KR101764970B1

KR101764970B1 - Biomarker composition for diagnosing cancer with mitochondrial dysfunction comprising NUPR1 and method for diagnosing cancer using the same marker

Info

Publication number: KR101764970B1
Application number: KR1020150081949A
Authority: KR
Inventors: 윤계순; 우현구; 이영경; 임종진
Original assignee: 아주대학교산학협력단
Priority date: 2015-06-10
Filing date: 2015-06-10
Publication date: 2017-08-04
Also published as: KR20160145897A

Abstract

The present invention relates to a biomarker composition for diagnosing malignancy-deficient cancer comprising NUPR1 and a method for diagnosing cancer using the same, and more particularly, to a biomarker composition for diagnosing malignancy of cancer, which comprises a NUPR1 gene or a protein encoded by the gene, A cancer diagnosis kit using the same, and a cancer diagnosis method. In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer that has undergone mitochondrial function comprising an NUPR1 protein expression or activity inhibitor as an active ingredient, and a method for screening a cancer treating agent having a reduced function of mitochondria using the NUPR1 protein. Therefore, the NUPR1 gene or the NUPR1 protein of the present invention can be usefully used for diagnosing and treating cancer that has undergone mitochondrial function.

Description

[0001] The present invention relates to a biomarker composition for diagnosing malignancy of cancer, including NUPR1, and a method for diagnosing cancer using the same.

The present invention relates to a biomarker composition for diagnosing malignant mitochondrial cancer including NUPR1 and a method of diagnosing cancer using the same.

Mitochondria are intracellular organelles that regulate the energy production required by cells. Normal cells produce energy through oxidative phosphorylation of mitochondria in the presence of oxygen, and produce energy using only the corresponding process when oxygen is not present. However, in many cancer cells, it has been observed that mitochondrial ATP production is degraded, and ATP is synthesized depending on the process regardless of the presence or absence of oxygen. Thus, there is insufficient study on how the degradation of mitochondrial function observed in cancer cells is due to what mechanism, and how it is related to the proliferative capacity and invasion of cancer cells. Several recent studies have reported that mitochondrial dysfunction promotes cancer metastasis in several cancer types, including breast, stomach, or liver cancer. In other words, it has been shown that mitochondrial deficiency plays an important role in cancer progression. Therefore, it is important to identify the major mechanisms by which mitochondrial deficiency plays a role in cancer progression.

PCT Publication No. WO2010-015538 (Feb. 11, 2010)

It is an object of the present invention to provide a biomarker composition for diagnosing malignant mitochondrial cancer including NUPR1 and a method for diagnosing cancer using the same.

The present invention provides a biomarker composition for diagnosing malignancy of cancer which comprises a NUPR1 gene or a protein encoded by the gene.

The present invention also relates to a method for diagnosing malignant cancer characterized by a mitochondrial comprising a primer or a probe specifically binding to the NUPR1 gene, an antibody that specifically binds to the protein encoded by the gene, or a peptide having a binding domain specific to the protein, Provide a kit.

The present invention also provides a method for providing information necessary for diagnosis of a mitochondrial dysfunctional cancer, which comprises measuring the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene from a cancer patient sample.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer that has undergone mitochondrial function comprising an NUPR1 protein expression or activity inhibitor as an active ingredient.

In addition, the present invention provides a method for screening for a mitochondrial deficient cancer therapeutic agent, comprising the step of measuring the expression or activity level of NUPR1 protein in cancer cells.

