KR20220143408A - Kits for Detecting Macrolide drug Resistant Mycoplasma pneumoniae - Google Patents

Abstract

The present invention relates to a kit for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae. By using the kit for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae and a detecting method of the present invention, macrolide antibiotic-resistant Mycoplasma pneumoniae can be detected with a single PCR reaction. A composition for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae of the present invention includes a primer combination for detecting Mycoplasma pneumoniae, and a first primer combination for confirming antibiotic resistance or a second primer combination for confirming antibiotic resistance.

Description

Kits for Detecting Macrolide drug Resistant Mycoplasma pneumoniae

The present invention relates to a kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

Mycoplasma pneumoniae (MP) is one of nine pathogens that cause acute respiratory infections and has been classified and managed as a designated infectious disease since December 30, 2010. Mycoplasma pneumoniae is a pneumonia-causing bacterium that damages the lining of the respiratory system (throat, lung, bronchi) and causes acute respiratory disease symptoms when infected, starting with mild diseases (fever, cough, sore throat, headache, fatigue, etc.) (pharyngitis), bronchitis, etc., and in severe cases may develop into atypical pneumonia.

As a method for diagnosing Mycoplasma pneumoniae infection, a culture test that can isolate and identify Mycoplasma pneumoniae from a sample of an acute respiratory infection patient, and a PCR (polymerase chain reaction method)-based method for amplifying and detecting the specific gene of the infectious bacteria of molecular diagnostic testing methods are being implemented. In addition, serological tests (antigen-antibody test) or enzyme immunoassay (ELlSA, etc.) are used to measure antibody titers in the acute and convalescent stages.

Samples for culture testing include throat swab, respiratory swab, nasal aspirate, respiratory aspirate, alveolar lavage, and sputum from suspected infection patients. It has the disadvantage that it requires more incubation time. In addition, even if culture tests are performed, molecular-based nucleic acid amplification tests such as PCR tests should be performed in parallel.

This culture test method takes a very long time to detect mycoplasma pneumoniae until the final confirmation, and the detection method is complicated, and there is a problem in that it is not possible to determine whether there is resistance to macrolide antibiotics.

Republic of Korea Patent No. 10-1038519

The present inventors made intensive research efforts to develop a detection kit that can detect Mycoplasma pneumoniae and simultaneously determine whether macrolide antibiotic resistance is present. As a result, the present invention was completed by developing a detection kit capable of detecting macrolide antibiotic-resistant Mycoplasma pneumoniae in a single PCR reaction using Polymerase Chain Reaction (PCR).

Accordingly, an object of the present invention is to provide a composition for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

Another object of the present invention is to provide a kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

Another object of the present invention is to provide a method for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

According to one aspect of the present invention, (i) a primer combination for detecting Mycoplasma pneumoniae comprising a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, and a primer consisting of a nucleotide sequence of SEQ ID NO: 3; and

(ii) a first primer combination for antibiotic resistance confirmation comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 5 and a primer consisting of the nucleotide sequence of SEQ ID NO: 6, or a primer consisting of the nucleotide sequence of SEQ ID NO: 11 and the nucleotide of SEQ ID NO: 12 It provides a composition for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae comprising a second primer combination for antibiotic resistance confirmation comprising a primer consisting of a sequence.

As used herein, the term “primer” means under conditions in which the synthesis of a primer extension product complementary to a nucleic acid strand (template) is induced, that is, in the presence of nucleotides and a polymerization agent such as DNA polymerase, and at a suitable temperature. and oligonucleotides that can act as a starting point for synthesis at pH.

In one embodiment of the present invention, the primer combination for detecting Mycoplasma pneumoniae and the primer combination for antibiotic resistance confirmation is a primer combination for real-time PCR.

In one embodiment of the present invention, the composition further comprises the following probes:

(i) a combination of primers for detecting Mycoplasma pneumoniae is a probe consisting of the nucleotide sequence of SEQ ID NO: 4; or

(ii) the first primer combination for confirming antibiotic resistance is a probe consisting of the nucleotide sequence of SEQ ID NO: 7, or the second primer combination for confirming antibiotic resistance is a probe consisting of the nucleotide sequence of SEQ ID NO: 13.

In one embodiment of the present invention, the 5'-end of the nucleotide sequence of SEQ ID NOs: 4, 7 and 13 is selected from the group consisting of FAM, TET, HEX, JOE, ROX, TMR, Cy5 and Cal Red 610. The species is labeled with a fluorophore, and the 3'-end is modified with a quencher of BHQ-1, BHQ-2 or BHQ-3. More specifically, the 5'-end of the nucleotide sequence of SEQ ID NO: 4 is labeled with Cy5, and the 3'-end is modified with BHQ3; The 5'-end of the nucleotide sequence of SEQ ID NO: 7 is labeled with FAM, and the 3'-end is modified with BHQ1; The 5'-end of the nucleotide sequence of SEQ ID NO: 13 is labeled with FAM, and the 3'-end is modified with BHQ1.

In one embodiment of the present invention, the antibiotic is a macrolide antibiotic.

Macrolide antibiotics are antibiotics with a macrocyclic lactone ring, such as erythromycin, oleandomycin, kitasamycin, josamycin, and midecamycin ( midecamycin), spiramycin, carbomycin, amphomycin, bleunsomycin, neutramycin, relomycin, rifamide, clarithromycin ( clarithromycin) and azithromycin.

The primers and probes of the present invention are Mycoplasma pneumoniae P1 gene (primers and probes of SEQ ID NOs: 1 to 4), A2063G (SEQ ID NOs: 5 to 7) and A2064G (primers and probes of SEQ ID NOs: 11 to 13) are used as detection targets.

The A2063G and A2064G of the present invention are SNPs of the 23s rRNA gene of Mycoplasma pneumoniae.

As used herein, the term “probe” refers to a single-stranded nucleic acid molecule comprising a region or regions that are substantially complementary to a target nucleic acid sequence. The “target nucleic acid”, “target nucleic acid sequence” or “target "Sequence" means a nucleic acid sequence to be detected, which is annealed or hybridized with a primer or probe under hybridization, annealing, or amplification conditions.

More specifically, the probes and primers are single-stranded deoxyribonucleotide molecules. The probe or primer used in the present invention may include naturally occurring dNMP (ie, dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. In addition, the probe or primer may include ribonucleotides.

The primer should be long enough to prime the synthesis of extension products in the presence of a polymerizer. The exact length of a primer will depend on a number of factors including, for example, temperature, application, and source of primer. As used herein, the term “annealing” or “priming” refers to apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, wherein the apposition is complementary to the template nucleic acid or a portion thereof by polymerase polymerizing the nucleotide to form nucleic acid molecules.

The primer used in the present invention hybridizes or anneals to one site of the template to form a double-stranded structure. Suitable conditions for nucleic acid hybridization to form such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization , A Practical Approach, IRL Press, Washington, D.C. (1985).

As used herein, the term “hybridization” means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur between two nucleic acid strands that are fully identical or substantially identical with some mismatch. Complementarity for hybridization may vary depending on hybridization conditions, particularly temperature. As used herein, the terms "annealing" and "hybridization" do not differ and are used interchangeably herein.

According to another aspect of the present invention, the present invention provides a kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae comprising the composition described above.

In one embodiment of the present invention, the kit is implemented by gene amplification.

In one embodiment of the present invention, the gene amplification is carried out by PCR (polymerase chain reaction).

In one embodiment of the present invention, the gene amplification is performed by real-time PCR.

The kit of the present invention simultaneously multiplexes detection or multiplexing detection of Mycoplasma pneumonia and antibiotic resistance through the polymerase chain reaction method using the primers and probes.

The "multiplex detection" or "multiplex detection" means the simultaneous detection of a plurality of target nucleic acid sequences in a reaction vessel (eg, a reaction tube).

The polymerase chain reaction (PCR) is the most well-known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase chain reaction) Chain reaction: IPCR), vectorette PCR, TAIL-PCR (thermal asymmetric interlaced PCR) and multiplex PCR have been developed for specific applications. For more information on PCR, see McPherson, M. J., and Moller, S. G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

As used herein, the term “multiplex PCR” means that a plurality of targets are simultaneously amplified by a polymerase chain reaction in a reaction vessel.

Various DNA polymerases may be used for the polymerase chain reaction, and include a 'Klenow' fragment of E. coli DNA polymerase I, a thermostable DNA polymerase, and a bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase that can be obtained from various bacterial species, which are Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu). include

According to one embodiment of the present invention, the kit of the present invention comprises Taq DNA polymerase or Pfu DNA polymerase.

According to another embodiment of the present invention, the kit of the present invention comprises Taq DNA polymerase.

The kit of the present invention may additionally include deoxyuridine triphosphate (dUTP) and Uracil DNA Glycosilase (UDG) to block carryover or crossover contamination by polymerase chain reaction products. UDG recognizes and cuts uracil contained in the previous amplification product DNA template strand, and the cut DNA template strand no longer functions as a template strand, so that the amplification reaction does not occur. By using dUTP and UDG, the present invention blocks generation of an amplification product due to contamination of the previous amplification product, thereby excluding false-positive results due to laboratory contamination of the previous amplification product, thereby improving the accuracy of the test.

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. It is desirable to provide the reaction mixture with cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to such a degree that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approximate optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

In the present invention, annealing is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary according to environmental variables.

In one embodiment of the present invention, the gene amplification is performed by real-time PCR.

The real-time PCR is a technique for analyzing and monitoring the increase in PCR amplification products in real time (Levak KJ, et al. , PCR Methods Appl. , 4(6): 357-62(1995)). The PCR reaction can be monitored by recording the amount of fluorescence emission in each cycle during the exponential phase in which the increase in PCR product is proportional to the initial amount of the target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the Ct value (cycle threshold). A marked increase in fluorescence above the reference value measured between 3-15 cycles indicates detection of accumulated PCR product. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) conventional PCR is measured in a plateau, whereas real-time PCR can obtain data during the exponential growth phase have; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) the digested probe provides permanent record amplification of the amplicon; (d) increase the detection range; (e) requires at least 1,000-fold fewer nucleic acids than conventional PCR methods; (f) detection of amplified DNA without separation via electrophoresis is possible; (g) increased amplification efficiency can be achieved using small amplicon sizes; and (h) a low risk of contamination.

