KR20230074891A - Molecular marker based on nuclear genome sequence for discriminating Prunus mume, Prunus armeniaca or hybrid of Prunus mume and Prunus armeniaca and uses thereof - Google Patents

Abstract

The present invention relates to a chloroplast genome sequence-based molecular marker for distinguishing a plum and an apricot and uses thereof, wherein a primer set of the present invention can accurately distinguish the plum and apricot, which are used domestically as food and herbal medicine, and can be usefully used as an indicator for the cultivation of the plum and apricot and prevention of mixing of raw materials.

Description

Molecular marker based on nuclear genome sequence for discriminating Prunus mume, Prunus armeniaca or hybrid of Prunus mume and Prunus armeniaca and uses thereof}

The present invention relates to a nuclear genome sequence-based molecular marker for distinguishing plum, apricot or hybrids thereof and its use.

Prunus mume (Japanese apricot, plum) is a deciduous broad-leaved tree belonging to the Rosaceae family, and the drupe of the plum tree is called plum. Its place of origin is known as Sichuan, China, and is widely distributed in Korea, China, and Japan. The main production areas for plums in Korea include Suncheon, Gwangyang, Jeollanam-do, and Hadong-gun, Gyeongnam. Plums contain organic acids such as succinic acid, citric acid, and malic acid, as well as minerals such as sitosterol, relieve indigestion, recover from fatigue, reduce fever, and are rich in vitamin C. Therefore, it has been widely used as a health supplement or medicine since 3000 years ago. In particular, in 2015, 2829 tons of plums were processed and used in many parts such as concentrate, pickled plums, and plum wine, and various effects such as liver function improvement, adult disease prevention, and constipation prevention were reported.

Apricot ( Prunus armeniaca ; apricot) is a woody type belonging to the Rosaceae family, and its origin is Eastern Asia, and is widely distributed in China, Japan, and Europe, including Korea. Apricots contain components such as β-carotene, which is converted to vitamin A in the body, which is good for eye health and is effective in preventing aging. Apricots have a unique fragrance, so they are used fresh or processed into canned goods, jams, dried fruits, etc., and their seeds are called passers-by, and are widely used as an expectorant against cough in oriental medicine.

Plums and apricots are not only very similar in fruit and tree shape, but also very close related species that can hybridize with each other, so there are many hybrid varieties. It is disturbing the distribution order of agricultural products. Therefore, it is necessary to clearly distinguish plum and apricot fruits, but conventionally, plums and apricots are classified using plant morphological characteristics such as the shape of the core in the fruit, grooves on the surface of the core, and hole shape. It was difficult. In addition, it is more difficult to identify the species of the intermediate strains of plum and apricot, so the development of DNA markers that can clearly distinguish these species is urgently required.

With the recent rapid development in the field of molecular biology, various molecular biological methods are being used to classify plants between genera, species, or varieties within species. are being developed Differentiation by DNA analysis at the level of molecular biology has the advantage of being able to grasp a number of characteristics along with the quantitative level and excluding the influence of the environment. Through the recently developed next generation sequencing (NGS) technology, DNA information is compared to find differences, and the development of molecular markers using this makes it possible to accurately distinguish plums, apricots, or hybrids thereof. Among various types of molecular markers based on genome information, InDel (Insertion/Deletion) marker is a method of detecting polymorphisms using PCR (polymerase chain reaction) technology, which is a relatively simple and rapid method of obtaining results. The InDel marker is a molecular marker suitable for classifying varieties as it exists in various genotypes not only between species but also within species by using differences in nucleotide sequences inserted or deleted in nucleotide sequences.

On the other hand, Korean Patent Publication No. 2005-0106967 discloses 'a method for distinguishing plum from apricot fruit and a SCAR marker primer therefor', but based on the nuclear genome sequence for distinguishing plum, apricot or hybrids thereof of the present invention. Molecular markers and their uses are not described.

The present invention was derived by the above request, and the present inventor compared the genomic sequences between plums ( Prunus mume ), apricots ( Prunus armeniaca ) and hybrids of plums and apricots to compare the Prude_001688 gene in the nuclear genome (NCBI accession No. AP019297), a molecular marker based on a base sequence showing InDel (insertion/deletion) polymorphism was developed. In addition, as a result of preparing a primer set capable of amplifying the InDel molecular marker and performing PCR, it was confirmed that the primer set of the present invention can accurately distinguish between plums, apricots, and hybrids thereof. completed.

The present invention was derived from the above request, and the present inventors provided a primer set for distinguishing plum ( Prunus mume ), apricot ( Prunus armeniaca ) or a hybrid between plum and apricot including the oligonucleotide primer set of SEQ ID NOs: 1 and 2 composition is provided.

In addition, the present invention provides a kit for distinguishing hybrids between plums, apricots, or plums and apricots including the primer set composition.