Fig. 1 shows the results of gene expression changes in mitochondria-deficient invasive hepatic cancer cells. Three different SNU liver cancer cell lines (SNU354, SNU387 and SNU423) and Ch-L clones were cultured for 2 hours to maintain exponential growth period. (A) The oxygen consumption rate (OCR) was measured using an XF analyzer. (B) Western blot analysis of mitochondrial respiratory subunits. (C) Cellular invasion activity was performed using Matrigel ^TM -coated Transwell ^TM . The number of invaded cells was measured. Representative photographs of invaded cells are shown in the panel below. **, p < Ch-L by student t-test. (D) Heatmap of genes that are differentially expressed between mitochondrial respiratory active hepatocarcinoma cells and mitochondrial respiratory deficient hepatocarcinoma cells (mitochondrial 'tumoral defect' characteristic). As a result of gene expression profiling, a total of 2,774 genes showing a difference in expression showed a difference of more than 2 times in expression. Of these, 1301 genes were commonly up-regulated and 1473 genes were down-regulated in mitochondrial deficient cells compared to mitochondrial activated cells. (E) Functional enrichment analysis results for commonly up-regulated genes (1301 genes) and down-regulated genes (1473 genes). The concentration score represents the -log 10 converted p-values calculated from the gene cluster enrichment assay.
Fig. 2 shows the results of analysis of CMD gene characteristics. (A) Ch-L clones were analyzed by treating four different respiratory inhibitors for 12 hours: 5 μM Rotenone (Ro), 200 μM TTFA, 5 μM antimycin A (AA) or 5 μM oligomycin (Oli). Comparing the gene expression profiles of the cells, we obtained 131 genes that were commonly up-regulated (mitochondrial 'functional defect' characteristics). (B) Comparison of gene expression profiles of MDA-MB435 and its ρ0 cells resulted in up-regulated 1760 genes (mitochondrial 'genetic defect' characteristics). (C) Ten genes were obtained from CMD characteristics from three independent mitochondrial deficiency conditions (tumor, genetic and functional deficiency). (Left panel) and non-recurrence-free survival rate (right panel) obtained from independent (D) and (E) independent public data (GSE4024 and GSE14520), respectively. Patients were stratified based on the expression status of CMD characteristics (CMD_UP vs CMD_DOWN).
Figure 3 shows that among the 10 CMD genes, NUPR1 is the major TR regulating hepatoma cell invasiveness and is regulated by an increase in intracellular Ca < ⁺⁺ > (A) mRNA levels of three common TRs in SNU liver cancer cells were measured by real-time PCR. **, p < SNU387 by student t-test. (B) and the SNU354 cells transfected with siRNAs for NUPR1, NFIX and NFE2L1, the result of applying the invasive analysis. **, p < Non-specific siRNA (siNC) by student t-test. (C) Representative results image of invasive analysis. (D) Fluo-3 results after staining the cells with a fluorescent dye, by flow cytometry measuring the Ca ⁺⁺ level within the cytoplasm of SNU liver cancer cells (SNU354, SNU387 and SNU423) and comparing it with a Ch-L clone. **, p < 0.01 and *, p < Ch-L by student t-test. Representative cell distributions of Fluo-3-stained cells are shown in the panel below. (E) Results of treatment of SNU387 cells with 20 μM A23187 for the indicated time. The level of Ca ⁺⁺ in the cytoplasm (top panel) and the level of NUPR1 mRNA (bottom panel) by real-time PCR using Fluo-3 fluorescent dye were measured. (F) Treatment of SNU354 cells with 5 μM BAPTA-AM for the indicated time. The cytoplasmic Ca ⁺⁺ level (upper panel) and NUPR1 mRNA levels (panel below). *, p <0.05; **, p < DMSO treated cell (vehicle, V) by student t-test.
Figure 4 shows that GRN is the major downstream working molecule of NUPR1 . (A) SNU354 cells were transfected with siRNA for NUPR1 for 2 days and 3 days, followed by cDNA microarray analysis. And a heatmap of genes that are commonly down-regulated. 26 genes were down-regulated and 14 genes were up-regulated. (B) Genetic interaction, co-expression, physical interaction, and pathway relevance as a result of networking of 26 commonly down-regulated genes using GeneMania software. By removing unconnected genes from the network, 19 of the 26 genes were included in the network (blue and yellow circles). Of the neighbors directly linked to NUPR1 , four genes that appear to be the highest interacting partner have been identified as potential targets (yellow circle). (C, D) SNU354 cells were infected with recombinant lentiviruses with shRNAs for NUPR1 and stably isolated clones expressing shRNAs. (C) GRN And mRNA levels of NUPR1 were measured by real-time PCR. **, p < shNC by student t-test. (D) Western blot analysis. (E) SNU387 cells were transfected with pcDNA3- NUPR1- HA plasmid for 2 days. NUPR1 And protein expression levels of GRN were determined by Western blot analysis.
Figure 5 depicts the Ca ⁺⁺ -mediated NUPR1 These results show that GRN regulates liver cancer cell invasion activity by expression. (A) SNU387 cells were exposed to 20 μM A23187 for the indicated time, then GRN mRNA levels were measured by real-time PCR. (B) NUPR1 SNU354 cells stably harboring shRNA or non-specific shRNA (shNC) were exposed to 20 μM A23187 for 6 hours. GRN mRNA levels were measured by real-time PCR. (C) SNU354 cells were transfected with siRNA for GRN and cell invasion activity was measured by Matrigel-coated Transwell ^™ assay. Invasive cell counts were counted (left panel) and representative images of invaded cells (right panel). (D) SNU354 cells stably harboring NUPR1 shRNA were transfected with pcDNA3- GRN Plasmid, and applied for cellular invasion analysis. Invasive cell counts were counted (left panel) and protein levels were verified by western blot analysis (right panel). **, p < siNC, shNC, pcDNA3 or DMSO vehicle (V) by student t-test. ##, p <0.01 vs A23187 treated cell.
6 is a GRN to NUPR1 binds to GRN-specific promoter region of the Lt; RTI ID = 0.0 > promoter activity. &Lt; / RTI > (A) shows a schematic model of a GRN -pGL3 reporter plasmid containing the promoter region of the GRN -2894 to +58. Promoter sites used for ChIP analysis are shown in the panel below. (B) NUPR1 SNU354 cells stably harboring shRNA were transfected with pcDNA3- GRN Plasmid and GRN- pGL3 reporter plasmid and applied to the luciferase promoter analysis. All experiments were repeated 3 times and repeated at least 2 times. Protein levels were determined by Western blot analysis (bottom panel). ** or ##, p < the indicated control by student t-test. (C) NUPR1 Using the antibody, the displayed GRN ChIP promoter binding analysis was performed on the promoter region. Representative gel images (top panel) and quantitative results (bottom panel) were shown. (D) After NUPR1 expression was suppressed by shRNA in SNU354 cells, ChIP analysis was performed on promoter region 5. Quantitative results (right panel) and representative gel image (left panel) were shown.
FIG. 7 shows that mitochondrial deficiency and NUPR1 / GRN Expression is the result of the relationship. (A) Protein expression levels of three mitochondrial respiratory subunits and GAPDH on tumors and their surrounding tissues from 23 liver cancer patients were determined by Western blot analysis. (B) NUPR1 And GRN mRNA levels were measured by real-time PCR using sample tissue. Changes in mitochondrial activity of tumor tissues are shown in the panel below. Gray represents increased mitochondrial deficiency of GAPDH expression, plaque for active mitochondria, and white for total metabolic inhibition. (C) NUPR1 / GRN represent the proportion of co-expressed tissue.
Figure 8 shows a schematic model of the molecular association of NUPR1, the major CMD gene in liver cancer progression.

Thus, the present inventors sought to clarify the main regulatory mechanism of mitochondrial deficiency in cancer progression. We identified mitochondrial depletion in hepatocarcinoma cells and identified three independently designed mitochondrial depletion models (liver cancer cells with low respiratory activity, ie, tumor deficiency; pharmacologically respiratory depressed cells, ie, deficient function; And genetic expression profiling of mitochondrial DNA deficient cancer cells, i. E., A genetic deficiency), to identify ten common mitochondrial defect (CMD) genes. Among them, we have found that nuclear protein 1 (NUPR1) is a major transcription regulator and that the downstream effector of NUPR1 is granulin (GRN), thus completing the present invention.

