNF-1β gene
(B) DNA encoding the RNA of (a)
(C) a polynucleotide comprising a binding sequence of HNF-1β protein

  The present invention provides a method for examining ovarian clear cell adenocarcinoma using the HNF-1β gene and a method for screening for a therapeutic agent for the disease. The test method of the present invention is an excellent method for distinguishing ovarian clear cell adenocarcinoma cells from other tissue types, which has been difficult with conventional standard Papanicolaou staining, particularly in cytodiagnosis. Furthermore, the compound obtained by the screening method of the present invention can be used as a new therapeutic agent for ovarian clear cell adenocarcinoma.

HNF-l [beta] protein (H epatocyte N uclear F actor- 1beta, mutations HNF1, also referred to as LF-B3 or TCF2,) is controlled promoter or enhancer of the gene expression in the liver-specific manner, such as albumin and α- fetoprotein (Courtois G, et al., Proc Natl Acad Sci USA, 1988, 85: 7937-7941, Cereghini S, et al., Genes Dev, 1988, 2: 957-974, and Rey-Campos J, et al., Embo J, 1991, 10: 1445-1457). HNF-1β and HNF-1α, a protein closely related to HNF-1β (Rey-Campos J, et al., Embo J, 1991, 10: 1445-1457), are also key regulators of glucose homeostasis It has been considered (Pontoglio M, J Am Soc Nephrol, 2000, 11 Suppl 16: S140-143), and HNF-1β mutation causes juvenile-onset non-insulin-dependent diabetes (Horikawa Y, et al., Nat Genet, 1997, 17: 384-385). It has been reported that HNF-1β is overexpressed in hepatocellular carcinoma (Wang W, et al., J Pathol, 1998, 184: 272-278).

  The “HNF-1β gene” in the present invention includes genomic DNA and cDNA as long as they do not violate the principle and purpose of the present invention. In addition, the “HNF-1β protein” in the present invention includes natural proteins and recombinant proteins as long as they do not violate the principle and purpose of the present invention. In addition to wild-type proteins, mutants thereof are also included. Moreover, there is no restriction | limiting in particular in the organism from which it originates. The HNF-1β protein targeted for the development of therapeutic agents for ovarian clear cell adenocarcinoma is preferably derived from mammals, and most preferably derived from humans. The amino acid sequence of a typical human-derived HNF-1β protein is shown in SEQ ID NO: 2, and the base sequence of the HNF-1β gene is shown in SEQ ID NO: 1.

  In the present invention, ovarian clear cell adenocarcinoma is an adenocarcinoma having the following characteristic histological characteristics among epithelial ovarian cancers. 1. Tumor cells with clear cytoplasm are solid and proliferate in a honeycomb shape. 2. Nuclei protrude from the cell surface, and hobnail-type and peg-like cells are observed. 3. It has a glass-like stroma, and the stroma is stained positive for PAS staining along with the tumor cells. In the gynecological tumor WHO international histological classification, it is defined as code 8310/3. In addition, a clear cell (clear cell) means a cell having a histologically clear cytoplasm that appears in various pathological states.

  The method for examining ovarian clear cell adenocarcinoma of the present invention comprises a step of collecting cells suspected of having ovarian clear cell adenocarcinoma from a subject, and measuring the expression level of the HNF-1β gene in the cells collected from the subject The process of carrying out is included.

  “Cells suspected of ovarian clear cell adenocarcinoma” collected from the subject are ovarian cells in the subject, and are usually ovarian cancer cells. As ovarian cancer cells, specimens excised by surgery or cytological specimens can be used. Because patients with ovarian cancer often have ascites retention, diagnosis of cells obtained by ascites puncture to determine the type and histology of the cancer may be a subsequent treatment strategy (for example, what chemotherapy is used) It is an important guideline for making decisions and is particularly important. Diagnosis using peripheral blood samples is also conceivable. In this case, it is conceivable to determine CCC by obtaining a small amount of cancer cells in peripheral blood and measuring the mRNA of HNF-1β of the cancer cells.

  If a lysate is prepared from the above biological sample, it can be used as a sample for immunological measurement of HNF-1β protein. Alternatively, if mRNA is extracted from this lysate, it can be used as a sample for measuring mRNA corresponding to the HNF-1β gene. It is convenient to use a commercially available kit for extracting lysate or mRNA from a biological sample.

  The “control cell” is not particularly limited as long as it can be used as a control for determining the risk of ovarian clear cell adenocarcinoma, but examples include ovarian cancer cells other than ovarian clear cell adenocarcinoma or normal ovarian surface epithelium. it can.

  In general, the standard value is determined by measuring the expression level of the HNF-1β gene in these control cells, and the tolerance range is determined based on this standard value. After setting the standard value, only the expression level of cells suspected of having ovarian clear cell adenocarcinoma in the subject is measured, and the test method of the present invention is carried out based on comparison with a predetermined standard value You can also If the HNF-1β gene expression level measured in the subject is higher than the HNF-1β gene expression level (tolerable range) in the control cells, the subject is at risk of having ovarian clear cell adenocarcinoma It is determined that there is. On the other hand, if the subject's HNF-1β gene expression level is within an acceptable range, it is determined that the risk of suffering from ovarian clear cell adenocarcinoma is low.

  In the present invention, the expression level of the HNF-1β gene includes the level of transcription of the gene into mRNA and the level of translation into protein. Therefore, the test method for ovarian clear cell adenocarcinoma according to the present invention can be performed based on the comparison of the expression intensity of mRNA corresponding to the HNF-1β gene or the expression level of HNF-1β protein. Measurement of the expression level of the HNF-1β gene can be performed according to a known gene analysis method. For example, a hybridization technique using a nucleic acid hybridizing to this gene as a probe or a gene amplification technique using a DNA hybridizing to the HNF-1β gene as a primer can be used. The probe or primer used in the test of the present invention can be designed based on the base sequence of the HNF-1β gene.

  As the primer or probe, a polynucleotide containing at least 15 consecutive nucleotide sequences of the sense strand of the HNF-1β gene or its complementary strand can be used. A “polynucleotide” can be DNA or RNA. These polynucleotides may be synthesized or natural. The “complementary strand” refers to the other strand of one strand of a double-stranded DNA consisting of A: T (U for RNA) and G: C base pairs. The polypeptide of the present invention is a polypeptide complementary to the sense strand of the HNF-1β gene. `` Complementary '' is not limited to a fully complementary sequence with at least 15 contiguous nucleotide regions, but at least 70%, preferably at least 80%, more preferably 90%, even more preferably 95% or more. What is necessary is just to have the homology on a base sequence. The homology of the base sequence can be determined by an algorithm such as BLAST. The polynucleotide of the present invention is preferably a polynucleotide having a length of at least 15 bases that hybridizes to the HNF-1β gene under stringent conditions. Here, “under stringent conditions” includes, for example, low stringent conditions. Low stringent conditions are, for example, conditions of 42 ° C., 5 × SSC, 0.1% SDS, and preferably 50 ° C., 5 × SSC, 0.1% SDS in washing after hybridization. More preferable hybridization conditions include highly stringent conditions. High stringent conditions are, for example, conditions of 65 ° C., 0.1 × SSC, and 0.1% SDS.