In addition, the present invention comprises the steps of isolating genomic DNA from a plum or apricot sample; Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition; and detecting the product of the amplification step.

Using the primer set of the present invention, it is possible to accurately distinguish plums, apricots, or hybrids thereof used as food and herbal medicine in Korea, so it can be usefully used as an indicator for cultivation of plums and apricots and prevention of raw material mixing. .

Figure 1 shows the results of PCR using the InDel polymorphism-based primer set of the present invention (Table 2) on plums, apricots, and their hybrids.

In order to achieve the object of the present invention, the present invention provides a primer set composition for distinguishing plum ( Prunus mume ), apricot ( Prunus armeniaca ) or a hybrid between plum and apricot, including the oligonucleotide primer set of SEQ ID NOs: 1 and 2 .

The primers of the present invention are oligos composed of fragments of at least 15, at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequences of SEQ ID NOs: 1 and 2, depending on the sequence length of each primer. may contain nucleotides. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may include oligonucleotides consisting of segments of at least 17, at least 18, at least 19 contiguous nucleotides within the sequence of SEQ ID NO: 1. In addition, the primers may also include sequences added, deleted, or substituted in each of the nucleotide sequences of SEQ ID NOs: 1 and 2 that can bind to the amplification site. Among the SEQ ID NOs, odd-numbered oligonucleotide primers are forward primers, and even-numbered oligonucleotide primers are reverse primers.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow for the synthesis of extension products to begin. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use of the primer, such as temperature and ionic strength.

In this specification, oligonucleotides used as primers may include nucleotide analogs, such as phosphorothioates, alkylphosphorothioates, or peptide nucleic acids, or insert It may contain an intercalating agent.

The primer set of the present invention is designed to amplify a region showing an InDel (insetion/deletion) polymorphism between plums, apricots, and hybrids of plums and apricots, and the sequence showing the InDel polymorphism may consist of SEQ ID NO: 3, Not limited to this.

SEQ ID NO: 3 is a polymorphic nucleotide containing a nucleotide sequence of an insertion site. InDel polymorphism refers to a sequence that includes a case in which a length difference between varieties or species occurs because a part of a polynucleotide sequence is added or deleted in the middle. The polymorphic nucleotide sequence may be DNA or RNA. The InDel polymorphism base information is shown in Table 1, and the InDel polymorphism according to the present invention was confirmed to be located in the Prude_001688 gene region in the nuclear nucleotide sequences of plum, apricot, and hybrids of plum and apricot.

The present invention also provides a kit for distinguishing hybrids between plums, apricots, or plums and apricots containing the primer set composition.

In one embodiment of the present invention, the kit may further include a reagent for performing the amplification reaction, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, and a buffer. Not limited.

In one embodiment of the present invention, the kit may further include a user guide describing optimal reaction performance conditions. The guide is a printout that explains how to use the kit, for example, how to prepare reverse transcription buffer and PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also

Isolating genomic DNA from plum or apricot samples;

Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the oligonucleotide primer sets of SEQ ID NOs: 1 and 2; and

Detecting the product of the amplification step; provides a method for distinguishing plums, apricots, or hybrids of plums and apricots, including.

The method of the present invention includes the step of isolating genomic DNA from plum or apricot samples. As a method for isolating the genomic DNA, a method known in the art may be used, and for example, a CTAB method may be used or a Wizard prep kit (Promega) may be used. A target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and an oligonucleotide primer set according to an embodiment of the present invention as primers. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system), strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling material may be a material that emits fluorescence, phosphorescence or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence can be labeled with a detectable fluorescent labeling material. In addition, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution during PCR, radioactive is incorporated into the amplification product as the amplification product is synthesized, and the amplification product can be radioactively labeled. The oligonucleotide primer set used to amplify the target sequence is as described above.

In one embodiment of the present invention, the method for distinguishing the plum, apricot, or a hybrid of plum and apricot includes the step of detecting the product of the amplification step, wherein the detection of the product of the amplification step is DNA chip, gel electrophoresis , Capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement may be performed, but is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and for gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method is performed by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product, and then using a radioactivity measurement instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail through examples. It should be noted that the specific examples and examples below include some embodiments of the invention, but not all embodiments. It is obvious that the content of the invention disclosed by this specification is not limited to the specific embodiments described herein, and includes that a person skilled in the art can implement it in various ways in the technical field to which the present invention belongs. Therefore, it should be understood that the content of the invention disclosed in this specification is not limited to the specific embodiments described herein, and modifications and other embodiments thereof are also included within the scope of the claims.

Materials and Methods

1. Collection of genetic resources and DNA extraction of plums, apricots and their hybrids

The genomic DNA of a total of 24 individuals (collected from Cheongju, Gangneung, Gwacheon, and Hamyang), 12 plums, 4 apricots, and 8 hybrids of plum and apricot used in this experiment, was rapidly sampled using liquid nitrogen. After cooling and pulverizing in a mortar and pestle, it was extracted using a plant gDNA Extraction kit (Biomedic).

2. InDel marker development

The genomic sequences of 12 plums, 4 apricots, and 8 hybrids of plum and apricot were compared and analyzed through the CLC Main Workbewnch program (version 20), and the Prudu_001688 gene (NCBI accession No. AP019297) region of the plum nuclear genome It was confirmed that a 94 bp base sequence was inserted (Table 1), and a primer set for amplifying the InDel polymorphism was prepared (Table 2). Primer sets were prepared by adjusting conditions such as maximum length, minimum length, amplification product size, temperature, and GC ratio.

InDel polymorphic sequence information of plum GGTATGTTTTGCGCCATT GCATTACCCTTATTTCTTTATGTGACTGAGAACATTAAGCTATGCCAAAATTTTGTTGTCAGTAAAACTTTTTTATTTTATTATTACCAACCTGATCTGAGTCCAAG G TA T N T GGT TT AT T G GT TG AGA GTT CA T C ATT CCTCATA G TCT GT GAA T A GA AACCT G CTAATATGATAACATTACT AG GC TT G CA AA CATTGA TCA GGAGTGAGTTGAATTTTTAAATATATGAAGT TTGATACTGTCTCAATGTAAAAT AGGTGAAAGGTATGCAAG (SEQ ID NO: 3)

Bold and underlined: Primer positions.

Underline: the position where the 94 bp nucleotide sequence was inserted.

Primer set information of the present invention Primer name Sequence (5'→3') (SEQ ID NO) NC-InDel-19_Fwd GGTATGTTTTGCGCCATT (1) NC-InDel-19_Rev CTTGCATACCTTTCACCT (2)

3. DNA amplification using PCR

The extracted genomic DNA of plum, apricot or plum and apricot hybrid was diluted to 10 ng / μl, DNA 1 μl (DNA 10 ng), InDel marker 2 μl (forward primer 1 μl, reverse primer 1 μl), Taq mixture 10 μl and 7 μl of distilled water were mixed to make a total PCR reaction mixture of 20 μl. PCR was pre-denaturation at 95° C. for 3 minutes; The process of denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute was repeated a total of 35 times; Final extension was performed under conditions of 72° C. for 10 minutes. PCR amplification products were confirmed by electrophoresis on a 3% agarose gel.

Example. Distinction between plums and apricots using the InDel marker of the present invention

DNA samples of 12 plums, 4 apricots, and 8 hybrids of plums and apricots using the primer set in Table 2 prepared based on the InDel polymorphism between plums, apricots, and hybrids of plums and apricots PCR was performed as templates After performing, polymorphic pattern analysis was performed by electrophoresis on an agarose gel.

As a result, a 294 bp band was confirmed in the plum individual, a 200 bp band was confirmed in the apricot individual, and both 294 bp and 200 bp bands were confirmed in the hybrid individual of plum and apricot (Fig. 1) . Through this, it was found that the primer set based on the InDel polymorphism of the present invention is capable of accurately distinguishing plum, apricot or hybrids thereof.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Molecular marker based on nuclear genome sequence for discriminating Prunus mume, Prunus armeniaca or hybrid of Prunus mume and Prunus armeniaca and uses its <130> PN21391 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> artificial sequence <220> <223> primer <400> 1 ggtatgtttt gcgccatt 18 <210> 2 <211> 18 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 cttgcatacc tttcacct 18 <210> 3 <211> 294 <212> DNA <213> unknown <220> 223 <Prunus mume> <400> 3 ggtatgtttt gcgccattgc attaccctta tttctttatg tgactgagaa cattaagcta 60 tgccaaaatt ttgttgtcag taaaactttt ttattttatt attaccaacc tgatctgagt 120 ccaaggtatn tggtttattg gttgagagtt catcattcct catagtctgt gaatagaaac 180 ctgctaatat gataacatta ctaggcttgc aaacattgat caggagtgag ttgaattttt 240 aaatatatga agtttgatac tgtctcaatg taaaataggt gaaaggtatg caag 294

Claims (4)

A primer set composition comprising the oligonucleotide primer sets of SEQ ID NOs: 1 and 2, for distinguishing plums ( Prunus mume ), apricots ( Prunus armeniaca ) or a hybrid between plum and apricot. A kit for identifying hybrids between plums ( Prunus mume ), apricots ( Prunus armeniaca ) or plums and apricots, comprising the primer set composition of claim 1 . Isolating genomic DNA from plum or apricot samples;
Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the primer set composition of claim 1; and
Detecting the product of the amplification step; plum ( Prunus mume ), apricot ( Prunus armeniaca ) or a method for distinguishing between plum and apricot hybrids. The method of claim 3, wherein the detection of the product of the amplification step is performed through a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images