The present invention provides a biomarker composition for diagnosing malignancy of cancer which comprises a NUPR1 gene or a protein encoded by the gene. Preferably, the cancer may be liver cancer, but is not limited thereto.

The term "NUPR1" of the present invention is expressed as a nuclear protein transcriptional regulator 1 or nuclear protein 1, as NCBI accession no. NC_000016.10, and two mRNA variants are transcribed from the gene, thus having two protein isoforms. The isoform may be nuclear protein 1 isoform A (NCBI Accession Number: NP_001035948.1) or nuclear protein 1 isoform B (NCBI Accession Number: NP_036517.1), but is not limited thereto.

The term " diagnosing " herein is used to determine the susceptibility of an object to a particular disease or disorder, to determine whether an object currently has a particular disease or disorder, Determining the prognosis of the object, or therametrics (e.g., monitoring the status of the object to provide information about the therapeutic efficacy).

The present invention also relates to a method for diagnosing malignant cancer characterized by a mitochondrial comprising a primer or a probe specifically binding to the NUPR1 gene, an antibody that specifically binds to the protein encoded by the gene, or a peptide having a binding domain specific to the protein, Provide a kit. Preferably, the cancer may be liver cancer, but is not limited thereto.

The term "primer" refers to a short nucleic acid sequence capable of forming a base pair with a template complementary to a nucleic acid sequence having a short free 3 'hydroxyl group and acting as a starting point for template strand replication . Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. The PCR conditions, the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

The term "probe" means a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or several hundreds of nucleotides that can specifically bind to an mRNA, and is labeled to confirm the presence or expression level of a specific mRNA . The probe may be prepared in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art.

As used herein, the term "antibody" means a specific immunoglobulin as indicated in the art and directed against an antigenic site. Any of those prepared through the above-mentioned one or more protein injections or commercially available can be used. In addition, the antibody includes a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope. The forms of the antibodies include polyclonal or monoclonal antibodies, including all immunoglobulin antibodies. The antibody refers to a complete form having two full-length light chains and two full-length heavy chains. The antibody also includes a special antibody such as a humanized antibody.

The term "peptide" refers to a polypeptide that does not have the structure of the intact antibody, but has a specific antigen binding site (binding domain) directed against the antigenic site. The peptide comprises a functional fragment of an antibody molecule that is not a complete form of the antibody having two light and two heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function.

(1) measuring the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene from the cancer patient sample; (2) comparing the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene with a control sample, and (3) comparing the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene with the control sample And a step of judging the cancer to be malfunctioning in mitochondria when the sample is higher than the sample. Preferably, the cancer may be liver cancer, but is not limited thereto.

In detail, the method for measuring the mRNA expression level may be RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA) ), Northern blotting and DNA chips, but are not limited thereto.

In detail, the method for measuring the protein expression level may be Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, But are not limited to, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assays, Complement Fixation Assays, FACS and protein chips.

As used herein, the term " patient sample " refers to a tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine that differs from the control in the expression level of the NUPR1 gene which is a biomarker for diagnosing malignancy. But are not limited to, the same sample.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer that has undergone mitochondrial function comprising an NUPR1 protein expression or activity inhibitor as an active ingredient. Preferably, the cancer may be liver cancer, but is not limited thereto.

Specifically, the pharmaceutical composition can inhibit the expression of granulin (GRN) protein and inhibit invasiveness of cancer cells.

Preferably, the NUPR1 protein expression inhibitor may be an antisense nucleotide complementary to the mRNA of the NUPR1 gene, a small interfering RNA (siRNA) or a short hairpin RNA (shRNA) The shRNA may be of SEQ ID NO: 1 or SEQ ID NO: 2, and the siRNA may be of SEQ ID NO: 3 or SEQ ID NO: 4, but is not limited thereto.

Preferably, the NUPR1 protein activity inhibitor may be a compound, a peptide, a peptide mimetic, an aptamer, an antibody or a natural product that specifically binds to the NUPR1 protein, but is not limited thereto.

Granulin (GRN) of the present invention may be, but is not limited to, NCBI Acceesion Number AAA58617.1 (protein) or NC000017.11 (gene).

The term "antisense nucleotide " in the present invention means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and binds to a complementary sequence in mRNA to inhibit translation of mRNA into a protein .

The term "small interfering RNA (siRNA)" in the present invention means a nucleic acid molecule capable of mediating RNA interference or gene silencing. Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method.

The term "short hairpin RNA (shRNA)" in the present invention refers to an oligonucleotide synthesizing oligonucleotides connecting 3-10 base linkers between the sense of the target gene siRNA sequence and the complementary nonsense, Or by shRNA insertion into retroviruses such as lentivirus and adenovirus, the short hairpin RNA with a looped hairpin structure is produced and converted into siRNA by intracellular Dicer to produce an RNAi effect It says. The shRNA shows a relatively long-term RNAi effect as compared to siRNA.

The term "Peptide Mimetics" in the present invention is a peptide or non-peptide that inhibits the binding domain of the NAG-1 protein leading to NUPR1 activity.

In the present invention, the term "Aptamer" is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure and capable of binding to a target molecule with high affinity and specificity. Aptamers are comparable to monoclonal antibodies due to their inherent high affinity (usually pM levels) and their ability to bind to target molecules with specificity, and there is a high likelihood of being an alternative antibody, especially as a "chemoantibody".

The term "antibody" in the present invention can be used either as a product prepared through NUPR1 injection or as a product purchased commercially. In addition, the antibody includes a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope.

The polyclonal antibody can be produced by a conventional method of injecting the above NUPR1 into an animal and collecting blood from the animal to obtain serum containing the antibody. Such polyclonal antibodies can be purified by any method known in the art and can be made from any animal species host such as goat, rabbit, sheep, monkey, horse, pig, cow, dog, etc. Monoclonal antibodies Can be prepared using any technique that provides for the production of antibody molecules through the culture of continuous cell lines. Such techniques include, but are not limited to, hybridoma technology, human B-cell line hybridoma technology, and EBV-hybridoma technology.