When the amount of PCR amplification product reaches an amount detectable by fluorescence, an amplification curve begins to occur, the signal rises exponentially, and then reaches a stagnant state. As the initial amount of DNA increases, the number of cycles at which the amount of amplification product reaches a detectable amount decreases, so the amplification curve appears faster. Therefore, if a real-time PCR reaction is performed using a standard sample diluted stepwise, amplification curves arranged at equal intervals in the order of the initial DNA amount are obtained. Here, if a threshold is set at an appropriate point, a Ct value at the intersection of the threshold and the amplification curve is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection method is largely divided into an interchelating method (SYBR Green I method), a method using a fluorescently labeled probe (TaqMan probe method), and the like. Since the interchelating method detects all double-stranded DNA, there is no need to prepare a probe for each gene, so a reaction system can be constructed at a low cost. The method using a fluorescently-labeled probe is expensive, but has high detection specificity so that even similar sequences can be discriminated and detected. According to certain embodiments of the present invention, the kit of the present invention utilizes the TaqMan probe method.

First, the interchelating method is a method using a double-stranded DNA binding die, and non-specific amplification using a non-sequence-specific fluorescent intercalating reagent (SYBR Green I or ethidium bromide) and primer-production of an amplicon including a dimer complex is to quantify The reagent does not bind to ssDNA. SYBR Green I is a fluorescent dye that binds to the minor groove of double-stranded DNA. It is an interchelator that shows little fluorescence in solution but shows strong fluorescence when bound to double-stranded DNA (Morrison TB, Biotechniques. , 24(6): 954-8, 960, 962 (1998)). Therefore, since fluorescence is emitted through the binding between SYBR Green I and double-stranded DNA, the amount of amplification product can be measured. SYBR Green real-time PCR is accompanied by optimization processes such as melting point or dissociation curve analysis for amplicon identification. Normally, SYBR Green is used for singleplex reactions, but can be used for multiplex reactions when accompanied by melting curve analysis (Siraj AK, et al. , Clin Cancer Res. , 8 ( 12): 3832-40 (2002) and Vrettou C., et al. , Hum Mutat. , Vol 23(5): 513-521 (2004)).

The cycle threshold (Ct) value means the number of cycles in which fluorescence generated in the reaction exceeds a threshold, which is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons in the reaction have accumulated. The Ct value is the cycle in which an increase in ΔRn was first detected. Rn denotes the magnitude of the fluorescence signal generated during PCR at each time point, and ΔRn denotes the fluorescence emission intensity of the reporter die (normalized reporter signal) divided by the fluorescence emission intensity of the reference die. The Ct value is also called Cp (crossing point) in LightCycler. The Ct value represents the point at which the system begins to detect an increase in fluorescence signal associated with exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (www.appliedbiosystems.co.kr/).

On the other hand, TaqMan probes typically contain primers (e.g., 20-30 nucleotides) comprising a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ)) at the 3'-end. ) is a longer oligonucleotide. The excited fluorophore transfers energy to a nearby quencher rather than fluorescing it (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al. , Proc Natl Acad Sci USA , 94(20): 10756-61) (1997)). Therefore, when the probe is normal, no fluorescence is generated. TaqMan probes are designed to anneal to the internal sites of the PCR product. For example, the TaqMan probe can be designed as an internal sequence of the M. pneumoniae P1 gene segment amplified by SEQ ID NOs: 1-3.

The TaqMan probe specifically hybridizes to the template DNA during the annealing step, but fluorescence is suppressed by the quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5' to 3' nuclease activity of Taq DNA polymerase, and the fluorescent dye is released from the probe, the quencher suppresses the inhibition, and fluorescence is displayed. In this case, the 5'-end of the TaqMan probe should be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5' to 3' nuclease activity of this polymerase, thereby forming a reporter molecule. A fluorescence signal is generated.

The reporter molecule and quencher molecule bound to the TaqMan probe include a fluorescent material and a non-fluorescent material.

Fluorescent reporter molecules and quencher molecules that can be used in the present invention may be any known in the art, examples of which are as follows (numbers in parentheses are the maximum emission wavelength in nanometers): Cy2 ^TM (506), YOPRO ^TM -1 (509), YOYO ^TM -1 (509), Calcein (517), FITC (518), FluorX ^TM (519), Alexa ^TM (520), rhodamine 110 (520), 5 -FAM(522), Oregon Green ^TM 500(522), Oregon Green ^TM 488(524), RiboGreen ^TM (525), RhodamineGreen ^TM (527), Rhodamine 123(529), Magnesium Green ^TM (531), Calcium Green ^TM (533), TO-PRO ^TM -1(533), TOTO1(533), JOE(548), BODIPY530/550(550), Dil(565), BODIPY TMR(568), BODIPY558/568(568), BODIPY564 /570 (570), