KR20220147920A - A RPA kit for detecting coronavirus and use thereof - Google Patents
A RPA kit for detecting coronavirus and use thereof Download PDFInfo
- Publication number
- KR20220147920A KR20220147920A KR1020210055045A KR20210055045A KR20220147920A KR 20220147920 A KR20220147920 A KR 20220147920A KR 1020210055045 A KR1020210055045 A KR 1020210055045A KR 20210055045 A KR20210055045 A KR 20210055045A KR 20220147920 A KR20220147920 A KR 20220147920A
- Authority
- KR
- South Korea
- Prior art keywords
- coronavirus
- primer
- present
- cov
- sars
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
Description
본 발명은 신종 코로나바이러스 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2)를 민감도 있게 검출할 수 있는 프라이머와, 선택적으로 프로브를 포함하는 검출용 RPA (Recombinant Polymerase Amplification) 키트에 관한 것이다.The present invention relates to a RPA (Recombinant Polymerase Amplification) kit for detection comprising a primer capable of sensitively detecting a novel coronavirus (Severe acute
코로나바이러스는 현대 문명에서 치명적인 감염병을 일으키는 대표적인 바이러스로 2019 년 12 월부터 중국 우한발 신종 코로나바이러스 감염증 (coronavirus disease 2019; COVID-19)이 전 세계로 확산되면서 감염자가 늘어나고 있으며, 치사율은 2020 년 3 월까지 집계된 자료에 따르면 5.6 %로 그나마 낮은 편이지만 전세계적으로 확진자가 폭증하는 중이며, 아직까지 예방 또는 치료 목적으로 승인된 백신이나 항바이러스제는 없다. 현재 유행하고 있는 코로나바이러스 감염증-19 (COVID-19)는 새로운 유형의 코로나바이러스인 중증 급성 호흡기증후군 코로나바이러스 2 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2)에 의한 호흡기 감염 질환으로, 현 사태를 통해서도 알 수 있듯이 신변종 바이러스의 유행은 인류에게 크나큰 문제를 야기하고 있다. 이는 보건의료 및 건강의 문제에 그치지 않고 세계 경제에 큰 파급 효과를 나타낼 정도로 신변종 바이러스는 인류 생존의 문제라고 할 수 있다. Coronavirus is a representative virus that causes a fatal infectious disease in modern civilization, and since December 2019, the number of infected people is increasing as the novel coronavirus disease 2019 (COVID-19) from Wuhan, China has spread around the world, and the fatality rate is 3 in 2020. According to data collected until May, it is the lowest at 5.6%, but the number of confirmed cases is increasing worldwide, and there are no vaccines or antiviral drugs approved for prevention or treatment yet. The currently prevalent coronavirus infection-19 (COVID-19) is a respiratory infection caused by a new type of coronavirus, Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). As can be seen from the situation, the outbreak of a new strain of virus is causing great problems for mankind. This is not only a problem of health care and health, but it can be said that a new strain of virus is a problem for human survival to the extent that it has a large ripple effect on the global economy.
현재, 코로나바이러스 감염증-19 (COVID-19)의 확진 여부는 일반 PCR을 통해 이루어지고 있어 진단 결과를 확인하기까지의 시간이 길어 의료진의 환자에 대한 상황 판단이 느린 문제점이 존재한다. 일반 PCR법은 통상적으로 여러 감염증의 진단에 사용되지만 최소 2시간 이상이 소요되며, 프라이머의 길이도 21 내지 24 bp로서 특이도, 민감도 면에서 떨어질 수 있으며, 초기에 진단하기 어렵고, 교차 반응이 일어나며, 결과의 해석에 숙련된 전문가가 필요하다는 단점이 있다.Currently, the confirmation of coronavirus infection-19 (COVID-19) is made through general PCR, so it takes a long time to confirm the diagnosis result, so there is a problem that the medical staff is slow in judging the patient's situation. The general PCR method is usually used for the diagnosis of various infections, but it takes at least 2 hours or more, and the length of the primers is 21 to 24 bp, which may decrease in specificity and sensitivity. However, there is a disadvantage that a skilled expert is required to interpret the results.
이에 본 발명자들은 재조합효소 중합효소 증폭 (recombinase polymerase amplification; RPA)법을 이용하여 비전문가도 손쉽게 보다 높은 정확도로 검출 가능하고 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 다양한 변이에 대응할 수 있는 서열의 프라이머 및/또는 프로브 세트를 포함하는 효과적인 진단용 키트를 고안하였다.Therefore, the present inventors can easily detect with higher accuracy even by non-specialists using the recombinase polymerase amplification (RPA) method and respond to various mutations of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). An effective diagnostic kit comprising a set of primers and/or probes of the sequence of the present invention was devised.
본 발명의 일 목적은 코로나바이러스의 검출을 위한 프라이머를 제공하는 것이다.One object of the present invention is to provide a primer for the detection of coronavirus.
본 발명의 다른 목적은 상기 프라이머에 프로브를 추가로 포함하는 코로나바이러스 검출용 조성물을 제공하는 것이다. Another object of the present invention is to provide a composition for detecting a coronavirus further comprising a probe in the primer.
본 발명의 또 다른 목적은 상기 프라이머 및 프로브를 포함하는 코로나바이러스의 검출용 키트를 제공하는 것이다. Another object of the present invention is to provide a kit for detecting a coronavirus comprising the primer and the probe.
본 발명의 또 다른 목적은 코로나바이러스의 감염 또는 감염 질환을 진단하기 위한 정보 제공 방법을 제공한다.Another object of the present invention is to provide an information providing method for diagnosing a coronavirus infection or infectious disease.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned will be clearly understood by those of ordinary skill in the art from the following description.
이하, 본원에 기재된 다양한 구현예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구현예는 이들 특이적 상세 사항 중 하나 이상, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구현예" 또는 "구현예"에 대한 본 명세서 전체를 통한 참조는 구현예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구현예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구현예" 또는 "구현예"의 상황은 반드시 본 발명의 동일한 구현예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구현예에서 어떠한 적합한 방법으로 조합될 수 있다.DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Various embodiments described herein are described below with reference to the drawings. In the following description, various specific details are set forth, such as specific forms, compositions and processes, and the like, for a thorough understanding of the present invention. However, certain embodiments may be practiced in conjunction with one or more of these specific details, or other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, references to "one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, the particular features, forms, compositions, or properties may be combined in any suitable manner in one or more embodiments.
명세서 내에 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.Unless otherwise defined in the specification, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
본 발명의 일 구현 예에 따르면, 서열번호 1 및 2 중 적어도 하나로 표시되는 코로나바이러스의 검출용 프라이머에 관한 것이다.According to one embodiment of the present invention, it relates to a primer for detecting a coronavirus represented by at least one of SEQ ID NOs: 1 and 2.
본 발명에서, 상기 "코로나바이러스 (coronavirus)"는 코로나바이러스과 (Coronaviridae)의 코로나바이러스아과 (Coronavirinae)에 4 개의 속 (알파, 베타, 감마, 델타)이 있으며, 유전자 크기 27 내지 32 kb의 RNA 바이러스로 사람과 동물의 호흡기와 소화기계 감염을 유발하는 것으로 알려져 있다. 주로 점막 전염, 비말 전파로 쉽게 감염되며, 사람은 일반적으로 경미한 호흡기 감염을 일으키지만 드물게 치명적인 감염을 일으키기도 하며, 소와 돼지는 설사, 닭은 호흡기 질환이 발생하기도 한다. 이는 하기 표 1의 분류로 나뉜다(질병관리본부, 2020). 4 개의 속 중에서 알파와 베타는 사람과 동물에게 감염이 되며, 감마와 델타는 동물에게만 감염되는 것으로 보고되고 있다. In the present invention, the "coronavirus (coronavirus)" has four genera (alpha, beta, gamma, delta) in the subfamily Coronavirinae of the Coronaviridae , and an RNA virus with a gene size of 27 to 32 kb. It is known to cause respiratory and digestive system infections in humans and animals. It is easily infected mainly through mucosal transmission and droplet transmission. Humans generally cause mild respiratory infections, but rarely fatal infections. Diarrhea in cattle and pigs, and respiratory diseases in chickens. It is divided into the classifications in Table 1 below (Centers for Disease Control and Prevention, 2020). Among the four genera, alpha and beta infect humans and animals, and gamma and delta are reported to infect only animals.