The pharmaceutical composition of the present invention may contain a chemical substance, a nucleotide, an antisense, an siRNA oligonucleotide and a natural product extract as an active ingredient. The pharmaceutical composition or combination preparation of the present invention may be prepared by using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the active ingredients. Examples of the adjuvants include excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants , A lubricant or a flavoring agent may be used. The pharmaceutical composition of the present invention may be formulated into a pharmaceutical composition containing at least one pharmaceutically acceptable carrier in addition to the active ingredient for administration. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile water and sterile water suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

Pharmaceutical dosage forms of the pharmaceutical compositions of the present invention may be granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, suspending agents or injectable solutions or suspensions . The pharmaceutical compositions of the present invention may be formulated and administered in a conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, percutaneous, intranasal, inhalation, topical, rectal, &Lt; / RTI > The effective amount of the active ingredient of the pharmaceutical composition of the present invention means the amount required for prevention or treatment of the disease. Accordingly, the present invention is not limited to the particular type of the disease, the severity of the disease, the kind and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, body weight, general health status, sex and diet, Rate of administration, duration of treatment, concurrent medication, and the like. For example, in the case of an adult, the inhibitor of the present invention may be administered at a dose of 0.1 ng / kg to 10 g / kg when the compound is administered once to several times a day, a polypeptide, In the case of protein or antibody, 0.1 ng / kg to 10 g / kg, antisense nucleotide, siRNA, shRNAi or miRNA can be administered at a dose of 0.01 ng / kg to 10 g / kg.

In addition, the present invention provides a method for testing a cancer cell, comprising the steps of: Measuring the level of expression or activity of NUPR1 protein in cancer cells in contact with the test substance; And selecting a test substance having a decreased degree of expression or activity of the NUPR1 protein as compared to a control sample. Preferably, the cancer may be liver cancer, but is not limited thereto.

The term "test substance" used in reference to the screening method of the present invention refers to an unknown candidate substance used in screening in order to examine whether it affects the expression amount of a gene or affects the expression or activity of a protein. do. Such samples include, but are not limited to, chemicals, nucleotides, antisense-RNA, siRNA (small interference RNA) and natural extracts.

As used herein, the term " cancer deficient in mitochondria "," cancer deficient in mitochondria ", or " mitochondrial deficient cancer " means that the ability of the mitochondrial to produce ATP is decreased in cancer cells. On the other hand, it has been reported that mitochondrial dysfunction promotes cancer metastasis in various cancer types including breast cancer, stomach cancer or liver cancer (PLoS One 2013; 8: e61677, Biochim Biophys Acta 2012; 1820: 1102-1110, PLoS One 2013; : e69485).

Hereinafter, the present invention will be described in detail with reference to embodiments which do not limit the present invention. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

< Experimental Example >

The following experimental examples are intended to provide experimental examples that are commonly applied to the respective embodiments according to the present invention.

1. Establishment of cell culture and mitochondrial deficiency conditions

Human liver cancer cells (SNU-354, SNU-387 and SNU-423) were purchased from Korean Cell Line Bank (Seoul, Korea) and 10% GIBCO ^™ fetal bovine serum (FBS; Invitrogen) and GIBCO ^™ antibiotics Were incubated at 37 [deg.] C in a 5% CO ₂ humidified incubator in an added GIBCO ^TM RPMI1640 medium (Invitrogen, Carlsbad, CA). Chang cell clones were isolated by single cell dilution and Chang cell expansion (ATCC, Rockville, Md.). Chang clones with strong hepatic characteristics (Ch-L), which were verified by confirming liver-specific expression of albumin and carbamoyl-phosphate synthase-1, were used in the present invention. Ch-L clone was GIBCO ^TM Dulbecco's modified Eagle's medium with a 10% FBS was added GIBCO ^TM; cultured at (DMEM Invitrogen).

Three other mitochondrial deficiency conditions were established. For 'tumoral defect', mitochondrial deficient hepatocytes (SNU-354 and SNU-423) were used. The 'functional defect' condition is a condition in which the Ch-L clone is treated with a positive inhibitor of rotenone (complex I inhibitor), TTFA (complex II inhibitor), antimycin A (complex III inhibitor) and oligomycin complex V inhibitor) for 12 hours. The Rho0 clone of MDA-MB435 deficient in mitochondrial DNA (mtDNA) was obtained from Singh KK and used as a 'genetic defect' condition.

2. Human HCC Specimen

HCC tumors and surrounding tissues were obtained from 23 HCC patients (aged 34-70 years) who visited Ajou University Hospital from August 2008 to January 2010, and received consent from the Ajou University Bioethics Committee. None of the patients participating in the present invention received preoperative chemotherapy or radiotherapy.

3. Gene expression profiling and data analysis

To obtain the biotinylated cDNA, the total RNA was amplified and separated according to the manufacturer's instructions using the Ambion Illumina RNA amplification kit (Ambion, Austin, Tex.). Specifically, 550 ng of total RNA was reverse transcribed into cDNA using oligo-dT primers. Double strand cDNA was synthesized, and in vitro vitro ) and labeled with biotinylated dNTPs. The labeled cDNA samples (750 ng) were each hybridized with a human HT-12 expression v.4 bead array and detection of the analytical signal was performed according to the manufacturer's instructions (Illumina, Inc., San Diego, Calif.). The raw data was filtered with a detection value of p-value <0.05 and further processed by log2 conversion and quartile normalization. Gene ontology analysis and signal path analysis were performed using DAIVD software. The enrichment scores (ES) were calculated by applying the non-parametric Kolmogorov-Smirnov test analysis in gene set enrichment analysis to identify identified gene characteristics for each patient. -log10 Converted p-values were used as ES and significance of ES was measured by p <0.05. For clinical validation, a set of two independent cohort 1 (GSE4024, GSE1898, n = 139) and cohort 2 (GSE14520, n = 247) HCC gene expression profile data were obtained in the Gene Expression Omnibus (GEO) And gene and array centering. All data processing and survival analyzes were performed using R / Bioconductor packages.