  When the polynucleotide of the present invention is used as a primer, it usually has a chain length of 15 to 100 bases, preferably 15 to 35 bases. When used as a probe, DNA having at least a part or all of the sequence of the HNF-1β gene (or its complementary strand) and a chain length of at least 15 base pairs is used. The primer needs to be complementary in the 3 ′ side region, but a restriction enzyme recognition sequence, a tag or the like can be added to the 5 ′ side.

When the polynucleotide of the present invention is used as a hybridization probe, a labeled one is usually used. The labeling substance is not particularly limited as long as it can be detected, and examples thereof include fluorescent substances and radioactive elements. The labeling can be performed by a method generally performed by those skilled in the art. Such methods include, for example, a method of labeling by phosphorylating the 5 ′ end of the oligonucleotide with ³² P using T4 polynucleotide kinase, and a random hexamer oligonucleotide using a DNA polymerase such as Klenow enzyme. Examples thereof include a method of incorporating a substrate base labeled with an isotope such as ³² P using a nucleotide or the like, a fluorescent dye, biotin or the like (random prime method or the like).

  The polynucleotide of the present invention can be produced by, for example, a commercially available oligonucleotide synthesizer. The probe can also be prepared as a double-stranded DNA fragment obtained by restriction enzyme treatment or the like.

  The examination of ovarian clear cell adenocarcinoma using a hybridization technique can be performed using, for example, the Northern hybridization method, the dot blot method, or a method using a DNA microarray. Furthermore, gene amplification techniques such as RT-PCR can be used. In the RT-PCR method, it is possible to perform more quantitative analysis on the expression of the HNF-1β gene by using real-time quantitative RT-PCR in the gene amplification process. In real-time quantitative RT-PCR, probes labeled with different fluorescent dyes that cancel each other's fluorescence at both ends are used and hybridized to a detection target (DNA or RNA reverse transcription product). When the PCR reaction proceeds and the probe is degraded by the 5'-3 'exonuclease activity of Taq polymerase, the two fluorescent dyes are separated and fluorescence is detected. This fluorescence is detected in real time. By simultaneously measuring a standard sample with a clear copy number for the detection target, the number of copies of the detection target in the target sample is determined by the linear number of cycles of PCR amplification (Holland, PM et al., 1991, Proc Natl. Acad. Sci. USA 88: 7276-7280; Livak, KJ et al., 1995, PCR Methods and Applications 4 (6): 357-362; Heid, CA et al., Genome Research 6: 986-994 Gibson, EMU et al., 1996, Genome Research 6: 995-1001). In the PCR amplification monitoring method, for example, GeneAmp 7700 Sequence Detector (Perkin Elmer Applied Biosystems, Foster City, CA) can be used.

  Another embodiment of the test method of the present invention can be performed by detecting a protein encoded by the HNF-1β gene. As such a test method, for example, immunoblot analysis using an antibody that binds to HNF-1β protein, immunohistochemical staining, immunoprecipitation, ELISA, and the like can be used. Antibodies that bind to the HNF-1β protein used for this detection can be obtained using techniques well known to those skilled in the art. The antibody used in the present invention can be a polyclonal antibody or a monoclonal antibody (Milstein C, et al., 1983, Nature 305 (5934): 537-40). For example, a polyclonal antibody against HNF-1β protein removes blood of a mammal sensitized with an antigen and separates serum from this blood by a known method. As the polyclonal antibody, serum containing the polyclonal antibody can be used. Alternatively, a fraction containing a polyclonal antibody can be further isolated from this serum as necessary. In order to obtain a monoclonal antibody, immune cells are taken out of the mammal sensitized with the antigen and fused with myeloma cells or the like. The thus obtained hybridoma can be cloned, and the antibody can be recovered from the culture to obtain a monoclonal antibody. For detection of HNF-1β protein, these antibodies may be appropriately labeled. Further, a substance that specifically binds to the antibody, such as protein A or protein G, can be labeled and detected indirectly without labeling the antibody. Specific examples of the detection method include an ELISA method.

  The protein used for the antigen or a partial peptide thereof, for example, incorporates the HNF-1β gene or a part thereof into an expression vector, introduces it into an appropriate host cell, creates a transformant, and cultures the transformant. Thus, the recombinant protein can be expressed, and the expressed recombinant protein can be purified from the culture or culture supernatant. Alternatively, an oligopeptide consisting of an amino acid sequence encoded by the HNF-1β gene or a partial amino acid sequence of the amino acid sequence encoded by the full-length cDNA can be chemically synthesized and used as an immunogen.

  The measured value of the expression level of the HNF-1β gene in the present invention can be corrected by a known method. By correction, it is possible to compare changes in gene expression levels in cells. The measurement value is corrected based on the measurement value of the expression level of a gene (for example, a housekeeping gene) whose expression level does not vary greatly in each cell in the biological sample. This is done by correcting. Examples of genes whose expression levels do not vary greatly include GAPDH, β-actin and the like.

  The present invention provides a test for ovarian clear cell adenocarcinoma. The test agent of the present invention includes a polynucleotide containing at least 15 consecutive nucleotide sequences of the sense strand of the HNF-1β gene or its complementary strand, or an antibody that binds to the HNF-1β protein. These polynucleotides and antibodies may be labeled as necessary. In the test agent of the present invention, in addition to the active ingredient polynucleotide and antibody, for example, sterile water, physiological saline, vegetable oil, surfactant, lipid, solubilizer, buffer, protein stabilizer (BSA and gelatin) Etc.), preservatives and the like may be mixed as necessary.

  Furthermore, the present invention provides a screening method for a therapeutic agent for ovarian clear cell adenocarcinoma. The expression level of HNF-1β gene is significantly increased in ovarian cells of ovarian clear cell adenocarcinoma patients. Therefore, a therapeutic drug for ovarian clear cell adenocarcinoma can be obtained by selecting a compound that can reduce the expression level of the HNF-1β gene. In the present invention, a compound that decreases the expression level of a gene is a compound having an action that acts in a suppressive manner on any step of gene transcription, translation, and protein activity expression.

An embodiment of the screening method of the present invention is, for example, a screening method based on the binding activity with HNF-1β protein. That is, this invention relates to the screening method of the therapeutic agent of ovarian clear cell adenocarcinoma including the following processes.
(1) The step of bringing the HNF-1β protein into contact with the candidate compound (2) The step of measuring the binding activity between the protein and the candidate compound (3) The step of selecting a compound that binds to the protein

  The HNF-1β protein used for screening may be a recombinant protein or a naturally derived protein. It may also be a partial peptide. The candidate compound is not particularly limited, and for example, cell extract, cell culture supernatant, fermented microorganism product, marine organism extract, plant extract, purified or crude purified polypeptide, non-peptidic compound, synthetic low molecular weight compound And natural compounds. The protein of the present invention to be contacted with the candidate compound can be contacted with the candidate compound, for example, as a purified protein, as a soluble protein, in a form bound to a carrier, or as a fusion protein with another protein.