특히, 현재 사람 감염 코로나바이러스로는 하기 표 2의 7 종이 존재하며, 감기를 일으키는 유형(229E, OC43, NL63, HKU1)과 중증 폐렴을 일으키는 유형(SARS-CoV, MERS-CoV, SARS-CoV2)으로 나뉜다. In particular, there are currently 7 types of human-infecting coronaviruses in Table 2 below, the types that cause colds (229E, OC43, NL63, HKU1) and the types that cause severe pneumonia (SARS-CoV, MERS-CoV, SARS-CoV2) divided into
본 발명에서 상기 "중증 급성 호흡기증후군 코로나바이러스 2 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2)"는 코로나바이러스아과의 네 속의 코로나바이러스 중 베타 코로나바이러스에 속하는 것으로 인수공통 감염증에 해당하며, SARS-CoV-2로도 명명된다. 2019 년 12 월에 발생한 바이러스로, 사람 감염 7 종의 코로나바이러스 중 하나에 해당한다. 코로나바이러스 감염증-19 (Coronavirus disease 19; COVID-19)는 감염자의 비말(침방울)이 호흡기나 눈, 코, 입 등의 점막으로 침투될 때 전염되는 것으로 보고되고 있으며, 감염되면 약 2 내지 14 일의 잠복기를 거쳐 37.5 ℃ 이상의 발열, 기침 또는 호흡곤란 등의 호흡기 증상과 폐렴이 주된 증상으로 나타나며, 무증상 감염 사례도 존재한다. 질병관리본부에 따르면 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 유전자 염기 서열은 박쥐 유래 유사 코로나바이러스와 가장 높은 약 96 %의 상동성을 보이며, 메르스와는 약 60 %의 상동성을 보이고, 사스와는 약 79 %의 상동성이 나타난 것으로 보고되었다. In the present invention, the "severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)" belongs to the beta coronavirus among the four genus coronaviruses of the subfamily coronavirus and corresponds to a zoonotic infection, Also called SARS-CoV-2. The virus occurred in December 2019 and is one of seven types of coronaviruses that infect humans. Coronavirus disease 19 (COVID-19) is reported to be transmitted when droplets (saliva) of an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, and mouth. After the incubation period, respiratory symptoms such as fever, cough, or shortness of breath above 37.5 ℃ and pneumonia appear as the main symptoms, and there are cases of asymptomatic infection. According to the Korea Centers for Disease Control and Prevention, the gene sequence of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) shows the highest homology with bat-derived coronavirus with about 96% homology, and about 60% homology with MERS. , and about 79% homology with SARS was reported.
본 발명에서 코로나바이러스 게놈은 5' 캡 구조 및 3' 폴리 A 꼬리를 갖는 30 kb 이내의 단일 가닥 포지티브-센스 RNA로 이루어져 있다. 상기 게놈 RNA는 다 단백질 1a/1ab(pp1a/pp1ab)를 직접 번역하는 템플릿으로 사용되며, 비구조 단백질 (non-structural protein; nsp)을 인코딩하여 이중 막 소포 (double-membrane vesicles; DMV)에 복제-전사 복합체(replication-transcription complex; RTC)를 형성한다(J Virol. 2006; 80(12): 5927-5940.). 중첩된 서브 게놈 RNA (sgRNA) 세트는 불연속 전사 방식으로 RTC에 의해 합성되며, 이러한 서브 게놈 메신저 RNA (mRNA)는 일반적인 5'-리더 및 3'-말단 서열을 보유한다. 전사 종결 및 리더 RNA의 후속 획득은 오픈 리딩 프레임(open reading frames; ORF) 사이에 위치한 전사 조절 서열에서 발생한다. 이 마이너스 가닥 sgRNA는 서브 게놈 mRNA 생산을 위한 주형으로 사용된다. The coronavirus genome in the present invention consists of a single-stranded positive-sense RNA within 30 kb with a 5' cap structure and a 3' poly A tail. The genomic RNA is used as a template to directly translate the polyprotein 1a/1ab (pp1a/pp1ab), and encodes a non-structural protein (nsp) and replicates in double-membrane vesicles (DMV) -forms a replication-transcription complex (RTC) (J Virol. 2006; 80(12): 5927-5940.). Sets of overlapping subgenomic RNAs (sgRNAs) are synthesized by RTC in a discontinuous transcriptional manner, and these subgenomic messenger RNAs (mRNAs) possess common 5′-leader and 3′-terminal sequences. Transcription termination and subsequent acquisition of leader RNA occurs in transcriptional regulatory sequences located between open reading frames (ORFs). This negative-stranded sgRNA is used as a template for subgenomic mRNA production.
본 발명에서 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2) 게놈은 단백질 생산이 가능한 유전체 영역에 해당하는 ORF1a 및 ORF1b 유전자를 함유하며, 말단은 4 가지 주요 구조 단백질로서 스파이크(spike; S), 막(membrane; M), 외피(envelope; E) 및 뉴클레오캡시드(nucleocapsid; N) 단백질을 인코딩한다. 이외에도, 3a, 6, 7a/b, 8 또는 10 단백질과 같은 특수 구조 및 보조 단백질을 코딩하기도 한다.In the present invention, the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome contains ORF1a and ORF1b genes corresponding to genomic regions capable of protein production, and the ends are four major structural proteins with a spike (S). , membrane (M), envelope (E) and nucleocapsid (N) proteins. In addition, they encode special structures and helper proteins, such as 3a, 6, 7a/b, 8 or 10 proteins.
본 발명에서 상기 "검출"은 코로나바이러스, 바람직하게는 중증 급성 호흡기증후군 코로나바이러스 2 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2)의 감염 여부를 판정하는 것으로, 보다 구체적으로 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 감염 여부를 모니터링하여 진단하는 것을 포함하는 개념이다.In the present invention, the "detection" is to determine whether or not a coronavirus, preferably, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is infected, and more specifically, severe acute respiratory syndrome It is a concept that includes monitoring and diagnosing whether coronavirus 2 (SARS-CoV-2) is infected.
본 발명에 있어서, "프라이머"는 짧은 자유 3' 말단 수산화기 (free 3' hydroxyl group)를 가지는 핵산 서열로서, 카피하고자 하는 핵산 가닥에 상보적인 단일 가닥의 올리고뉴클레오티드 서열을 의미한다. 상보적인 주형 (template)과 염기 쌍 (base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하여 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 프라이머는 적절한 완충 용액 및 온도에서 중합반응을 위한 시약 (DNA 중합효소 또는 역전사효소) 및 상이한 4 가지 NTP (nucleoside triphospate)의 존재 하에 DNA 합성을 개시할 수 있다. 또한, 프라이머 디자인을 수행할 때에는 표적 DNA의 염기서열의 반복성 정도에 따라서 목표 DNA 내의 유사한 다른 염기서열에서 잘못된 결합이 일어나는 것을 방지하기 위해서 프라이머 염기서열이 매우 주의 깊게 선택되어야 한다. 적절한 프라이머 디자인을 위해 통상적으로 사용되는 방법의 일 예로써 BLAST 검색법이 있으며, 프라이머 자체뿐 아니라 뉴클레오티드 서열도 BLAST에 의해 검색될 수 있다. NCBI 웹도구인 Primer-BLAST 역시 프라이머 디자인에 자주 이용되고 있으며, 기타 상업적인 소프트웨어 도구들도 프라이머 디자인에 이용될 수 있다.In the present invention, "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, and refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied. It can form a base pair with a complementary template and serve as a starting point for template strand copying and thus serve as a starting point for the synthesis of extension products. A primer can initiate DNA synthesis in the presence of a reagent for polymerization (DNA polymerase or reverse transcriptase) and four different nucleoside triphospates (NTPs) in an appropriate buffer solution and temperature. In addition, when performing primer design, the primer sequence must be selected very carefully in order to prevent erroneous binding to other similar nucleotide sequences in the target DNA according to the degree of repeatability of the nucleotide sequence of the target DNA. As an example of a method commonly used for proper primer design, there is a BLAST search method, and not only the primer itself but also the nucleotide sequence may be searched by BLAST. Primer-BLAST, an NCBI web tool, is also frequently used for primer design, and other commercial software tools can also be used for primer design.
본 발명의 프라이머는 프라이머의 크기, Tm 값, 프라이머의 GC 함량, 프라이머 내의 자가-상보적 서열(self-complementary sequence)에 의한 프라이머의 복합체(dimer) 형성 방지, 같은 염기 서열의 3 회 이상 반복금지 등을 충분히 고려하고, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 특정 유전자의 민감도와 특이도를 최대화할 수 있도록 세심하게 디자인된 것을 포함한다.The primer of the present invention prevents the formation of a primer complex (dimer) by the size of the primer, the Tm value, the GC content of the primer, the self-complementary sequence in the primer, and prohibits repeating the same nucleotide sequence three or more times. Including those carefully designed to maximize the sensitivity and specificity of a specific gene of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
본 발명의 상기 프라이머는 기본 성질을 변화시키지 않은 추가의 특징을 혼입할 수 있다. 즉 핵산 서열이 당해 분야에 공지된 많은 수단을 이용하여 변형될 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 뉴클레오티드의 하나 이상의 동족체로의 치환 및 포스포네이트, 포스포트리에스테르, 포스포로아미데이트 또는 카바메이트 등의 하전되지 않은 연결체나 포스포로티오에이트 또는 포스포로디티오에이트 등의 하전된 연결체로의 뉴클레오티드의 변형이 가능하다. The primers of the present invention may incorporate additional features that do not change their basic properties. That is, the nucleic acid sequence can be modified using a number of means known in the art. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of a nucleotide and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates or phosphorothioates or phosphorodithioates. Modification of nucleotides into charged linkages such as .
본 발명에서 "핵산"은 단일가닥 또는 이중 가닥의 올리고뉴클레오티드 또는 폴리뉴클레오티드를 포함하는 것으로, 임의의 형태의 하나 이상의 뉴클레오티드를 포함하는 RNA 또는 DNA 분자 또는 그 유사체 및 그 유도체일 수 있다. 또한, 본 발명의 프라이머 세트가 사용되는 신종 코로나바이러스의 핵산은 신종 코로나바이러스 유래의 RNA, 예를 들면 유전체의 전부 또는 일부를 포함하고, 또는 이에 상응하는 DNA를 포함하는 것일 수 있다.In the present invention, "nucleic acid" includes single-stranded or double-stranded oligonucleotides or polynucleotides, and may be RNA or DNA molecules containing one or more nucleotides in any form, or analogs thereof, and derivatives thereof. In addition, the nucleic acid of the novel coronavirus to which the primer set of the present invention is used may include RNA derived from the novel coronavirus, for example, all or part of a genome, or a DNA corresponding thereto.
본 발명의 상기 프라이머는 올리고뉴클레오티드 및 폴리뉴클레오티드와 혼용되어 사용될 수 있으며, 핵산(RNA 또는 DNA), 앱타머 등을 포함할 수 있다. The primers of the present invention may be used in combination with oligonucleotides and polynucleotides, and may include nucleic acids (RNA or DNA), aptamers, and the like.
본 발명에 있어서, 상기 프라이머는 짧은 서열의 뉴클레오티드인 올리고뉴클레오티드로서 목적하는 DNA 또는 RNA의 반대편 가닥의 상보적 위치에 특이적으로 부착되어 유전자의 증폭 (amplification)을 개시하는 역할을 하는 올리고뉴클레오티드일 수 있다. In the present invention, the primer is an oligonucleotide that is a short sequence of nucleotides and is specifically attached to the complementary position of the opposite strand of the desired DNA or RNA, and may be an oligonucleotide serving to initiate amplification of a gene. have.
본 발명의 상기 프라이머는 코로나바이러스, 바람직하게는 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 타겟 유전자의 전부 또는 일부에 상보적으로 결합함으로써 상기 코로나바이러스를 검출할 수 있다. The primer of the present invention can detect the coronavirus by complementary binding to all or part of a target gene of a coronavirus, preferably, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
본 발명의 상기 프라이머는 표적 핵산의 상응하는 부분으로, 즉, 상기 유전자를 타겟으로 하여 특이적으로 결합하는 올리고뉴클레오티드일 수 있으며, 상기 유전자의 전부 또는 일부와 최소 70 %의 상보성, 특히 80 % 상보성, 더욱 90 % 상보성, 더더욱 특히 95 %, 96 %, 97 %, 98 %, 99 % 또는 100 % 상보성을 가질 수 있으나, 이에 제한되는 것은 아니다.The primer of the present invention may be a corresponding part of a target nucleic acid, that is, an oligonucleotide that specifically binds to the gene, and has at least 70% complementarity, particularly 80% complementarity, with all or part of the gene. , even more 90% complementarity, even more particularly 95%, 96%, 97%, 98%, 99% or 100% complementarity.
본 발명에서, 상기 프라이머는 타겟 유전자에 위치하는 서열과 상보적인 서열일 수 있으며, 바람직하게는 서열번호 1 및 2 중 적어도 하나로 표시되는 프라이머 또는 이와 실질적으로 동일한 것을 포함할 수 있다. 상기 실질적으로 동일한 서열의 프라이머는 서열번호 1 및 2 각각으로 표시되는 프라이머와 70 %, 바람직하게는 80 %, 더욱 바람직하게는 90 %, 가장 바람직하게는 95 %, 96 %, 97 %, 98 %, 99 % 또는 100 % 상보성을 가지는 것일 수 있다. In the present invention, the primer may be a sequence complementary to a sequence located in the target gene, and preferably may include a primer represented by at least one of SEQ ID NOs: 1 and 2 or substantially the same. The primers of the substantially identical sequence are 70%, preferably 80%, more preferably 90%, most preferably 95%, 96%, 97%, 98% of the primers represented by SEQ ID NOs: 1 and 2, respectively. , 99% or 100% complementarity.
본 발명에서, 상기 프라이머는 정방향 프라이머 (forward primer)로서 서열번호 1로 표시되는 올리고뉴클레오티드를 포함할 수 있다. In the present invention, the primer may include the oligonucleotide represented by SEQ ID NO: 1 as a forward primer.
본 발명에서, 상기 프라이머는 역방향 프라이머 (reverse primer)로서 서열번호 2로 표시되는 올리고뉴클레오티드를 포함할 수 있다.In the present invention, the primer may include the oligonucleotide represented by SEQ ID NO: 2 as a reverse primer.
본 발명에서, 상기 프라이머는 서열번호 1 및 2 중 적어도 하나로 표시되는 프라이머일 수 있으며, 보다 바람직하게는 서열번호 1 및 2 모두를 포함하는 프라이머일 수 있다.In the present invention, the primer may be a primer represented by at least one of SEQ ID NOs: 1 and 2, and more preferably a primer including both SEQ ID NOs: 1 and 2.
본 발명에서, 상기 프라이머는 바람직하게는 등온증폭 용도로 사용되는 것일 수 있고, 더욱 바람직하게는 재조합효소 중합효소 증폭반응(recombinase polymerase amplification; RPA) 또는 역전사-재조합효소 중합효소 증폭반응(Reverse transcriptase-recombinase polymerase amplification; RT-RPA)에 사용되는 것일 수 있으나, 현장에서 단시간 내에 유전자를 증폭 및 검출 가능한 방법에 해당하는 것이라면 이에 제한되는 것은 아니다.In the present invention, the primer may be preferably used for isothermal amplification, and more preferably, a recombinase polymerase amplification (RPA) or a reverse transcriptase-recombinase polymerase amplification reaction (Reverse transcriptase- It may be used for recombinase polymerase amplification (RT-RPA), but it is not limited thereto as long as it corresponds to a method capable of amplifying and detecting a gene within a short time in the field.
본 발명에서, 상기 “재조합효소 중합효소 증폭 반응(Recombinase polymerase amplification; RPA)”이란 핵산의 빠른 등온 증폭을 위한 방법이다. 일정한 온도에서 사용되는 효소와 단백질(재조합효소, 단일 가닥 결합 단백질 및 사슬 치환 DNA 중합효소(strand displacing DNA polymerase))의 특정 조합에 의존하여 증폭한다. 엑소-프로브를 통해 RPA 증폭 산물의 실시간 검출이 가능하다. 형광 물질은 혼성화된 엑소-프로브의 내부 무염기 부위 유사체 (abasic site mimic, 예를 들어 테트라하이드로퓨란 (THF)을 들 수 있다)에서 엑소뉴클레아제 III 절삭을 통한 형광단 (fluorophore) 및 소광물질 (quencher) 등을 사용할 수 있다. 형광 신호는 랩톱 (ESEQuant Tubescanner 장치, Qiagen Lake Constance GmbH, Stockach, Germany)을 포함하는 무게가 1.2 kg인 현장 진단 스캐너를 통해 실시간으로 측정된다. 예를 들어, 비오틴 또는 겨자무과산화효소 (horseradish peroxidase)로 표지된 역방향 프라이머를 사용하여 분석에 필요한 단계 수를 줄이기 위해 다른 표지 전략의 사용을 조사한 것이다. 사용된 증폭 온도를 최적화하고 표면 차단제를 사용하고자 한 방법이다. 이러한 변화의 조합은 1 x 10-15 M의 검출 한계 (LOD)를 낮추어 훨씬 더 신속한 증폭 및 검출 프로토콜을 용이하게 한 방법이다(J. Clin. Microbiol., 50 (2012), pp. 2234-2238). 역전사-재조합효소 중합효소 증폭 (reverse transcription-recombinase polymerase amplification, RPA)은 상기한 RPA 방법에서 역전사 효소를 첨가한 것이다. In the present invention, the "recombinase polymerase amplification (RPA)" is a method for rapid isothermal amplification of nucleic acids. Amplification depends on the specific combination of enzymes and proteins (recombinases, single-stranded binding proteins, and strand displacing DNA polymerases) used at a constant temperature. The exo-probe enables real-time detection of RPA amplification products. Fluorescent material is a fluorophore and quencher through exonuclease III cleavage in an internal abasic site mimic (such as tetrahydrofuran (THF)) of the hybridized exo-probe. (quencher) can be used. The fluorescence signal is measured in real time via a point-of-care diagnostic scanner weighing 1.2 kg containing a laptop (ESEQuant Tubescanner device, Qiagen Lake Constance GmbH, Stockach, Germany). For example, we investigated the use of different labeling strategies to reduce the number of steps required for the assay by using reverse primers labeled with biotin or horseradish peroxidase. This is a method to optimize the amplification temperature used and to use a surface blocking agent. The combination of these changes is a method that lowers the limit of detection (LOD) of 1 x 10 -15 M, facilitating much faster amplification and detection protocols (J. Clin. Microbiol., 50 (2012), pp. 2234-2238). ). Reverse transcription-recombinase polymerase amplification (RPA) is the addition of a reverse transcriptase in the above RPA method.