4. Cell Oxygen Consumption Rate ( cellular oxygen consumption rate ; OCR ) Measure

To observe mitochondrial respiratory activity, OCR was measured using a Seahorse XF24 analyzer (Seahorse Bioscience Inc., MA).

5. Cellular invasion analysis

Cellular invasion assays were performed using Transwell ^TM Permeable Supports (8-μm pore size; Corning, Acton, MA) with pre-coated 7% Growth Factor Reduced BD Matrigel ^™ Matrix (Becton Dickinson Labware, Franklin Lakes, NJ) Respectively.

6. NUPR1 shRNAs Production of cell clones stably expressing

To produce recombinant lentiviruses bearing NUPR1 shRNAs, Lipofectamine ^TM (Invitrogen), 293T virus packaging cells were transfected with a pLKO.1-puro plasmid containing the NUPR1 shRNA sequence (Sigma-Aldrich, Saint Louis, MI). The NUPR1 shRNA sequence is as follows. NUPR1 # 1: 5'-CCGGGGATGAATCTGACCTCTATACCTCGAGCTATAGAGGTCAGATTCATCCTTTTTG (SEQ ID NO: 1), NUPR1 # 2: 5'-CCGGTGGACACTACACCCAGCAATACTCGAGTATTGCTGGGTGTAGTGTCCATTTTTG (SEQ ID NO: 2), the negative control group: 5'-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT. Three days after transfection, medium containing recombinant lentivirus was collected and filtered through a 0.45 μm filter unit (Milipore corp., UFC 920008). To promote infection, polybrene (8 μg / ml, Sigma-Aldrich) was added to the filtered medium and stored at 80 ° C. Cells were infected with recombinant lentivirus and clones expressing shRNAs were selected with 8 μg / ml puromycin (Sigma-Aldrich).

7. Recombination cDNA Plasmid production and transfection

To prepare pcDNA3- NUPR1- HA and pcDNA3- GRN- HA, the traditional cloning method was used. Briefly, target cDNAs were amplified by RT-PCR, with primer set as follows. NUPR1: 5'-TGGATCCACCATGGCCACCTTCCCA and 5'-TCTCGAGGCGCCGTGCCCCT, GRN: 5'-TGAATTCACCATGTGGACCCTGGTG and 5'-TCTCGAGCAGCAGCTGTCTCAAG. The entire cDNAs of the Ch-L clones were used as templates for NUPR1 and commercial pCMV-SPORT6- GRN Plasmid (Korea Human Gene Bank, Daejeon, Korea) was used as a template for GRN . NUPR1 The cDNA fragment was inserted between the BamHI and XhoI sites of the pcDNA3-HA vector, and GRN The cDNA fragment was inserted between the EcoRI and XhoI sites. The inserted cDNA fragments were confirmed by DNA sequencing.

To introduce the plasmid into the cells, the cells were transfected with plasmids using FuGENE HD (Roche Diagnostics, Indianapolis, Ind.) According to the manufacturer's instructions.

8. Intracellular siRNA Introduction of

In order to introduce a targeted siRNAs into cells, using Oligofectamine ^TM Reagent (Invitrogen) according to the manufacturer's instructions, cells were transfected with siRNA duplexes. Target siRNAs were prepared from Bioneer (Seoul, Korea) and the sequence is as follows. NUPR1 # 1: 5'-GGAAACUGGUGACCAAGCU (SEQ ID NO: 3), NUPR1 # 2: 5'-CAGACAAAGCGUUAGGAGA (SEQ ID NO: 4), NFIX # 1: 5'- CUCUACAAGUCGCCUCAGU, NFIX # 2: 5'- ACUGAGGCGACUUGUAGAG, NFE2L1 # 5'-GAGAACGGACGACCCUACU, NFE2L1 # 2: 5'-GACGUGGAUACUUACCUGA, GRN # 1: 5'-CACAAGCCUUGAAGAGAGA, GRN # 2: 5'-GGACAGUACUGAAGACUCU and negative control group: 5'-CCUACGCCACCAAUUUCGU.

9. Promoter - Luciferase Reporter Plasmid Preparation and Promoter Analysis

A human GRN promoter region of 2895 bps (-2894 to +58, NG_007886) was cloned by targeted PCR on Ch-L genomic DNA, and the primer set used was as follows. Gt; The amplified GRN promoter site was inserted between the BglII and MluI sites of the pGL3-basic vector (Promega, Fitchburg, Wis.). After production, the insert promoter was confirmed by DNA sequencing.

To observe the GRN promoter activity, cells were incubated with FuGENE HD reagent for a total of 1 μg DNA (700 ng pcDNA3 or pcDNA3-NUPR1-HA, 250 ng cloned reporter plasmid and 50 ng thymidine kinase promoter-derived Renilla luciferase Plasmid). Two days later, the luciferase activity of the cell extracts was measured with a Synergy 2 Multi-Mode Reader (BioTek Instruments, Inc., Winooski, VT) according to the protocol provided with the Dual-Luciferase Reporter Assay System (Promega). The luciferase activity was normalized by renilla luciferase activity.

10. Chromatin Immunoprecipitation ( Chromatin immunoprecipitation ; ChIP ) Method

The ChIP assay was performed with slight modification of the ChIP Assay kit protocol (Upstate Biotechnology Inc., Lake Placid, NY). Briefly, to stably cross-link the genomic DNA and DNA-interacting proteins, the cells were treated with 1% formaldehyde. After cell lysis, the lysate was briefly sonicated to cut the genomic DNA and centrifuged at 13,000 rpm for 10 minutes. One aliquot was left for the input control and the remaining fractions were applied to ChIP using NUPR1 antibody and protein-G agarose bead. The eluted DNA was purified using a DNA extraction kit (Inclone Biotech, Seoul, Korea), and the specific promoter region was amplified by the following primer set. Region 1: 5'-CAGAGGAAGGCTCTG and 5'-CCTGGAATGCTGTGTT, Site 2: 5'-CTGATTGTAATGATGCTGC and 5'-ATTACAGGCATGAGCCAC, Site 3: 5'-GACTAGTACTAGGTCCTCAG and 5'- GCCTTCGAGGAATTGATATG, Site 4: 5'-CTGTCCTGCTGAGCAC and 5'- AGGTCAATAGTGCTGAG, Site 5: 5'-GTTGTTGAGTCTCAGCAC and 5'-CAGCGGATAAGACACCTG.

11. Measurement of intracellular calcium level

Fluo-3 (Molecular probe) fluorogenic probe was used to measure cytoplasmic calcium levels. Briefly, cells were incubated at 37 ° C for 20 min in media containing 2.5 μM Fluo-3. The stained cells were washed, resuspended in PBS, and analyzed with a flow cytometer (FACS Vantage, Becton Dickinson Corp.). Mean values of random fluorescence units of 10,000 cells were obtained and expressed as a percentage compared to the control.

12. Quantitative real-time RT -PCR ( Quantitative real - time RT - PCR ; qRT - PCR )

Total RNAs were isolated using Trizol (Invitrogen) and total cDNAs were prepared using AMV reverse transcriptase (Promega). PCR was carried out 50 times using 95 ° C for 15 seconds, 58 ° C for 30 seconds and 72 ° C for 20 seconds using THUNDERBIRD ^™ SYBR ^™ qPCR Mix (Toyobo Co., Ltd., Osaka, Japan). The PCR primer set produced by Bioneer is as follows. NUPR1, 5'-CTGGATGAATCTGACCTCTA and 5'-CGCTTCTTCCTCTCTGAATT; NFIX 5'-AGGAGATGCGGACATCAAAC and 5'-TGTTGTAGTAGCTGGGACTC; NFE2L1, 5'-CTGCTAGTGGATGGAGAGA and 5'-GCTTCTGTTATGCTGGAAATG; GRN, 5'-TTTACCGTCTCAGGGACTT and 5'-GGGCATTCGAACTGACTATC; ß-actin, 5'-CCTTCCTGGGCATGGAGTCCTGT and 5'-GGAGCAATGATCTTGATCTTC. Target mRNA expression was normalized by β-actin mRNA levels.

13. Western Blat analysis

Western blot analysis was performed according to standard methods. NUPR1 (sc-23283), GRN (sc-377036) and b-actin (sc-1616) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, Tex.). Antibodies to hemagglutinin (HA, 2367) were purchased from Cell Signaling Technology, Inc. (Danvers, MA). Antibodies to GAPDH (LF-PA0018) were purchased from AbFrontier (Seoul, Korea). Antibodies to NDUFA9 (A21344) of complex I, flavoprotein (A11142) of complex II, UQCRC2 (A11143) of complex III, MTCOII (A6404) of complex IV and ATP5A1 (A21350) of complex V were obtained from Molecular Probes Corp. (Eugene, OR).

< Example 1> Mitochondrial respiratory deficiency in liver cancer cells - Reprogramming Character analysis

First, the present inventors examined the mitochondrial respiratory status and cytopathic activity of three different liver cancer cell lines (SNU387, SNU354, and SNU423). Ch-L clones were isolated and found to have liver-specific genes. The clone was used as a control for active mitochondria. SNU387 cells have OCR activity similar to Ch-L, whereas SNU354 and SNU423 cells have decreased OCRs, indicating mitochondrial respiratory deficiency (FIG. 1A). Mitochondrial In order to confirm breathing deficiency, the levels of expression of several mitochondrial complex proteins (I, II, III and IV) were observed. SNU354 and SNU423 expressed the mitochondrial complex protein at levels lower than Ch-L and SNU387 (Fig. 1B). To confirm the association of mitochondrial deficiency with malignant liver cancer, invasiveness was observed. As expected, cells deficient in mitochondria (i.e., SNU354 and SNU423 cells) were more invasive than SNU387 and Ch-L cells (Fig. 1C). Taken together, these results show that SNU354 and SNU423 cells have cancer cell invasion associated with mitochondrial respiratory impairment, which may be a suitable model for studying the role of mitochondrial deficiency in cancer progression.

Gene expression profiling was performed on SNU354 and SNU423 cells to study transcriptional volume regulation associated with mitochondrial damage in hepatoma cells. Differential expression of the levels of Ch-L and SNU387 cells at cut-off levels 1.4 fold Were identified. A total of 1,301 genes were up-regulated and 1,473 genes were down-regulated (Fig. 1D), which they named the 'tumoral defect' gene. Functional gene set enrichment analysis showed that genes related to cell migration and cytoskeleton organization were clearly up-regulated in SNU354 and SNU423 cells (Figure IE) , Indicating that up-regulated genes are involved in the acquisition of aggressive phenotypes and are regulated by mitochondrial deficiency.

< Example 2> CMD Analysis of genes

To select genes directly regulated by mitochondrial respiration deficiency from 1,301 up-regulated genes, we established two additional mitochondrial deficient cell conditions: (1) exposure to several pharmacological mitochondrial respiratory inhibitors (2) a 'genetic defect' using ρ0 cells deficient in mtDNA. As a result of gene expression profiling of direct functional deficiency conditions, 131 up-regulated genes and 118 down-regulated genes were common for direct respiratory depression (Figure 2A). Comparison of gene expression between Rho0 cells and the parental MDA-MB435 cell line revealed 1,760 up-regulated genes and 1,604 down-regulated genes in Rho0 (Fig. 2B). Three independent mitochondrial deficiency model (tumor deficiency, deficient function and genetic deficiency) was, after ten CMD gene (NFIX, SEL1L3, NFE2L1, PABPC1L, NUPR1, HINT3, PSPH, TGFB1, PPP1R15A comparison And TMEM49 ) (Fig. 2C). By independent stimulation in liver cancer cells, these 10 genes appear to be directly inducible for mitochondrial damage.

To confirm the clinical significance of the CMD genes, we used two independent liver cancer cohorts (cohort 1 (GSE4024, n = 139) and cohort 2 (GSE14520, n = 247) We analyzed the association between clinical outcomes such as overall survival (OS) and recurrence-free survival (RFS). Patients who were stratified based on enrichment scores (ES) of CMD genes (ES> 1.3, p <0.05) showed that patients with increased expression of CMD genes had lower OS (cohorts 1 and 2 0.0 &gt; p = 0.025 < / RTI > and p = 0.0005) and RFS ( p = 0.008 and p = 0.0002 for cohorts 1 and 2, respectively) (Figs. 2D and 2E). These results show significant prognostic value of CMD characteristics that can play a central role in HCC progression.

< Example 3> Liver cancer cells Invasive Regulated NUPR1 , NFIX And NFE2L1

CMD genes include three transcription regulators (TR), NUPR1 , NFIX and NFE2L1 . Thus, the present inventors predicted that these genes would play an important role in regulating the invasive activity of hepatocellular carcinoma cells by inducing an additional secondary activator as a major first-order reaction gene. After confirming the level of mRNA expression of three TRs in liver cancer cells using qRT-PCR (Fig. 3A), we performed cell-invasion analysis after siRNA-mediated knockdown to confirm the association of TRs in invasiveness of cancer cells Respectively. The siRNA-mediated knockdown of TRs significantly reduced the invasive activity of SNU354 cells (Figure 3B and Figure 3C). The knockdown effects of individual TR-specific siRNAs were verified by qRT-PCR. In addition, continuous inhibition of TRs by shRNAs did not change the cell growth rate, but the cellular invasion activity was significantly reduced. These results indicate that the three TRs are probably the major primary factors in inducing mitochondrial deficiency responses that regulate hepatocellular invasiveness by synthesizing secondary working molecules.

Of the three CMD TRs, NUPR1 is often mentioned in malignant tumor metastasis and chemotherapy tolerance. However, a direct association between NUPR1 and mitochondrial deficiency is not clear. Accordingly, the present inventors sought to reveal the molecular relationship between NUPR1 and mitochondrial deficiency. Calcium and ROS release from damaged mitochondria are known as major retrograde signal initiators. However, when the Ch-L clone was exposed to exogenous H ₂ O ₂ (200 μM) for 6 hours, NUPR1 mRNA was not induced and only mitochondrial deficiency induced by exogenous ROS after 3 days of exposure increased, Is not a direct modulator of the NUPR1 transcription. Therefore, the present inventors confirmed the involvement of Ca ⁺⁺ in NUPR1 expression. Invasive SNU liver cancer cells (SNU354 and SNU423 cells) deficient in mitochondria were more cytosolic Ca ⁺⁺ than other mitochondrial activated cells (FIG. 3D). SNU387 cells are known to increase the cytoplasmic Ca ⁺⁺ in the (low cytosolic calcium levels with active mitochondria) when hayeoteul calcium ionophore A23187 in a 20 μM treatment, NUPR1 mRNA expression was significantly increased (Fig. 3E). In contrast, the removal of cytoplasmic Ca ⁺⁺ from SNU354 cells using 5 uM BAPTA-AM, a membrane-infiltrating calcium scavenger, significantly reduced NUPR1 mRNA expression (Fig. 3F). These results support the fact that NUPR1 transcription is regulated by mitochondrial deficiency-mediated Ca ⁺⁺ signaling in invasive SNU liver cancer cells.

< Example 4> NUPR1 As the main transcription downstream target Granular ( Granulin ; GRN)

Next, the present inventors sought to clarify which molecules are induced as downstream effectors of NUPR1 in the control of hepatocellular invasiveness. High NUPR1 SNU354 cells expressing < RTI ID = 0.0 > NUPR1 & siRNA and applied to gene expression profiling. siRNA-mediated NUPR1 Knockdown is NUPR1 mRNA levels were effectively reduced. Gene expression profiling revealed that 26 genes were down-regulated in common with a difference of 1.4-fold or more, indicating that these genes are putative downstream targets of NUPR1 (FIG. 4A). To pinpoint the most likely target of the 26 genes, a network analysis was performed using the GeneMAINA software running Cytoscape plugin (FIG. 4B). Of the possible target genes that are networked with NUPR1 , four genes ( LBP , DHRS3 , SDS And GRN ) were found to be the highest interacting partners, suggesting that NUPR1 And the functional relevance as a target.

Among the above four genes, GRN has recently been reported to be highly expressed in many cancer types including liver cancer and having tumorigenic activity. Thus, the present inventors have confirmed that GRN is a functional downstream target of NUPR1 . Knockdown of NUPR1 by shRNA resulted in a reduction in both GRN expression and mRNA and protein expression levels in invasive SNU354 cells (FIGS. 4C and 4D). Conversely, overexpression of NUPR1 in SNU387 cells was inhibited by GRN (Figure 4E), indicating that GRN is a downstream target of NUPR1 . In addition, we have determined that GRN expression is regulated by Ca ⁺⁺ -mediated NUPR1 expression. When A23187 was treated in SNU387 cells to increase intracellular Ca < ⁺⁺ > levels, GRN mRNA expression was clearly increased (Fig. 5A). SNU354 cells (high intracellular Ca < ⁺⁺ > level and GRN Gt; A23187 < / RTI > at the < RTI ID = 0.0 & The warrior was further improved, but it was minimal. However, increased levels of the degree of NUPR1 But not by knockdown (Figure 5B), indicating that GRN The expression of calcium-mediated NUPR1 Indicating that the warrior is involved.

In order to confirm the relevance of GRN to liver cancer cell invasion, GRN was knocked down in SNU354 cells and cell invasion analysis was performed. GRN knockdown by shRNA significantly reduced the invasive activity of SNU354 cells (Figure 5C). In contrast, overexpression of GRN in SNU354 cells further increased invasive activity, while NUPR1 The invasiveness inhibited by knockdown was effectively restored (Fig. 5D). These results NUPR1 - mediated liver cells are invasive GRN Expression. &Lt; / RTI >

< Example 5 > -2033 to -1547 GRN Binding to the promoter site GRN Regulate the warrior NUPR1

GRN To further elucidate the regulatory mechanism of NUPR1 in transcription, NUPR1 protein is expressed in the GRN promoter Activity. To measure the promoter activity, the present inventors produced a luciferase reporter plasmid having a promoter region of 2,894 bp upstream of the GRN containing a transcription initiation site (Fig. 6A). When SNU354 cells were transfected with the reporter plasmid, the GRN promoter site fully activated luciferase transcription. The activated GRN promoter activity was NUPR1 Significantly restrained by knockdown and restored by re-expression of NUPR1 (Figure 6B). To map the NUPR1 binding sites in the promoter region, ChIP analysis was performed with NUPR1 antibodies on four different GRN promoter sites using SNU354 cells (Fig. 6A, below). Compared to SNU387 cells, NUPR1 in SNU354 cells bound strongly to promoter site 2 and weakly to sites 1 and 3 (FIG. 6C). Therefore, the present inventors presumed that an important NUPR1 binding site exists in a specific portion (-2006 to -1590) in Site 2 that does not overlap Sites 1 and 3. NUPR1 is a high mobility group (HMG) I / Y that binds to an A / T-rich sequence [e.g., (TATT) n or (AATA) n], although the sequence involved in NUPRl binding is not clearly defined. - < / RTI > similar protein. Thus, we selected site 5 (-2033 to -1547) with 5 AATA or TATT units dispersed and 56% A / T-rich sequence and applied this to ChIP analysis. The site was sufficiently conjugated with NUPR1 (Fig. 6C). Finally, we found that the binding of site 5 and NUPRl in SNU354 cells was significantly reduced by NUPR1 knockdown (Fig. 6D). These results indicate that the increased expression of NUPR1 binds to the GRN promoter, particularly the -2033 to -1547 sites, to activate transcription of GRN .

< Example 6> Human HCC With mitochondrial deficiency NUPR1 And GRN Manifestation of With increasing relevance

Finally, we used 23 human HCC samples and their surrounding non-tumor tissues to determine whether mitochondrial deficiency is associated with increased co-expression of the gene. Mitochondrial activity was determined by the protein levels of complex I subunit and complex V subunit. The inventors have also found that glyceraldehyde (glyceraldehyde), a glyceraldehyde enzyme that has been reported to increase expression in cancers, has been shown to decrease the expression of mitochondria in glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Of the 23 cases, 8 showed GAPDH-induced mitochondrial deficiency, 4 showed increased mitochondrial expression, and 11 showed reduced total metabolic activity (FIGS. 7A and 7B). GRN And NUPR1 Screening of mRNA levels showed that only four cases increased co-expression (Figure 7B). Three of the four cases were closely related to mitochondrial deficiency (Figure 7C). These results suggest that the mitochondrial deficiency associated with sugar activation is NUPR1 And GRN , and also indicates that NUPRl may be involved in the expression of the sugar-sugar gene.

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Biomarker composition for diagnosing cancer with mitochondrial dysfunction of NUPR1 and method for diagnosing cancer using the same marker <130> ADP-2015-0147 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> NUPR1 shRNA <400> 1 ccggggatga atctgacctc tatacctcga gctatagagg tcagattcat cctttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> NUPR1 shRNA <400> 2 ccggtggaca ctacacccag caatactcga gtattgctgg gtgtagtgtc catttttg 58 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NUPR1 siRNA <400> 3 ggaaacuggu gaccaagcu 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NUPR1 siRNA <400> 4 cagacaaagc guuaggaga 19

Claims

Wherein the NUPR1 gene or a protein encoded by the gene is a mitochondrion-defective biomarker composition for diagnosing liver cancer.

delete

A primer or a probe that specifically binds to the NUPR1 gene, an antibody that specifically binds to the protein encoded by the gene, or a peptide having a binding domain specific to the protein.

delete

(1) measuring the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene from the liver cancer patient sample;
(2) comparing the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene with a control sample; And
(3) determining that the mRNA expression level of the NUPR1 gene or the expression level of the protein encoded by the gene is higher than that of the control sample, and determining the mitochondrial function-deficient liver cancer to be useful for diagnosing mitochondrial dysfunctional liver cancer Way.

delete

As an inhibitor of NUPR1 protein expression, mitochondrial-deficient liver cancer prevention comprising small interfering RNA (siRNA) or short hairpin RNA (shRNA) complementarily binding to mRNA of NUPR1 gene as an active ingredient, A pharmaceutical composition for therapeutic use.

delete

[Claim 7] The pharmaceutical composition according to claim 7, wherein the shRNA comprises SEQ ID NO: 1 or SEQ ID NO: 2.

The pharmaceutical composition according to claim 7, wherein the siRNA comprises SEQ ID NO: 3 or SEQ ID NO: 4.

delete

The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition inhibits the expression of granulin (GRN) protein.

The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition inhibits invasiveness of cancer cells.

Contacting the test substance to liver cancer cells;
Measuring the expression or activity level of NUPR1 protein in liver cancer cells in contact with the test substance; And
And selecting a test substance whose expression or activity level of the NUPR1 protein is decreased as compared with a control sample.

delete