As another aspect of the screening method of the therapeutic agent of this invention, it can implement according to the following processes, for example.
(1) The step of contacting a candidate compound with a cell that expresses the HNF-1β gene (2) The step of measuring the expression level of the HNF-1β gene (3) Compared with the case where the candidate compound is not contacted, the HNF-1β gene Selecting a compound that reduces the expression level of

  As a cell expressing the HNF-1β gene, for example, a cell line, preferably an ovarian cancer cell line can be used. In the screening method of the present invention, the expression level of the HNF-1β gene may be detected at the transcription level or at the translation level. The method for detecting the expression level of the HNF-1β gene is as described above in relation to the test method using the expression of the HNF-1β gene as an index.

Another embodiment of the method for screening therapeutic agents of the present invention is a technique using a reporter assay system using the transcriptional regulatory region of the HNF-1β gene of the present invention. That is, this invention relates to the screening method of the therapeutic agent of ovarian clear cell adenocarcinoma including the following processes.
(1) A step of bringing a candidate compound into contact with a cell into which a vector containing a transcription regulatory region of the HNF-1β gene and a reporter gene expressed under the control of this transcriptional regulatory region is brought into contact (2) Measuring the activity of the reporter gene (3) selecting a compound that reduces the expression level of the reporter gene compared to a control that does not contact the candidate compound

  Examples of transcription regulatory regions include promoters, enhancers, and CAAT boxes, TATA boxes, etc. that are usually found in promoter regions. As a reporter gene, a CAT (chloramphenicol acetyltransferase) gene, a luciferase gene, or the like can be used. For transcriptional regulatory regions, see Lockwood et al. (Lockwood CR, Bingham C, Frayling TM., Mol Genet Metab. 2003 Feb; 78 (2): 145-51.).

  The transcriptional regulatory region of the HNF-1β gene can also be obtained as follows. That is, first, a genomic DNA library such as a BAC library or a YAC library is screened by PCR or hybridization using a primer or probe designed based on the cDNA base sequence of the HNF-1β gene. From the above, a genomic DNA clone containing the cDNA base sequence is obtained, and then, in the obtained genomic DNA, a transcriptional regulatory region is identified using transcriptional activity as an index, and DNA in the region is obtained.

  Once the transcriptional regulatory region is obtained, a reporter construct is constructed by cloning it so that it is located upstream of the reporter gene. The obtained reporter construct is introduced into a cultured cell line to obtain a transformant for screening. The screening of the present invention can be performed by selecting a compound that lowers the expression level of the reporter gene as compared with a control in which a candidate compound is contacted with the transformant and no candidate compound is contacted.

As another aspect of the screening method of the present invention, a secondary screening method using apoptosis of ovarian clear cell adenocarcinoma cells as an index can be used. That is, this invention relates to the screening method of the therapeutic agent of ovarian clear cell adenocarcinoma including the following processes.
(1) A step of contacting a compound identified by the above screening method with ovarian clear cell adenocarcinoma cells (2) A step of detecting apoptosis of ovarian clear cell adenocarcinoma cells (3) Apoptosis of ovarian clear cell adenocarcinoma cells Step of selecting a compound to be induced

  The compound thus obtained can induce apoptosis in ovarian clear cell adenocarcinoma cells, and as a result, can control ovarian clear cell adenocarcinoma. Apoptosis-inducing activity can be confirmed, for example, using TUNEL and FACS analysis of a cell line expressing HNF-1β protein as an indicator of cell morphological change or chromosomal DNA breakage.

The compound selected by the screening method of the present invention is useful as a therapeutic agent for ovarian clear cell adenocarcinoma. The HNF-1β gene is a gene whose expression increases in ovarian clear cell adenocarcinoma cells of ovarian clear cell adenocarcinoma patients. Therefore, the therapeutic effect of ovarian clear cell adenocarcinoma can be expected by suppressing the expression of these genes or the function of the protein encoded by these genes. In order to suppress the function of proteins in cells, for example, antisense RNA of HNF-1β gene, short double-stranded RNA (short RNA), decoy of HNF-1β protein, DNA encoding these, etc. Introduced or expressed. That is, the therapeutic agent for ovarian clear cell adenocarcinoma of the present invention contains a compound selected by the screening method as an active ingredient. For example, although any of following (a)-(c) is included, it is not limited to these.
(A) RNA complementary to the transcript of the HNF-1β gene
(B) DNA encoding the RNA of (a)
(C) a polynucleotide comprising a binding sequence of HNF-1β protein

  One embodiment of “RNA complementary to the transcript of the HNF-1β gene” and “DNA encoding the RNA” is an antisense RNA complementary to the transcript of the HNF-1β gene and the DNA encoding the RNA. It is. There are several factors as described below for the action of an antisense nucleic acid to suppress the expression of a target gene. That is, transcription initiation inhibition by triplex formation, transcription inhibition by hybridization with a site where an open loop structure is locally created by RNA polymerase, transcription inhibition by hybridization with RNA that is undergoing synthesis, intron and exon Of splicing by hybrid formation at the junction with the protein, suppression of splicing by hybridization with the spliceosome formation site, suppression of transition from the nucleus to the cytoplasm by hybridization with mRNA, hybridization with capping sites and poly (A) addition sites Splicing suppression by formation, translation initiation suppression by hybridization with the translation initiation factor binding site, translation suppression by hybridization with the ribosome binding site near the initiation codon, peptization by hybridization with the mRNA translation region and polysome binding site For example, inhibition of gene chain elongation is prevented, and hybridization between nucleic acid and protein interaction sites is performed. They inhibit transcription, splicing, or translation processes and suppress target gene expression (Hirashima and Inoue, "Neurochemistry Experiment Course 2, Nucleic Acid IV Gene Replication and Expression", edited by the Japanese Biochemical Society, Tokyo Kagaku Dojin , pp.319-347, 1993).

  The antisense sequence used in the present invention may suppress the expression of the target gene by any of the actions described above. In one embodiment, if an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the gene is designed, it will be effective for inhibiting translation of the gene. However, sequences complementary to the coding region or the 3 ′ untranslated region can also be used. As described above, a DNA containing an antisense sequence of a non-translated region as well as a translated region of a gene is also included in the antisense DNA used in the present invention. The antisense DNA to be used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side. The sequence of the antisense DNA is preferably a sequence complementary to the HNF-1β gene or a part thereof, but may not be completely complementary as long as the gene expression can be effectively inhibited. The transcribed RNA preferably has a complementarity of 90% or more, most preferably 95% or more, to the transcription product of the target gene. In order to effectively inhibit the expression of a target gene using an antisense sequence, the length of the antisense DNA is at least 15 bases or more, preferably 100 bases or more, more preferably 500 bases or more. is there. Usually, the length of the antisense DNA used is shorter than 5 kb, preferably shorter than 2.5 kb.

  Another embodiment of “RNA complementary to the transcript of HNF-1β gene” and “DNA encoding the RNA” is a dsRNA complementary to the transcript of HNF-1β gene (transcription of HNF-1β gene). DsRNA consisting of RNA complementary to the product and its complementary strand) and DNA encoding the dsRNA. RNAi is a phenomenon in which, when a double-stranded RNA (hereinafter referred to as dsRNA) having the same or similar sequence as a target gene sequence is introduced into a cell, the expression of the introduced foreign gene and target endogenous gene are both suppressed. When dsRNA of about 40 to several hundred base pairs is introduced into a cell, a RNaseIII-like nuclease called Dicer with a helicase domain is present in the presence of ATP, and dsRNA is about 21 to 23 base pairs from the 3 ′ end. Cut out and produce siRNA (short interference RNA). A protein specific to this siRNA binds to form a nuclease complex (RISC: RNA-induced silencing complex). This complex recognizes and binds to the same sequence as siRNA, and cleaves the mRNA of the target gene at the center of siRNA by RNaseIII-like enzyme activity. In addition to this pathway, the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RsRP) to synthesize dsRNA. There is also a possibility that this dsRNA becomes Dicer's substrate again to generate new siRNA and amplify the action.

  The RNAi was originally found in nematodes (Fire, A. et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811, (1998)), In addition to nematodes, it has been observed in various organisms such as plants, linear animals, Drosophila, protozoa (Fire, A. RNA-triggered gene silencing. Trends Genet. 15, 358-363 (1999), Sharp, PA RNA interference 2001. Genes Dev. 15, 485-490 (2001), Hammond, SM, Caudy, AA & Hannon, GJ Post-transcriptional gene silencing by double-stranded RNA.Nature Rev. Genet. 2, 110-1119 ( 2001), Zamore, PD RNA interference: listening to the sound of silence. Nat Struct Biol. 8, 746-750 (2001)). In these organisms, it has been confirmed that the expression of the target gene is suppressed by actually introducing dsRNA from a foreign body, and is also being used as a method for creating knockout individuals.

  At the beginning of RNAi, dsRNA was thought to be effective unless it was longer than a certain length (40 bases), but US Rockefeller University Tuschl et al. Used single-stranded dsRNA (siRNA) around 21 base pairs in cells. Introduced in, we report that RNAi is effective in mammalian cells without causing antiviral reaction by PKR (Tuschl, Nature, 411, 494-498 (2001)). It has attracted a lot of attention as a technology that can be applied to mammalian cells.

  The DNA of the present invention comprises an antisense code DNA that encodes an antisense RNA for any region of the target gene mRNA, and a sense code DNA that encodes a sense RNA for any region of the target gene mRNA. The antisense RNA and the sense RNA can be expressed from the sense code DNA and the sense code DNA. Moreover, dsRNA can also be produced from these antisense RNA and sense RNA.

  When the dsRNA expression system of the present invention is retained in a vector or the like, the antisense RNA and sense RNA are expressed from the same vector, and the antisense RNA and sense RNA are expressed from different vectors, respectively. There is. For example, antisense RNA and sense RNA can be expressed from the same vector as antisense RNA in which an antisense coding DNA and a promoter capable of expressing a short RNA such as polIII are linked upstream of the sense coding DNA. It can be constructed by constructing an expression cassette and a sense RNA expression cassette, respectively, and inserting these cassettes into the vector in the same direction or in the opposite direction. It is also possible to construct an expression system in which the antisense code DNA and the sense code DNA are arranged in opposite directions so as to face each other on different strands. In this configuration, one double-stranded DNA (siRNA-encoding DNA) in which an antisense RNA coding strand and a sense RNA coding strand are paired is provided, and antisense RNA and sense RNA from each strand are provided on both sides thereof. A promoter is provided oppositely so that it can be expressed. In this case, in order to avoid adding extra sequences downstream of the sense RNA and antisense RNA, a terminator is added to the 3 ′ end of each strand (antisense RNA coding strand, sense RNA coding strand). It is preferable to provide. As this terminator, a sequence in which four or more A (adenine) bases are continued can be used. Further, in this palindromic style expression system, it is preferable that the two promoters are of different types.

  In addition, as a configuration for expressing antisense RNA and sense RNA from different vectors, for example, antisense coding DNA and an antisense in which a promoter capable of expressing a short RNA such as polIII is linked upstream of the sense coding DNA. An RNA expression cassette and a sense RNA expression cassette can be constructed, and these cassettes can be held in different vectors.

  In the RNAi of the present invention, siRNA may be used as dsRNA. “SiRNA” means a double-stranded RNA consisting of short strands in a range that does not show toxicity in cells, and is not limited to the total length of 21 to 23 base pairs reported by Tuschl et al. The length is not particularly limited as long as the length is not shown. For example, the length can be 15 to 49 base pairs, preferably 15 to 35 base pairs, and more preferably 21 to 30 base pairs. Alternatively, the siRNA to be expressed is transcribed and the length of the final double-stranded RNA portion is, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, more preferably 21 to 30 base pairs. be able to.

  As the DNA of the present invention, an appropriate sequence (preferably an intron sequence) is inserted between inverted repeats of a target sequence to produce a double-stranded RNA having a hairpin structure (self-complementary 'hairpin' RNA (hpRNA)). (Smith, NA et al. Nature, 407: 319, 2000, Wesley, SV et al. Plant J. 27: 581, 2001, Piccin, A. et al. Nucleic Acids Res. 29: E55, 2001) Can also be used.

  The DNA used for RNAi need not be completely identical to the target gene, but has at least 70%, preferably 80%, more preferably 90%, most preferably 95% or more sequence identity. . The identity of the base sequence can be determined using the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc Natl Acad Sci USA 90: 5873, 1993) by Carlin and Arthur. Programs called BLASTN and BLASTX based on the BLAST algorithm have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When analyzing a base sequence using BLASTN, parameters are set to, for example, score = 100 and wordlength = 12. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods of these analysis methods are known.

  The part of the double-stranded RNA in which the RNAs in dsRNA are paired is not limited to a perfect pair, but mismatch (corresponding base is not complementary), bulge (no base corresponding to one strand) ) Or the like may include an unpaired portion. In the present invention, both bulges and mismatches may be included in the double-stranded RNA region where RNAs in dsRNA pair with each other.

  The above antisense RNA and dsRNA can be chemically synthesized. In this case, RNA can be modified to prevent degradation by nuclease. For example, thiolated RNA is suitable because it is less susceptible to nuclease action. Alternatively, these RNAs can be expressed in cells. A vector in which a DNA encoding a target RNA is linked downstream of a promoter active in the target cell is prepared and introduced into the cell. As the vector, a viral vector such as a retrovirus vector, an adenovirus vector, and an adeno-associated virus vector, a non-viral vector such as a liposome, and the like can be used. By using these vector systems, gene therapy can be performed by administering to a patient by ex vivo method or in vivo method.

  The present invention also includes a polynucleotide (decoy nucleic acid) containing a binding sequence of HNF-1β protein. The polynucleotide may be RNA or DNA. An example is a polynucleotide comprising GTTAATNATTAAC (SEQ ID NO: 3) as a consensus sequence (Dirk BC and Gerald RC, J. Biol. Chem., 266, 677-680, 1991).

  The therapeutic agent for ovarian clear cell adenocarcinoma of the present invention can be produced by mixing with a physiologically acceptable carrier, excipient, diluent or the like. The therapeutic agent for ovarian clear cell adenocarcinoma of the present invention can be administered orally or parenterally for the purpose of improving the disease.

  As the oral preparation, dosage forms such as granules, powders, tablets, capsules, solvents, emulsions or suspensions can be selected. Examples of injections include subcutaneous injections, intramuscular injections, intraperitoneal injections, and the like.

  Moreover, when the compound to be administered consists of protein, the therapeutic effect can be achieved by introducing a gene encoding it into a living body using a gene therapy technique. A technique for treating a disease by introducing a gene encoding a protein having a therapeutic effect into a living body and expressing the gene is known.

  The dosage varies depending on the patient's age, sex, body weight and symptoms, therapeutic effect, administration method, treatment time, or the type of active ingredient contained in the pharmaceutical composition, etc. A therapeutically effective dose could be determined. Since the dose varies depending on various conditions, a dose smaller than the above dose may be sufficient, or a dose exceeding the above range may be required.

  When a nucleic acid molecule that suppresses the expression of the HNF-1β gene or the function of the HNF-1β protein is incorporated into a vector and administered, it is effective for treatment in consideration of the activity of the promoter that governs the expression of the nucleic acid molecule. The dosage of the vector will need to be determined.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.
[Materials and Methods Used in Examples]
[1] Cell culture

The providers and sources of the cell lines used in this example are shown below.
RMG-1, RMG-2, and RMUG-L (Dr. Nozawa (Keio University, Tokyo, Japan))
JHOS-5, JHOC-2, and JHOS-3 (Dr. Ishikawa (Tokyo Jikei University School of Medicine, Tokyo, Japan))
OMC-3 (Dr. Yamada (Osaka Medical University, Osaka, Japan))
MCAS (JCRB Gene Bank, Tokyo, Japan)
OV-90, TOV-21G, TOV-112D, and HeLa cells (ATCC (American Type Culture Collection), Manassas, VA)

The abbreviations and tissue types of the above cell lines are shown in Table 1. All cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 units / mL penicillin, and 100 μg / mL streptomycin at 37 ° C. in a humid gas phase at 37 ° C. and 5% CO ₂ air. Cultured.

[2] RNA extraction and oligonucleotide array

Total RNA was extracted from each cell line using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions and treated with DNaseI (Promega, Madison, WI). CRNA target from 5 μg total RNA from each sample using Super Script Choice System (Invitrogen) and BioArray High Yield RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY) according to the manufacturer's instructions Synthesized. Hybridization of each cRNA target to a human U95Av2 oligonucleotide probe array (corresponding to 12,686 human genes) (Affymetrix, Santa Clara, Calif.) And signal detection were performed according to the manufacturer's instructions. Subsequently, the absolute value of the expression level was analyzed using Affymetrix Microarray Suite 4.0 software (absolute analysis). The expression intensity data was standardized so that the average signal intensity of all genes for each array was 1000. The resulting expression intensity data was selected and analyzed by GeneSpring software (version 4.2.1; Silicon Genetics, San Carlos, CA).
[3] Real-time reverse transcription PCR

Template cDNA was synthesized from total RNA samples using oligo (dT) _12-18 primer (Invitrogen) and Omniscript reverse transcriptase (Qiagen, Hilden, Germany). Using a QuantiTect SYBR Green PCR kit (Qiagen) and GeneAmp 7700 Sequence Detector (PerkinElmer Applied Biosystems, Foster City, CA), real-time quantitative RT-PCR was performed under the following conditions.
95 ° C 15 minutes 1 cycle
95 ° C 15 seconds, 55 ° C 30 seconds, 72 ° C 30 seconds 40 cycles
In order to normalize the amount of RNA, the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in each sample was quantified. Primer pairs for amplification of HNF-1β, lamin, and GAPDH cDNA are shown below.
HNF-1β (forward direction) 5′-GCCCACACACCACTTACTTCG-3 ′ (SEQ ID NO: 4)
(Reverse direction) 5'-GTCCGTCAGGTAAGCAGGGAC-3 '(SEQ ID NO: 5)
Lamin (positive direction) 5'-CTGCGCAACAAGTCCAATGAG-3 '(SEQ ID NO: 6)
(Reverse direction) 5'-CAGGGTGAACTTTGGTGGGAAC-3 '(SEQ ID NO: 7)
GAPDH (positive direction) 5'-AGGAAGAGAGAGACCCTCACTGC-3 '(SEQ ID NO: 8)
(Reverse direction) 5'-ATGACAAGGTGCGGCTCC-3 '(SEQ ID NO: 9)
Quantitative RT-PCR was performed at least 3 times for each sample, and a sample without template cDNA was used as a negative control. Statistical analysis was performed by the Mann-Whitney U-test.
[4] Immunoblot analysis

For immunoblot analysis, cells were lysed with lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland)). The lysate was centrifuged and the supernatant was prepared. Equal amounts of protein were separated by SDS-PAGE (10%) and transferred to a polyvinylidene difluoride membrane (Immobilon; Millipore, Canton, Mass.). In order to prevent non-specific antigen-antibody reaction, it was blocked by incubation with phosphate buffered saline (PBS) containing 5% (w / v) nonfat dry milk at room temperature for 90 minutes. The membrane was then washed in the same blocking solution with goat polyclonal antibody (sc-7411; Santa Cruz Biotechnology, CA) for HNF-1β and mouse monoclonal antibody (612163; BD Biosciences for Lamin A / C). , San Jose, California) and mouse monoclonal antibody (sc-8035; Santa Cruz Biotechnology) for α-tubulin as a loading control was incubated overnight at 4 ° C. The membrane was then washed and incubated with horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) for 90 minutes at room temperature. Immune complexes were visualized using a chemiluminescent detection system (Amersham Pharmacia Biotech, Buckinghamshire, UK).
[5] Cases used for immunohistochemical staining

  A total of 83 surgically resected specimens of epithelial ovarian cancer were investigated at the National Cancer Center Central Hospital between 1998 and 2001. The patient's age ranged from 30 to 84 years (average 55.6 years) and the patient had not received chemotherapy or other treatment prior to surgery. The detailed clinicopathological features of the patients are summarized in Table 2. Normal ovarian surface epithelium from 10 patients with ovarian endometriosis and 10 other patients with benign gynecological diseases was also investigated. Pathological diagnosis was performed according to the standards of the World Health Organization and the World Obstetrics and Gynecology Union (FIGO) (Serov SF, et al., Geneva: World Health Organization 1973).

[6] Immunohistochemical staining

A section cut to 5 μm thickness from formalin-fixed paraffin-embedded tissue was deparaffinized with xylene, treated with methanol solution containing 0.3% hydrogen peroxide, and immersed in 10 mM citrate buffer (pH 6.0). Heated in a microwave oven at 90 ° C. for 10 minutes and cooled at room temperature for 30 minutes. Sections were preincubated with PBS containing 2% normal porcine serum (Dako, Grostrap, Denmark), incubated with primary antibody overnight at 4 ° C, washed with PBS, and biotinylated horse anti-goat immunoglobulin as secondary antibody (Vector Laboratories, Burlingame, Calif.) For 30 minutes. Subsequently, Tris containing 0.02% 3,3'-diaminobenzidine tetrahydrochloride of chromogen and 0.007% hydrogen peroxide was incubated with avidin-biotinyl-peroxidase complex for 30 minutes using Vectastain ABC kit (Vector Laboratories) The sample was subjected to peroxidase reaction using -HCl buffer (pH 7.6), and then subjected to nuclear counterstaining using hematoxylin.
[7] Staining evaluation and statistical methods

Two observers (AT and MS) evaluated the staining. Scored based on the percentage of nuclei positive for HNF-1β (0, no positive cells; 1, 5% or less; 2, 6% to 25%; 3, 26% to 50%; 4, 51% to 75%; 5, more than 75%). Mann-Whitney U test and χ ² test were used to analyze the statistical significance of the relationship between HNF-1β expression and clinicopathological variables.
[8] RNA interference

A chemically synthesized double-stranded RNA consisting of 21 nucleotides, HNF-1β siRNA, was obtained from Dharmacon Research Inc. (Raffyette, CO). HNF-1β siRNA was targeted to the coding region 1276-1296 (AAUCCCCAGCAAUCUCAAAAC (SEQ ID NO: 10)) for the first nucleotide of the start codon (Genbank accession number X58840). Control siRNA targeting luciferase GL2 and lamin A / C were obtained from Dharmacon Research Inc. 2 × 10 ⁵ cells were plated in 6-well plates for real-time quantitative RT-PCR, immunoblot, TUNEL, and FACS analysis. Twenty-four hours after plating, cells were transfected with a final concentration of 100 nM siRNA using siPORT Lipid (Ambion, Austin, TX) according to the manufacturer's instructions.
[9] Detection of apoptosis

  Apoptosis was detected by TUNEL (in situ terminal transferase mediated dUTP nick end labeling) analysis and FACS (fluorescent cell analysis separator) analysis. TUNEL analysis was performed using an In Situ cell death detection kit (Roche Deagnostics) according to the manufacturer's instructions. The nuclei were then counterstained with VectaShield DAPI (Vector Laboratories) and observed with a Zeiss LSM410 microscope (Thornwood, NY). TUNEL positive nuclei were counted and divided by the number of DAPI stained nuclei to calculate the ratio of TUNEL positive cells.

For FACS analysis, a certain time after transfection with siRNA, adherent cells and isolated cells were combined and fixed overnight at 4 ° C. with 70% ethanol. After washing twice with PBS, the cells were incubated with 1 ml PBS containing 1 mg ribonuclease A for 20 minutes at 37 ° C. and stained with 1 ml PBS containing 50 μg propidium iodide. A total of 2 × 10 ⁴ cells were analyzed on a flow cytometer (FACScalibur; Becton Dickinson, Franklin Lakes, NJ) and sub-G1 peaks were quantified using CELLQuest software.
[Example 1] Expression analysis of 11 ovarian cancer cell lines

To identify genes that are differentially expressed in CCC and non-CCC, oligonucleotide arrays were used to determine gene expression in 4 ovarian CCC cell lines and 7 other histological cell lines. Compared. All genes were selected according to the following criteria.
(1) Expression is observed in at least 5 samples out of 11 samples (2) Expression intensity is over 1000 in at least 5 samples out of 11 samples (expression intensity is between perfect matched probe pair and mismatched probe pair) Meaning the difference in signal intensity).
(3) Gene groups whose expression is different between CCC and non-CCC with P <0.05 by Mann-Whitney U test.
Using the above criteria, 207 differentially expressed genes were selected from 12,686 pairs of probes. Furthermore, in order to identify genes that are significantly different in expression in CCC cells or non-CCC cells, genes with a difference of 3 times or more in expression intensity between the two groups were listed (FIG. 1). Compared with non-CCC, the expression of 16 genes was increased in CCC and the expression of 12 genes was attenuated.
[Example 2] Expression of HNF-1β mRNA and protein in ovarian cancer cell lines

  The present inventors paid attention to the transcription factor HNF-1β among the genes shown in FIG. Since HNF-1β is the most highly upregulated transcription factor, it was speculated that the regulation of target genes downstream of it contributes to the characteristic biological behavior of CCC. First, the present inventors analyzed the expression level of HNF-1β mRNA by quantitative RT-PCR (FIG. 2A). The relative expression level of HNF-1β mRNA normalized by GAPDH mRNA by quantitative RT-PCR analysis was closely correlated with the results of microarray analysis. The relative expression level of HNF-1β mRNA in CCC (8.75 ± 3.89) was an average of 11.6 times that of non-CCC (0.75 ± 1.09) (P = 0.008 by U test).

Next, the expression of HNF-1β protein was examined using an anti-HNF-1β antibody. Immunoblot detection of HNF-1β in a series of ovarian cancer cell lines is shown in FIG. 2B. A band with a molecular weight of 70,000 corresponding to HNF-1β protein was detected in all CCC cell lines. The 55,000 molecular weight band detected in C1 and C2 is due to the presence of three HNF-1β isoforms (Bach I & Yaniv M, Embo J 1993, 12: 4229-4242). It was thought that it corresponded to. No specific bands other than these two HNF-1β specific bands were detected. The band intensity of 70,000 molecular weight in each cell line correlated with the mRNA expression level obtained by quantitative RT-PCR analysis. Except for M1, there was little or no expression of HNF-1β protein in any non-CCC cell line.
[Example 3] Immunohistochemical staining of ovarian cancer specimen

  To identify whether the expression of HNF-1β is enhanced at the protein level in surgically excised specimens of CCC, immunohistochemical staining was performed using the same anti-HNF-1β antibody used in the immunoblot analysis. Performed (FIG. 3). Almost all CCC specimens stained nuclei (FIGS. 3A-C), but non-CCC specimens were not immunostained at all or only locally and slightly stained nuclei (FIGS. 3D-G). Nuclear staining of HNF-1β was not observed in benign endometriosis specimens (FIG. 3H). Normal ovarian surface epithelium, considered to be the origin of epithelial ovarian cancer, also did not show nuclear staining for HNF-1β (FIG. 3I).

The CNF HNF-1β immunostaining score (4.22 ± 0.85) was significantly higher than the non-CCC HNF-1β immunostaining score (0.31 ± 0.62) (P <0.0001 by U test) (FIG. 4). Differences in the expression pattern of HNF-1β (high and low HNF-1β expression) did not correlate with patient age or tissue differentiation (Table 3). P value for the difference in the expression pattern of HNF-1β between early FIGO stage (I, II stage) and advanced stage (III, IV stage) is significant (P = 0.041 by χ ² test) (Table 3) The present inventors considered that this significance is due to the fact that many CCCs have an early (stage I, II) FIGO stage, and the CNF HNF-1β immunostaining score is higher than that of non-CCC. In fact, there was no significant difference in HNF-1β score between early CCC (4.16 ± 0.57, 18 cases) and advanced CCC (4.50 ± 0.99, 4 cases) (P = 0.670 by U test). Therefore, there was no essential relationship between the immunostaining score and the FIGO stage.