본 발명의 상기 프라이머는 코로나바이러스 감염자, 특히는 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2) 감염자에게 나타나는 타겟 유전자를 특이적으로 민감도 있게 증폭할 수 있고, 현장에서 코로나바이러스 감염 의심자에 대하여 재조합효소 중합효소 증폭반응(RPA)을 이용하여 신속하고 빠르게 감염 여부를 진단할 수 있다. The primer of the present invention can specifically and sensitively amplify a target gene that appears in a coronavirus-infected person, especially a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infected person, It is possible to quickly and quickly diagnose infection by using the recombinase polymerase amplification reaction (RPA).
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 프라이머를 포함하는 코로나바이러스 검출용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for detecting coronavirus comprising the primer provided in the present invention.
본 발명에서, 상기 검출용 조성물은, 프로브를 추가로 더 포함할 수 있고, 바람직하게는 서열번호 3으로 표시되는 프로브를 더 포함할 수 있다. In the present invention, the composition for detection may further include a probe, and preferably may further include a probe represented by SEQ ID NO:3.
본 발명에서, 상기 "프로브(probe)"란, 목적하는 유전자에 특이적으로 부착되어 목적 유전자를 확인 및/또는 검출하는 탐침자를 포괄적으로 포함하는 광의의 개념이며, 코로나바이러스, 바람직하게는 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 타겟 유전자를 타겟으로 특이적 항원 유전자에 특이적으로 결합하는 화합물, 항체, 단백질, 올리고뉴클레오티드 등 일 수 있으며, 더욱 바람직하게는 서열 5'- CTGGTCAAAAGACTTATGAAAGACATTCTC [FAM-dT] C [THF] C [BHQ-dT] CATTTTGTTAACTTA -[3'-block]의 염기서열을 포함하는 올리고뉴클레오티드로서, 상기 올리고뉴클레오티드는 상기 서열의 염기서열과 80 % 이상, 90 % 이상, 95 % 이상, 또는 99 % 이상 유사한 서열일 수 있다. 또한, 상기 프로브는 용이한 검출을 위한 표지를 하나 이상 포함할 수 있다.In the present invention, the "probe" is a broad concept that includes a probe that is specifically attached to a target gene to identify and/or detect the target gene, and is a coronavirus, preferably a severe acute It may be a compound, antibody, protein, oligonucleotide, etc. that specifically binds to a specific antigen gene by targeting the target gene of Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), more preferably SEQ ID NO: 5'-CTGGTCAAAAGACTTATGAAAGACATTCTC An oligonucleotide comprising the nucleotide sequence of [FAM-dT] C [THF] C [BHQ-dT] CATTTTGTTAACTTA -[3'-block], wherein the oligonucleotide is 80% or more, 90% or more of the nucleotide sequence of the sequence , 95% or more, or 99% or more similar sequences. In addition, the probe may include one or more labels for easy detection.
본 발명에서, 상기 검출용 조성물은 검출의 편의성을 높이기 위해, 검출용 표지 화합물이 더 함유될 수도 있다. 이 때, 표지되는 화합물은 증폭 과정에서 증폭 산물에 포함되거나, 증폭 산물에 물리적으로 삽입되어 통상적인 방식으로 증폭 산물의 밀도, 농도, 양 등을 확인할 수 있는 화합물, 생체 분자 또는 생체 분자 유사체 등일 수 있으며, 상기 프로브는 검출을 용이하게 하기 위하여 말단 부위 또는 중간 부위에 하나 이상의 표지를 포함할 수 있으며, 상기 표지는 바람직하게는 형광 모이어티이며, 더욱 바람직하게는 다민, 쿠마린, 시아닌, EvoBlue, 옥사진, 카르보피로닌(carbopyronin), 나프탈렌, 바이페닐, 안트라센(anthracene), 페난트렌, 파이렌, 카르바졸 등을 기본 백본으로 가지는 형광 색소 또는 이의 유도체 같은 형광 모이어티가 선택적으로 연결 또는 컨쥬게이션될 수 있다. 예를 들어, 본 발명의 형광 모이어티는 Cy5.5 (694), Cy7 (773), ATTO 390™ (479), ATTO 425™ (484), ATTO 465™ (508), ATTO 488™ (523), ATTO 495™ (527), ATTO 520™ (538), ATTO 532™ (553), ATTO Rho6G™ (570), ATTO 550™ (576), ATTO 565™ (592), ATTO Rho3B™ (565), ATTO Rho11™ (608), ATTO Rho12™ (532), ATTO Thio12™ (579), ATTO 610™ (634), ATTO 611X™ (681), ATTO 620™ (643), ATTO Rho14™ (625), ATTO 633™ (657), ATTO 647™ (669), ATTO 647 N™ (669), ATTO 655™ (684), ATTO Oxa12™ (663), ATTO 700™ (719), ATTO 725™ (752), ATTO 740™ (764), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), EvoBlue10™, EvoBlue30™, MR121, Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), 로다민(Rhodamine) 110 (520), 5-FAM (522), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), Cy3™ (570), Alexa™546 (570), TRITC (572), Magnesium Orange™ (575), 피코에리트린 R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), 피로닌 Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), SYBR green, VIC (594), TET (541), HEX (553), RED670, TYE563, NED (575), Texas Red(615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-피코시아닌 (642), C-피코시아닌 (648), TOPRO™-3 (660), TOTO3 (660), DiDDilC(5) (665), Cy5™ (670), 티아디카르보시아닌 (671), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar650 (566), Quasar570 (667), Quasar670 (705), Quasar705 (610) 및 이의 유도체 또는 컨쥬게이트와 연결될 수 있지만, 이에 제한되지 않는다. 괄호의 숫자는 나노미터 단위로 표시한 발광 최대 파장이다. 또한, 상기 형광 모이어티 유도체는 본 발명의 검출을 방해하지 않는 한 자유 카르복실기, 에스테르(예컨대, N-하이드로숙신이미드(NHS) 에스테르) 또는 말레이미드 유도체를 추가적으로 포함할 수 있다. 또는, 형광 빛을 흡수하여 퀀칭시킬 수 있는 퀀처가 선택적으로 연결 또는 컨쥬게이션될 수 있다. 예를 들어, 본 발명의 퀀처는 답실(Dabsyl), BHQ(Black Hole Quencher)-0, BHQ-1, BHQ-2, BHQ3, Iowa Black®FQ, Iowa Black®RQ, QXLTM490, IRDye QC-1, Deep Dark QuencherII, Deep Dark QuencherI, Eclipse® Dark Quencher, ATTO 540Q, ATTO 580Q, ATTO 612Q 및 이의 유도체 또는 컨쥬게이트와 연결될 수 있지만, 이에 제한되지 않는다. 또한, 상기 퀀처 유도체는 본 발명의 검출을 방해하지 않는 한 자유 카르복실기, 에스테르 (예컨대, N-하이드로숙신이미드 (NHS) 에스테르) 또는 말레이미드 유도체를 추가적으로 포함할 수 있다. 또는 상기 표지는 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파 등 검출이 가능한 시그널을 제공할 수 있는 표지라면 이에 제한되는 것은 아니다. 또한, 후술하는 실시예에서는 작업의 용이성, 검출 민감도 등을 고려하여 표지 화합물로 형광 염료를 사용하였으나, 표지 화합물은 앞서 열거한 물질 중 경우에 따라 자유롭게 선택될 수 있으며, 당업계에서 통상적으로 사용되는 물질에 해당한다면 이에 제한되는 것은 아니다.In the present invention, the composition for detection may further contain a labeling compound for detection in order to increase the convenience of detection. In this case, the labeled compound may be a compound, a biomolecule or a biomolecule analog, etc., which is included in the amplification product during the amplification process or is physically inserted into the amplification product to check the density, concentration, amount, etc. of the amplification product in a conventional manner. In addition, the probe may include one or more labels at the end or in the middle to facilitate detection, and the label is preferably a fluorescent moiety, more preferably damine, coumarin, cyanine, EvoBlue, jade. A fluorescent moiety such as a fluorescent dye or a derivative thereof having a photo, carbopyrronin, naphthalene, biphenyl, anthracene, phenanthrene, pyrene, carbazole, etc. as a basic backbone is selectively linked or conjugated can be For example, a fluorescent moiety of the invention can be Cy5.5 (694), Cy7 (773), ATTO 390™ (479), ATTO 425™ (484), ATTO 465™ (508), ATTO 488™ (523) , ATTO 495™ (527), ATTO 520™ (538), ATTO 532™ (553), ATTO Rho6G™ (570), ATTO 550™ (576), ATTO 565™ (592), ATTO Rho3B™ (565), ATTO Rho11™ (608), ATTO Rho12™ (532), ATTO Thio12™ (579), ATTO 610™ (634), ATTO 611X™ (681), ATTO 620™ (643), ATTO Rho14™ (625), ATTO 633™ (657), ATTO 647™ (669), ATTO 647 N™ (669), ATTO 655™ (684), ATTO Oxa12™ (663), ATTO 700™ (719), ATTO 725™ (752), ATTO 740™ (764), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), EvoBlue10™, EvoBlue30™, MR121, Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), 5-FAM (522), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™ -1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), Cy3™ (570), Alexa™546 (570), TRI TC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronine Y (580), Rhodamine B (580), TAMRA (582) , Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), SYBR green, VIC (594), TET (541), HEX ( 553), RED670, TYE563, NED (575), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642) , C-phycocyanin (648), TOPRO™-3 (660), TOTO3 (660), DiDDilC(5) (665), Cy5™ (670), thiadicarbocyanin (671), Biosearch Blue (447) ), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520) ), Fluorescein-C3 (520), Pulsar650 (566), Quasar570 (667), Quasar670 (705), Quasar705 (610) and derivatives or conjugates thereof. The number in parentheses is the maximum emission wavelength expressed in nanometers. In addition, the fluorescent moiety derivative may additionally include a free carboxyl group, an ester (eg, N-hydrosuccinimide (NHS) ester) or a maleimide derivative as long as it does not interfere with the detection of the present invention. Alternatively, a quencher capable of absorbing and quenching fluorescent light may be selectively linked or conjugated. For example, the quencher of the present invention is Dabsyl, Black Hole Quencher (BHQ)-0, BHQ-1, BHQ-2, BHQ3, Iowa Black ® FQ, Iowa Black ® RQ, QXLTM490, IRDye QC-1, Deep Dark QuencherII, Deep Dark QuencherI, Eclipse ® Dark Quencher, ATTO 540Q, ATTO 580Q, ATTO 612Q and derivatives or conjugates thereof. In addition, the quencher derivative may additionally include a free carboxyl group, an ester (eg, N-hydrosuccinimide (NHS) ester) or a maleimide derivative as long as it does not interfere with the detection of the present invention. Or the label is a label capable of providing a detectable signal such as radioactivity, colorimetry, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, etc. If it is limited thereto not. In addition, although a fluorescent dye is used as a labeling compound in consideration of easiness of operation, detection sensitivity, etc. in the Examples to be described later, the labeling compound may be freely selected from among the materials listed above, and is commonly used in the art. If it is a substance, it is not limited thereto.
본 발명에서, 상기 검출용 조성물은 RPA 반응을 수행하기 위한 시약을 더 포함할 수 있다. 보다 구체적인 시약의 예로써 반응 완충액, 중합효소, dNTP, 주형 RNA(Template RNA) 등이 포함될 수 있으나, 유전자 증폭에 필요한 요소에 해당한다면 이에 제한되는 것은 아니다. In the present invention, the composition for detection may further include a reagent for performing the RPA reaction. Examples of more specific reagents may include a reaction buffer, polymerase, dNTP, template RNA, and the like, but are not limited thereto as long as they correspond to elements necessary for gene amplification.
본 발명의 또 다른 구현 예에 따르면, 본 발명에서 제공하는 검출용 조성물을 포함하는, 코로나바이러스 검출용 키트에 관한 것이다. According to another embodiment of the present invention, it relates to a kit for detecting coronavirus, comprising the composition for detection provided by the present invention.
본 발명에서, 상기 "키트(kit)"란 코로나바이러스, 보다 바람직하게는 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 DNA 또는 RNA를 증폭 및/또는 검출하여 코로나바이러스의 감염 여부를 예측할 수 있는 검진용 기기를 의미하며, COVID-19가 발병했을 것으로 의심되는 개체로부터 얻어진 생물학적 시료로부터 중증 급성 호흡기증후군 코로나바이러스 2의 감염 여부를 확인할 수 있는 형태라면 제한이 없다. 바람직하게는, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 타겟 유전자를 타겟으로 상보적인 서열을 가지는 프라이머 또는 프로브를 포함할 수 있고, 더욱 바람직하게는 본 발명의 프라이머 및 프로브 세트를 포함할 수 있다. 또한, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)에 특이적으로 결합하는 항체 (antibody) 또는 앱타머 (aptamer)를 포함하는 형태일 수 있으나, 상기 코로나바이러스의 DNA를 증폭 및/또는 검출하여 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 감염 여부를 예측할 수 있는 형태라면 이에 제한되지 않는다.In the present invention, the "kit" means a coronavirus, more preferably by amplifying and/or detecting DNA or RNA of a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to determine whether or not the coronavirus is infected. It means a predictable test device, and there is no limitation as long as it is a form that can confirm whether or not infection with severe acute
본 발명의 또 다른 구현 예에 따르면, 본 발명에서 제공하는 프라이머를 이용하여 코로나바이러스의 감염 또는 감염 질환을 진단하기 위한 정보 제공 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method of providing information for diagnosing a coronavirus infection or infectious disease using the primer provided in the present invention.
본 발명에서, 상기 정보 제공 방법은, 프로브를 추가로 더 이용할 수 있고, 바람직하게는 서열번호 3으로 표시되는 프로브를 더 이용하여 코로나바이러스의 감염 또는 감염 질환을 진단하기 위한 정보 제공할 수 있다. In the present invention, the information providing method may further use a probe, and preferably, further use the probe represented by SEQ ID NO: 3 to provide information for diagnosing a coronavirus infection or infectious disease.
본 발명에서 상기 방법은 목적하는 개체로부터 얻어진 생물학적 시료로부터 RNA를 추출하는 단계; 및 추출된 RNA를 주형으로 하여 본 발명에서 제공하는 프라이머를 이용하여 표적서열을 증폭시키는 단계를 포함할 수 있다.In the present invention, the method comprises the steps of extracting RNA from a biological sample obtained from a subject; and using the extracted RNA as a template and amplifying the target sequence using the primers provided in the present invention.
본 발명에서 상기 방법은, 증폭 산물을 검출하는 단계를 추가로 포함할 수 있다.In the present invention, the method may further include detecting an amplification product.
본 발명에서 상기 "목적하는 개체"란 인간을 포함하는 포유 동물로, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "target subject" refers to mammals including humans, for example, humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cattle, horses, pigs, sheep and goats. It may be selected from the group consisting of, and preferably may be a human, but is not limited thereto.
본 발명에서 상기 "인간"은 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)에 감염되었거나 그 감염이 의심되는 자로, 이에 대한 적절한 치료가 필요하거나 예상되는 자를 의미하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "human" is a person infected with or suspected of being infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and may mean a person who needs or is expected to receive appropriate treatment, but is limited thereto it's not going to be
본 발명에서 상기 "생물학적 시료"란 개체로부터 얻어지거나 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 보다 바람직하게는 환자의 유전자 정보를 확인할 수 있는 모든 시료를 의미할 수 있다. 구체적으로, 전혈 (whole blood), 백혈구 (leukocytes), 말초혈액 단핵 세포 (peripheral blood mononuclear cells), 백혈구 연층 (buffy coat), 혈장 (plasma), 혈청 (serum), 객담 (sputum), 눈물 (tears), 점액 (mucus), 세비액 (nasal washes), 비강 흡인물 (nasal aspirate), 호흡 (breath), 소변 (urine), 정액 (semen), 침 (saliva), 복강 세척액 (peritoneal washings), 복수 (ascites), 낭종액 (cystic fluid), 뇌척수막 액 (meningeal fluid), 양수 (amniotic fluid), 선액 (glandular fluid), 췌장액 (pancreatic fluid), 림프액 (lymph fluid), 흉수 (pleural fluid), 유두 흡인물 (nipple aspirate), 기관지 흡인물 (bronchial aspirate), 활액 (synovial fluid), 관절 흡인물 (joint aspirate), 기관 분비물 (organ secretions), 세포 (cell), 세포 추출물 (cell extract) 및 뇌척수액 (cerebrospinal fluid) 등으로 이루어진 군에서 선택된 1 종 이상일 수 있으나, 이에 제한되지 않는다.In the present invention, the term "biological sample" refers to any material, biological fluid, tissue or cell obtained from or derived from an individual, and more preferably, any sample from which genetic information of a patient can be identified. have. Specifically, whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, serum, sputum, tears ), mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, ascites (ascites), cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple suction nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cell, cell extract and cerebrospinal fluid) may be one or more selected from the group consisting of, but is not limited thereto.