[Example 4] Reduction of HNF-1β expression by RNA interference

  In order to examine whether the expression enhancement of HNF-1β in CCC is biologically significant, functional analysis was performed by reducing HNF-1β expression using RNAi. Quantitative RT-PCR was used to test the ability of siRNA to reduce endogenous levels of lamin and HNF-1β mRNA in the TOV-21G ovarian clear cell adenocarcinoma cell line (FIG. 5A). Lamin mRNA expression levels compared to cells treated with transfection reagent alone with lamin siRNA having the same sequence as used by Elbashir et al. (Elbashir SM, et al., Nature 2001, 411: 494-498) Although significantly decreased to 44 ± 6%, the expression of HNF-1β mRNA was not decreased. HNF-1β siRNA significantly reduced HNF-1β mRNA expression levels by 27-45% compared to cells treated with transfection reagent alone, but did not reduce lamin mRNA expression. Thus, the use of siRNA induced gene specific silencing in the TOV-21G cell line.

Next, by immunoblot analysis, we tested whether siRNA also reduced lamin or HNF-1β protein expression (FIG. 5B). Lamin siRNA reduced lamin protein expression. HNF-1β siRNA decreased HNF-1β protein expression over time, and the band intensity of HNF-1β protein reached almost the background level 36 hours after transfection. Lamin siRNA or HNF-1β siRNA reduced lamin protein or HNF-1β protein, respectively, and siRNA targeting luciferase, where TOV-21G is not endogenously expressed, did not alter any protein expression.
[Example 5] Induction of apoptosis of ovarian clear cell adenocarcinoma cells by reduction of HNF-1β expression

  It was observed that TOV-21G cells transfected with HNF-1β siRNA frequently detached from the culture dish and floated in the culture medium, and the floating cells showed a circular, shrunken morphology reminiscent of apoptosis. . On the other hand, cells transfected with lamin siRNA as a control showed no floating or morphological changes. To determine whether decreased HNF-1β expression induced apoptosis of TOV-21G cells, TUNEL and FACS analyzes were performed. TUNEL analysis showed that 9.2 ± 2.2% of adherent TOV-21G cells transfected with HNF-1β siRNA undergo apoptosis 24 hours after the start of transfection. The proportion of apoptotic cells was significantly higher than the proportion of control cells transfected with lamin siRNA (2.9 ± 1.0%) (P <0.001 by U test) (FIG. 6A).

  FIG. 6B shows the effect of HNF-1β siRNA over time on the cell cycle profile of TOV-21G cells by FACS analysis. When cells were treated with lamin siRNA or buffer alone, the proportion of cells in the sub-G1 peak, characteristic of apoptotic cells, did not change throughout the experimental period. On the other hand, in the cells treated with HNF-1β siRNA, a significant increase in sub-G1 peak was observed 12 hours after the start of transfection. The ratio of sub-G1 peak in HNF-1β siRNA-treated cells increased stepwise, reaching 23.0% 24 hours after the start of transfection.

  To exclude the possibility that the synthesized HNF-1β siRNA showed unexpected toxicity to cultured cells, FACS analysis of HeLa cells that did not show endogenous HNF-1β expression was performed. In HeLa cells, expression of HNF-1β mRNA (data not shown) and HNF-1β protein (FIG. 5C) was not observed. Since lamin siRNA decreased the content of lamin protein contained in HeLa cells, it was shown that the RNAi mechanism acted on HeLa cells (FIG. 5C). FACS analysis performed 24 hours after transfection revealed no significant difference between the sub-G1 peak of HNF-1β siRNA-treated cells and the sub-G1 peak of lamin-siRNA-treated cells (FIG. 6B). Therefore, this finding indicates that the synthesized HNF-1β siRNA has no non-specific side effects, and TOV-21G cells transfected with HNF-1β siRNA by degradation of HNF-1β mRNA and subsequent reduction of HNF-1β protein. Has been shown to cause apoptotic cell death.

  As a result of the expression analysis of the ovarian cancer cell line using the oligonucleotide array, the present inventors have found that the expression of HNF-1β is enhanced in the ovarian clear cell adenocarcinoma cell line. Furthermore, the present inventors have used surgically excised specimens with various clinicopathological features, so that the increased expression of HNF-1β expression at the protein level is independent of the clinical progression stage or the degree of tissue differentiation. We found it very strongly related to ovarian CCC. Over 95% of CCC specimens analyzed (21 out of 22 cases) showed more than 25% of HNF-1β-positive cancer cells, compared to less than 2% of non-CCC specimens (61 cases) 1 case), and more than 25% HNF-1β positive cancer cells were not observed. Endometriosis is highly associated with CCC (Ogawa S, et al., Gynecol Oncol 2000, 77: 298-304) and is considered a precursor lesion of CCC (Feeley KM & Wells M, Histopathology 2001 , 38: 87-95), it is interesting that no HNF-1β immunostaining was observed in benign endometriosis specimens or normal ovaries. The results of immunohistochemical staining indicate that HNF-1β is a useful molecular marker for ovarian CCC. Particularly in cytodiagnosis, HNF-1β immunostaining is an excellent method for distinguishing ovarian CCC cells from other tissue types, which has been difficult with conventional standard Papanicolaou staining.

  In addition, functional analysis of HNF-1β using RNAi suggested that HNF-1β expression is essential for the survival of CCC cells. Evidence that inhibition of HNF-1α with dominant negative mutants induces apoptosis of insulinoma cells supports our findings (Wobser H, Dussmann H, et al., J Biol Chem 2002 277: 6413-6421).

  In conclusion, we have found a series of genes that are preferentially expressed in ovarian CCC. It was further found that HNF-1β expression is strongly associated with CCC and is essential for its cell survival. The gene cluster found in the present invention is considered to be a useful clue to clarify the unique properties of CCC, including its origin, morphology, and resistance to standard treatment of ovarian cancer.

It is the figure and photograph which show the gene from which expression differs by clear cell adenocarcinoma and non-clear cell adenocarcinoma. The expression levels of 28 genes were significantly increased or decreased by 3 times or more at P <0.05 by U test. Each color patch in the resulting visual map shows the level of gene expression in 11 cell line samples from green (lowest) to bright red (highest). Genbank accession number, gene symbol, locus, gene description, and fold change. The scale bar reflects the increase (red) or decrease (green) of any given gene relative to the median expression level of all samples. Samples are classified as follows: C = clear cell carcinoma of the ovary, E = endometrial adenocarcinoma, M = mucinous adenocarcinoma, S = serous adenocarcinoma. FIG. 2 is a diagram and a photograph showing quantitative RT-PCR analysis and immunoblot analysis in an ovarian cancer cell line. A: Gene expression level of HNF-1β. Expression levels were normalized with GAPDH mRNA in each sample. B and C: immunoblot analysis of HNF-1β protein (B). Each cell lysate (20 μg) was analyzed using anti-HNF-1β antibody. The arrow indicates the normal HNF-1β isoform. In order to confirm that the amount of protein loaded in each lane was equal, reprobing was performed with an anti-α-tubulin antibody (C). Table 1 shows the abbreviations (C1, C2, C3, C4, E1, M1, M2, M3, S1, S2, and S3) of these cell lines and the cell line tissue types. It is a photograph showing immunohistochemical staining of HNF-1β protein expression in a surgically resected epithelial ovarian cancer specimen. Clear cell adenocarcinoma of the ovary (A: case 26, B: case 8, C: case 15), serous adenocarcinoma (D: case 35, E: case 59), endometrioid adenocarcinoma (F: case 18), And immunohistochemical staining of paraffin-embedded samples of mucinous adenocarcinoma (G: case 81) were performed using antibodies against HNF-1β. Ovarian endometriosis (H) and normal ovarian surface epithelium (I) were also immunostained with the same antibody. Clear cell adenocarcinoma showed strong staining in the nucleus for HNF-1β. Magnification: AH; 200 times, I; 400 times. It is a figure which shows the relationship between the immunohistochemical staining of HNF-1β and a tissue type. Box-whisker diagram showing the relationship between HNF-1β immunostaining score and tissue type. The box contains 25th to 75th percentiles with a 50th percentile (median) in between. The 5th and 95th percentiles are shown as upper and lower circles, and the 10th and 90th percentiles are shown as whisker caps. The immunostaining score for clear cell adenocarcinoma was significantly higher than that of the other tissue types (P <0.0001 by U test). FIG. 2 is a diagram and a photograph showing the effect of siRNA in HeLa and TOV-21G ovarian clear cell adenocarcinoma cells. A: Lamin and HNF-1β gene expression levels measured by real-time quantitative RT-PCR analysis. TOV-21G cells transfected with buffer (PBS + transfection reagent), luciferase siRNA, and lamin siRNA were analyzed 24 hours after the start of transfection. HNF-1β siRNA transfected cells were analyzed 12 hours, 24 hours and 36 hours after the start of transfection. Expression levels were normalized with GAPDH mRNA in each sample. I went three times and took the average. Error bars indicate standard deviation. ^** indicates a significant decrease compared to buffer alone (P <0.001 by U test). B and C: immunoblot analysis of lamin and HNF-1β protein in transfected TOV-21G (B) and HeLa (C) cells. Each cell line lysate (20 μg) was analyzed using anti-lamin and anti-HNF-1β antibodies. Reprobed with anti-α-tubulin antibody to confirm that the total protein mass loaded in each lane was equal. FIG. 2 is a diagram and a photograph showing the induction of apoptosis by decreasing HNF-1β expression in TOV-21G ovarian clear cell adenocarcinoma cells using RNAi. A: TOV-21G cells were transfected with HNF-1β and lamin siRNA. Apoptosis was detected 24 hours after the start of transfection by the TUNEL method using FITC radiation. The ratio of TUNEL positive values corresponds to the average and standard deviation of the results obtained in 3 independent experiments with a total of 10 fields per slide evaluated in 3 areas. B: Apoptotic cells were analyzed by FACS analysis at 6, 12, 18, and 24 hours after the start of transfection using buffer (PBS + transfection reagent), lamin siRNA, and HNF-1β siRNA (upper four rows). evaluated. Values indicate the percentage of cells containing sub-G1 DNA content. Measurements were performed three times for each experiment in three independent experiments. As a control, siRNA was transfected into HeLa cells that did not show endogenous HNF-1β expression, and the proportion of apoptotic cells was evaluated by FACS analysis 24 hours later.

Claims (16)

A test method for ovarian clear cell adenocarcinoma,
(1) collecting a cell suspected of having ovarian clear cell adenocarcinoma from a subject, and (2) measuring the expression level of the HNF-1β gene in the cell collected in step (1),
A subject whose HNF-1β gene expression level measured in step (2) is higher than the HNF-1β gene expression level in the control cells for determining the risk of ovarian clear cell adenocarcinoma is designated as ovarian clear cell adenocarcinoma. A method of determining that you are at risk of being affected. The test method according to claim 1, wherein the gene expression level is measured at the transcription level. The method according to claim 2, wherein the transcription level is measured by real-time quantitative RT-PCR. The method according to claim 1, wherein the expression level of the gene is measured at the translation level. The test method according to claim 4, wherein the translation level is measured by immunoblot analysis. The test method according to claim 4, wherein the translation level is measured by immunohistochemical staining. The method according to claim 1, wherein the control cells for determining the risk of ovarian clear cell adenocarcinoma are ovarian cancer cells other than ovarian clear cell adenocarcinoma or normal ovarian surface epithelium. A test for ovarian clear cell adenocarcinoma comprising the following (a) or (b):
(A) a polynucleotide comprising at least 15 consecutive nucleotide sequences of the sense strand of the HNF-1β gene or its complementary strand (b) an antibody that binds to the HNF-1β protein A screening method for a therapeutic agent for ovarian clear cell adenocarcinoma, comprising the following steps.
(1) The step of bringing the HNF-1β protein into contact with the candidate compound (2) The step of measuring the binding activity between the protein and the candidate compound (3) The step of selecting a compound that binds to the protein A screening method for a therapeutic agent for ovarian clear cell adenocarcinoma, comprising the following steps.
(1) The step of contacting a candidate compound with a cell that expresses the HNF-1β gene (2) The step of measuring the expression level of the HNF-1β gene (3) Compared with the case where the candidate compound is not contacted, the HNF-1β gene Selecting a compound that reduces the expression level of The method according to claim 10, wherein the cell expressing the HNF-1β gene is a clear cell adenocarcinoma cell. A screening method for a therapeutic agent for ovarian clear cell adenocarcinoma, comprising the following steps.
(1) A step of bringing a candidate compound into contact with a cell into which a vector containing a transcription regulatory region of the HNF-1β gene and a reporter gene expressed under the control of this transcriptional regulatory region is brought into contact (2) Measuring the activity of the reporter gene (3) selecting a compound that reduces the expression level of the reporter gene compared to a control that does not contact the candidate compound A screening method for a therapeutic agent for clear cell adenocarcinoma, comprising the following steps.
(1) A step of contacting a compound identified by the screening method according to any one of claims 9 to 12 with an ovarian clear cell adenocarcinoma cell (2) a step of detecting apoptosis of the ovarian clear cell adenocarcinoma cell (3) A step of selecting a compound that induces apoptosis of ovarian clear cell adenocarcinoma cells A therapeutic agent for ovarian clear cell adenocarcinoma comprising a compound obtainable by the screening method according to any one of claims 9 to 13 as an active ingredient. A therapeutic agent for ovarian clear cell adenocarcinoma comprising, as an active ingredient, a compound having the ability to reduce the expression level or activity of the HNF-1β gene. The therapeutic agent according to claim 15, wherein the compound having the ability to decrease the expression level or activity of the HNF-1β gene is any one of the following (a) to (c).
(A) RNA complementary to the transcript of the HNF-1β gene
(B) DNA encoding the RNA of (a)
(C) a polynucleotide comprising a binding sequence of HNF-1β protein