본 발명에서, 상기 증폭 산물을 검출하는 단계는 탁도계, 형광 시약, 스핀다운에 의한 침전물 또는 전기 영동 (electrophoresis)을 이용하여 증폭된 DNA를 확인하여 수행될 수 있고, 이를 통하여 표적 DNA의 재조합효소 중합효소 증폭 (recombinase polymerase amplification, RPA) 반응을 모니터링할 수 있다.In the present invention, the step of detecting the amplification product may be performed by confirming the amplified DNA using a turbidimeter, a fluorescent reagent, a precipitate by spin-down or electrophoresis, and through this, the recombinase polymerization of the target DNA The enzyme amplification (recombinase polymerase amplification, RPA) reaction can be monitored.
본 발명의 상기 방법에서, 상기 표적서열은 타겟 유전자의 전부 또는 일부일 수 있다. In the method of the present invention, the target sequence may be all or part of the target gene.
본 발명의 상기 방법에서, 코로나바이러스의 감염 질환은 코로나바이러스 감염증-19 (coronavirus disease 2019; COVID-19), 코로나바이러스성 장염, 코로나바이러스성 설사, 중증 급성 호흡기 증후군 (severe acute respiratory syndrome coronavirus; SARS), 중동 호흡기 증후군 (Middle East respiratory syndrome; MERS), 또는 이들의 조합일 수 있으나, 이에 제한되는 것은 아니다. In the method of the present invention, the infectious disease of coronavirus is coronavirus disease 2019 (COVID-19), coronavirus enteritis, coronavirus diarrhea, severe acute respiratory syndrome coronavirus (SARS) ), Middle East respiratory syndrome (MERS), or a combination thereof, but is not limited thereto.
본 발명의 상기 방법에서, 상기 증폭 산물을 검출하는 단계 시 프로브를 추가로 더 이용할 수 있고, 바람직하게는 서열번호 3으로 표시되는 프로브를 더 이용할 수 있다.In the method of the present invention, a probe may be further used during the step of detecting the amplification product, and preferably, the probe represented by SEQ ID NO: 3 may be further used.
본 발명에서 제공하는 코로나바이러스 검출용 RPA 키트는 코로나바이러스의 감염자에게 발현되는 타겟 유전자를 특이적으로 증폭하는 프라이머 및 프로브 세트를 이용함으로써 높은 감도로 정밀하면서 신속하게 중증 급성 호흡기증후군 코로나바이러스를 검출할 수 있다.The RPA kit for coronavirus detection provided by the present invention uses a primer and probe set that specifically amplifies a target gene expressed in a person infected with a coronavirus to accurately and quickly detect severe acute respiratory syndrome coronavirus with high sensitivity. can
도 1은 본 발명의 일 실시예에 따른, 프라이머 및/또는 프로브를 디자인하기 위한 모식도를 나타낸 도이다.
도 2a 내지 도 2c는 본 발명의 일 실시예에 따른, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 검출을 위해 선별된 프라이머 및 프로브 세트의 효율을 평가하기 위하여, 다양한 간섭물질로부터 RPA 반응 수행 시 민감도를 비교 확인한 결과를 나타낸 도이다.
도 3은 본 발명의 일 실시예에 따른, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 검출을 위해 선별된 프라이머 및 프로브 세트의 민감도를 평가하기 위하여, 반응 시간에 따라 5' FAM을 부착시킨 DNA 절편의 검출 농도에 따른 RPA 반응 결과를 비교하는 도이다. 1 is a diagram illustrating a schematic diagram for designing a primer and/or a probe according to an embodiment of the present invention.
Figures 2a to 2c, in order to evaluate the efficiency of the primer and probe set selected for the detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) according to an embodiment of the present invention, from various interfering substances It is a diagram showing the result of comparing and confirming the sensitivity when performing the RPA reaction.
3 is a 5' FAM according to the reaction time to evaluate the sensitivity of the primer and probe set selected for the detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) according to an embodiment of the present invention; It is a diagram comparing the RPA reaction results according to the detection concentration of the DNA fragment to which is attached.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예 1: 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 검출용 프라이머 및 프로브 세트의 제조Example 1: Preparation of primers and probe sets for detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
본 발명자들은 보다 높은 정확도로 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)에 대한 검출이 가능하며 다양한 변이에 대응할 수 있는 하기 표 3의 서열번호 4로 표시되는 타겟 유전자의 전부 또는 일부 서열을 포함하는 효과적인 진단용 키트를 고안하고자 하였다. The present inventors can detect severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with higher accuracy and respond to various mutations All or part of the target gene represented by SEQ ID NO: 4 in Table 3 below It was intended to devise an effective diagnostic kit comprising a.
이에 본 발명자들은 보다 높은 정확도로 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)에 대한 검출이 가능한 프라이머 또는 프로브를 제작하기 위하여, 일차적으로 기존에 검출된 바이러스의 유전 정보를 이용하여 다중 정렬 (multiplealignment)을 수행하여, 그 결과를 도 1에 나타내었다. DNA 분석 소프트웨어 패키지 (DNA analysis software package)를 이용하여 다양한 프라이머와 프로브를 디자인하였다. 제작된 프라이머 및 프로브들을 이용하여 중합효소 연쇄 반응(polymerase chain reaction; PCR)을 실시하여 헤어핀 구조가 생성되는지, 다이머(dimer)를 형성하는지 등에 대하여 확인하고, 최종적으로 정방향 프라이머 (forward primer), 역방향 프라이머 (reverse primer) 및 검출용 프로브 (detection probe)를 제작하였다. 검출용 프로브는 올리고뉴클레오티드 골격에 dT-fluorophore (FAM-dT)와 이에 상응하는 dT-quencher(BHQ-dT) 그룹을 abasic 뉴클레오타이드 유사체 (tetrahydrofuran residue; THF, 혹은 dSpacer)에 인접하도록 제작하였고, 중합효소에 의한 중합반응 (연장)을 방지하기 위하여 3' 말단에는 3'-modification 그룹인 C3-spacer를 배치함으로써, 프로브 결합시 형광의 발생을 통하여 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)를 검출할 수 있도록 제작하였다. 상기에서 디자인된 SARS-CoV-2 검출용 프라이머 세트 및 프로브 서열은 하기 표 4와 같다. Therefore, in order to produce a primer or probe capable of detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with higher accuracy, the present inventors primarily use the genetic information of the previously detected virus for multiple alignment. (multiple alignment) was performed, and the results are shown in FIG. 1 . Various primers and probes were designed using a DNA analysis software package. By conducting a polymerase chain reaction (PCR) using the prepared primers and probes, it is checked whether a hairpin structure is formed or a dimer is formed, and finally, a forward primer and a reverse primer are used. A reverse primer and a detection probe were prepared. The detection probe was prepared so that dT-fluorophore (FAM-dT) and the corresponding dT-quencher (BHQ-dT) group were adjacent to an abasic nucleotide analogue (tetrahydrofuran residue; THF, or dSpacer) in the oligonucleotide backbone, and polymerase In order to prevent polymerization (extension) by was designed to detect. The primer sets and probe sequences for SARS-CoV-2 detection designed above are shown in Table 4 below.
실시예 2: 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 진단을 위한 RPA용 프라이머 및 프로브 세트의 검출 효율 평가Example 2: Evaluation of detection efficiency of primers and probe sets for RPA for diagnosis of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
2.1 검출 정확도 1 차 확인 실험2.1 Detection Accuracy Primary Confirmation Experiment
실시예 1의 방법으로 제작된 프라이머 및 프로브 세트를 이용하여 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 특이적 검출이 가능한지 확인하기 위하여, Rapid viral RNA detection 키트(SPG-FMDV-A-001. Scorpiogen Co. cooperated with TwistDx Co.)를 이용하여 RT-RPA(reverse transcriptase-recombinase polymerase amplification)를 실시하였다. RT-RPA를 실시하기 위하여 하기 표 5의 다양한 바이러스 타입(간섭 물질)으로부터 viral RNA extraction 키트(1020953, QIAGEN)을 이용하여 RNA를 추출하고, 추출된 RNA를 정량하여 100 pg, 10 ng, 및 1 ug의 RNA를 각각의 튜브에 담고, 실시예 1의 방법으로 제조된 프라이머 세트를 각각 1 uL씩, 그리고 프로브는 0.5 uL를 각각의 튜브에 첨가하고, 재수화-완충용액(rehydration buffer)을 29.5 uL씩 첨가하였다. 그리고 증류수로 50 uL를 맞춰준 후에 280 mM의 아세트산 마그네슘을 2.5 uL씩 첨가하고 39 ℃에서 증폭 반응을 개시한 후에 초기 반응 4 분 후에 튜브를 꺼내어 5 초간 와류시키고, 짧게 스핀다운 시킨 후에 다시 튜브를 39 ℃에서 20 분 동안 반응시키며 형광을 관찰하였다. 그 결과는 도 2a 내지 도 2c에 나타내었다.In order to confirm that specific detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is possible using the primer and probe set prepared by the method of Example 1, the Rapid viral RNA detection kit (SPG-FMDV-A) -001. Reverse transcriptase-recombinase polymerase amplification (RT-RPA) was performed using Scorpiogen Co. cooperated with TwistDx Co.). In order to perform RT-RPA, RNA was extracted from various virus types (interfering substances) in Table 5 using a viral RNA extraction kit (1020953, QIAGEN), and the extracted RNA was quantified to 100 pg, 10 ng, and 1 ug of RNA was placed in each tube, 1 uL of each of the primer set prepared by the method of Example 1, and 0.5 uL of the probe were added to each tube, and 29.5 rehydration-buffer solution (rehydration buffer) was added to each tube. uL was added. Then, after adjusting 50 uL with distilled water, 2.5 uL of 280 mM magnesium acetate was added at a time, and the amplification reaction was started at 39 ° C. After 4 minutes of the initial reaction, the tube was taken out, vortexed for 5 seconds, and the tube was briefly spun down. After reacting at 39 °C for 20 minutes, fluorescence was observed. The results are shown in Figs. 2a to 2c.
도 2a 내지 도 2c에 나타난 바와 같이, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 경우에만 12 내지 14 분 정도 사이에 특이적으로 검출이 가능한 것을 확인하였다. 상기 결과를 통하여, 본 발명의 프라이머 세트 및 프로브를 이용하여 단 시간에 적은 RNA 양으로도 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 특이적인 검출이 가능하다는 것을 확인할 수 있다.As shown in Figures 2a to 2c, it was confirmed that only in the case of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) can be specifically detected between 12 to 14 minutes. From the above results, it can be confirmed that the specific detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is possible even with a small amount of RNA in a short time using the primer set and probe of the present invention.
2.2 민감도 확인 실험2.2 Sensitivity Check Experiment
본 발명의 프라이머 및 프로브 세트의 검출 민감도를 확인하기 위하여, 질병관리본부 (Korea Centers for Disease Control and Prevention; KCDC)에서 분양 받은 코로나바이러스 감염증-19 (COVID-19) 환자의 검체를 수득하여 RNA의 농도에 따른 민감도를 측정하였다. 민감도 측정을 위하여 실시예 2.1과 동일한 방법으로 RT-RPA를 실시하여 RNA를 증폭시킨 후에, 실시간 형광 측정을 통하여 그 결과를 확인하였다. 그 결과를 도 3에 나타내었다.In order to confirm the detection sensitivity of the primer and probe set of the present invention, a sample of a coronavirus infection-19 (COVID-19) patient received from the Korea Centers for Disease Control and Prevention (KCDC) was obtained and RNA The sensitivity according to the concentration was measured. For sensitivity measurement, RT-RPA was performed in the same manner as in Example 2.1 to amplify RNA, and then the result was confirmed through real-time fluorescence measurement. The results are shown in FIG. 3 .
도 3에 나타난 바와 같이, 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)의 경우에 0.1 pg의 낮은 농도만으로도 12 분이 지나면 검출이 가능할 정도로 민감도가 뛰어남을 확인하였다. 상기 결과들을 통하여, 본 발명의 프라이머 세트를 이용하면 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)를 낮은 농도에서도 특이적으로 검출이 가능할 뿐만 아니라, 프로브와 함께 이용하면 등온증폭법인 RT-RPA가 가능하기 때문에 현장에서 분 단위로 신속하게 검출이 가능한 것을 알 수 있다.As shown in FIG. 3 , in the case of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), it was confirmed that the sensitivity was excellent enough to be detected after 12 minutes with only a low concentration of 0.1 pg. Through the above results, using the primer set of the present invention, it is possible to specifically detect severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) even at a low concentration, and when used with a probe, the isothermal amplification method RT- It can be seen that RPA is possible, so it can be detected quickly in the field in minutes.
결론적으로, 본 발명에 따른 방법은 실시간 PCR 기기, T8 UV 스캐너, 또는 T16 스캐너를 이용할 수 없는 현장에서 직접적으로 활용이 가능하다는 장점이 있다. 현장에서 직접 코로나바이러스 감염 의심자의 검체로부터 추출한 유전자로부터 본 발명의 프라이머 및 프로브 세트를 이용함으로써 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)를 효과적으로 검출하여 15 분 이내에 신속하게 비전문가도 손쉽게 감염 여부를 확진할 수 있어 바이러스의 확산 방지에 기여할 수 있을 것으로 기대된다.In conclusion, the method according to the present invention has the advantage that it can be directly utilized in a field where a real-time PCR machine, a T8 UV scanner, or a T16 scanner cannot be used. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is effectively detected by using the primer and probe set of the present invention from a gene extracted from a sample of a suspected coronavirus infection directly in the field, quickly and easily infected even by a non-specialist within 15 minutes It is expected that it will contribute to preventing the spread of the virus by being able to confirm whether the virus is present or not.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
<110> LEE, Hyeong Woo <120> A RPA kit for detecting coronavirus and use thereof <130> PDPB204084 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> nCoV-7,429 F1 <400> 1 atcattttat tatgtatgga aaagttatgt gcatg 35 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> nCoV-7,886 R1 <400> 2 taacattaat aggcaatgaa cctttagtgt tatta 35 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> nCoV-7800 P1 <220> <221> misc_feature <222> (31) <223> n=FAM-dT <220> <221> misc_feature <222> (33) <223> n=THF(abasic site mimic) <220> <221> misc_feature <222> (35) <223> n=BHQ-dT <400> 3 ctggtcaaaa gacttatgaa agacattctc ncncncattt tgttaactta 50 <210> 4 <211> 565 <212> DNA <213> Unknown <220> <223> SARS-CoV-2 target sequence <400> 4 gcagtacatt ttattagtaa ttcttggctt atgtggttaa taattaatct tgtacaaatg 60 gccccgattt cagctatggt tagaatgtac atcttctttg catcatttta ttatgtatgg 120 aaaagttatg tgcatgttgt agacggttgt aattcatcaa cttgtatgat gtgttacaaa 180 cgtaatagag caacaagagt cgaatgtaca actattgtta atggtgttag aaggtccttt 240 tatgtctatg ctaatggagg taaaggcttt tgcaaactac acaattggaa ttgtgttaat 300 tgtgatacat tctgtgctgg tagtacattt attagtgatg aagttgcgag agacttgtca 360 ctacagttta aaagaccaat aaatcctact gaccagtctt cttacatcgt tgatagtgtt 420 acagtgaaga atggttccat ccatctttac tttgataaag ctggtcaaaa gacttatgaa 480 agacattctc tctctcattt tgttaactta gacaacctga gagctaataa cactaaaggt 540 tcattgccta ttaatgttat agttt 565 <110> LEE, Hyeong Woo <120> A RPA kit for detecting coronavirus and use thereof <130> PDPB204084 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> nCoV-7,429 F1 <400> 1 atcattttat tatgtatgga aaagttatgt gcatg 35 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> nCoV-7,886 R1 <400> 2 taacattaat aggcaatgaa cctttagtgt tatta 35 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> nCoV-7800 P1 <220> <221> misc_feature <222> (31) <223> n=FAM-dT <220> <221> misc_feature <222> (33) <223> n = THF (basic site mimic) <220> <221> misc_feature <222> (35) <223> n=BHQ-dT <400> 3 ctggtcaaaa gacttatgaa agacattctc ncncncattt tgttaactta 50 <210> 4 <211> 565 <212> DNA <213> Unknown <220> <223> SARS-CoV-2 target sequence <400> 4 gcagtacatt ttattagtaa ttcttggctt atgtggttaa taattaatct tgtacaaatg 60 gccccgattt cagctatggt tagaatgtac atcttctttg catcatttta ttatgtatgg 120 aaaagttatg tgcatgttgt agacggttgt aattcatcaa cttgtatgat gtgttacaaa 180 cgtaataagag caacaagagt cgaatgtaca actattgtta atggtgttag aaggtccttt 240 tatgtctatg ctaatggagg taaaggcttt tgcaaactac acaattggaa ttgtgttaat 300 tgtgatacat tctgtgctgg tagtacattt attagtgatg aagttgcgag agacttgtca 360 ctacagttta aaagaccaat aaatcctact gaccagtctt cttacatcgt tgatagtgtt 420 acagtgaaga atggttccat ccatctttac tttgataaag ctggtcaaaa gacttatgaa 480 agacattctc tctctcattt tgttaactta gacaacctga gagctaataa cactaaaggt 540 tcattgccta ttaatgttat agttt 565
Claims (17)
상기 코로나바이러스는 중증 급성 호흡기증후군 코로나바이러스 2 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2)인, 프라이머.The method of claim 1,
The coronavirus is severe acute respiratory syndrome coronavirus 2 (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2), the primer.
상기 프라이머는 타겟 유전자의 전부 또는 일부에 특이적인 것인, 프라이머.The method of claim 1,
The primer is specific to all or part of the target gene, the primer.
상기 프라이머는 재조합효소 중합효소 증폭반응(recombinase polymerase amplification; RPA) 또는 역전사-재조합효소 중합효소 증폭반응(Reverse transcriptase-recombinase polymerase amplification; RT-RPA)에 사용되는 것인, 프라이머.The method of claim 1,
The primer is a recombinase polymerase amplification reaction (recombinase polymerase amplification; RPA) or reverse transcriptase-recombinase polymerase amplification reaction (Reverse transcriptase-recombinase polymerase amplification; RT-RPA) to be used for, the primer.
상기 검출용 조성물은 서열번호 3으로 표시되는 프로브를 추가로 포함하는 것인, 조성물.6. The method of claim 5,
The composition for detection will further include a probe represented by SEQ ID NO: 3, the composition.
상기 코로나바이러스는 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)인, 조성물.6. The method of claim 5,
wherein the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
상기 검출용 조성물은 반응 완충액, 중합효소, dNTP, 주형 RNA(Template RNA) 및 검출용 표지 화합물을 추가로 포함하는 것인, 조성물.6. The method of claim 5,
The composition for detection further comprises a reaction buffer, polymerase, dNTP, template RNA, and a labeling compound for detection.
상기 검출용 표지 화합물은 쿠마린, 시아닌, EvoBlue, 옥사진, 카르보피로닌(carbopyronin), 나프탈렌, 바이페닐, 안트라센(anthracene), 페난트렌, 파이렌 또는 카르바졸을 기본 백본으로 가지는 형광 색소 및 이의 유도체 형광 모이어티로 구성된 군으로부터 선택된 적어도 하나를 추가로 포함하는 것인, 조성물.9. The method of claim 8,
The labeling compound for detection is coumarin, cyanine, EvoBlue, oxazine, carbopyrronin, naphthalene, biphenyl, anthracene, phenanthrene, pyrene, or a fluorescent dye having carbazole as a basic backbone, and fluorescent dyes thereof The composition of claim 1, further comprising at least one selected from the group consisting of derivative fluorescent moieties.
추출된 RNA를 주형으로 하여 제 1항의 프라이머를 이용하여 표적서열을 증폭시키는 단계를 포함하는 코로나바이러스의 감염 또는 감염 질환을 진단하기 위한 정보 제공 방법.extracting RNA from a biological sample obtained from a subject of interest; and
An information providing method for diagnosing a coronavirus infection or infectious disease, comprising amplifying a target sequence using the primer of claim 1 using the extracted RNA as a template.
상기 방법은 증폭 산물을 검출하는 단계를 추가로 포함하는, 방법.12. The method of claim 11,
The method further comprises detecting an amplification product.
상기 생물학적 시료는 전혈 (whole blood), 백혈구 (leukocytes), 말초혈액 단핵 세포 (peripheral blood mononuclear cells), 백혈구 연층 (buffy coat), 혈장 (plasma), 혈청 (serum), 객담 (sputum), 눈물 (tears), 점액 (mucus), 세비액 (nasal washes), 비강 흡인물 (nasal aspirate), 호흡 (breath), 소변 (urine), 정액 (semen), 침 (saliva), 복강 세척액 (peritoneal washings), 복수 (ascites), 낭종액 (cystic fluid), 뇌척수막 액 (meningeal fluid), 양수 (amniotic fluid), 선액 (glandular fluid), 췌장액 (pancreatic fluid), 림프액 (lymph fluid), 흉수 (pleural fluid), 유두 흡인물 (nipple aspirate), 기관지 흡인물 (bronchial aspirate), 활액 (synovial fluid), 관절 흡인물 (joint aspirate), 기관 분비물 (organ secretions), 세포 (cell), 세포 추출물 (cell extract) 및 뇌척수액 (cerebrospinal fluid)으로 이루어진 군에서 선택된 1 종 이상인, 방법.12. The method of claim 11,
The biological sample includes whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, serum, sputum, tears ( tears), mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, Ascites, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extract and cerebrospinal fluid ( cerebrospinal fluid) at least one selected from the group consisting of, the method.
상기 표적서열을 증폭시키는 단계는 재조합효소 중합효소 증폭반응 (recombinase polymerase amplification; RPA) 또는 역전사-재조합효소 중합효소 증폭반응(Reverse transcriptase-recombinase polymerase amplification; RT-RPA)으로 수행되는 것인, 방법.12. The method of claim 11,
The step of amplifying the target sequence is a recombinase polymerase amplification (RPA) or reverse transcriptase-recombinase polymerase amplification (RT-RPA) method.
상기 증폭 산물을 검출하는 단계는 형광 발색 반응을 통해 수행되는 것인, 방법.13. The method of claim 12,
The method of claim 1, wherein the step of detecting the amplification product is performed through a fluorescence reaction.
상기 증폭 산물을 검출하는 단계 시 서열번호 3으로 표시되는 프로브를 추가로 이용하여 수행되는, 방법.13. The method of claim 12,
The method of detecting the amplification product is performed by additionally using a probe represented by SEQ ID NO: 3.
상기 코로나바이러스는 중증 급성 호흡기증후군 코로나바이러스 2 (SARS-CoV-2)인, 방법.12. The method of claim 11,
wherein the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020210055045A KR102584987B1 (en) | 2021-04-28 | 2021-04-28 | A RPA kit for detecting coronavirus and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020210055045A KR102584987B1 (en) | 2021-04-28 | 2021-04-28 | A RPA kit for detecting coronavirus and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20220147920A true KR20220147920A (en) | 2022-11-04 |
| KR102584987B1 KR102584987B1 (en) | 2023-10-05 |
Family
ID=84101389
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020210055045A KR102584987B1 (en) | 2021-04-28 | 2021-04-28 | A RPA kit for detecting coronavirus and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR102584987B1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500776A (en) * | 2020-04-29 | 2020-08-07 | 湖南润美基因科技有限公司 | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method |
-
2021
- 2021-04-28 KR KR1020210055045A patent/KR102584987B1/en active IP Right Grant
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500776A (en) * | 2020-04-29 | 2020-08-07 | 湖南润美基因科技有限公司 | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method |
Non-Patent Citations (1)
| Title |
|---|
| GenBank Accession number NC_045512 (2020.03.30.)* * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102584987B1 (en) | 2023-10-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN111004870B (en) | Novel coronavirus N gene nucleic acid detection kit | |
| TW202140799A (en) | Assays for the detection of sars-cov-2 | |
| JP6329370B2 (en) | Simultaneous diagnosis kit for diseases caused by respiratory viruses | |
| CN111187858A (en) | Novel coronavirus detection kit | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| EP4101935A1 (en) | Nucleic acid detection kit for novel coronavirus 2019-ncov | |
| CN111304368A (en) | Method, oligonucleotide and kit for detecting novel coronavirus | |
| CN113652505A (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| US20230203603A1 (en) | Rt-pcr detection reagent for detecting novel coronavirus, kit and detection method thereof | |
| KR102207965B1 (en) | Primers and probes for detection of Hantaan virus and Seoul virus and detecting method for Hantaan virus and Seoul virus using the same | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| KR102584987B1 (en) | A RPA kit for detecting coronavirus and use thereof | |
| KR102346881B1 (en) | A kit for simultaneous diagnosis of coronavirus and influenza virus | |
| EP1911853A2 (en) | Nucleic acid sequences that can be used as primers and probes in the amplification and detection of SARS coronavirus | |
| KR102252750B1 (en) | Primer and probe sets for diagnosing african swine fever virus and uses thereof | |
| KR102278402B1 (en) | Primers and probes for Measles virus and Measles virus vaccine strain and detection method using them | |
| KR102395969B1 (en) | Primer set for detecting coronavirus using the loop-mediated isothermal amplification reaction and uses thereof | |
| KR102461006B1 (en) | Primers and probes for detecting corona virus omicron mutations and uses thereof | |
| KR102495807B1 (en) | Primers and probes for detecting corona virus omicron mutations and uses thereof | |
| CN111500793A (en) | Detection primer and kit for canine parvovirus and use method of detection primer and kit | |
| KR102435209B1 (en) | Composition for simultaneously distinguishing and detecting influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus and detection method using the same | |
| KR102421844B1 (en) | Novel Marker for diagnosis of Sars coronavirus2 infection and use thereof | |
| KR20120076154A (en) | Rt-pcr composition for detecting norovirus | |
| KR102481243B1 (en) | Marker for multi-diagnosis of corona virus infection and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant |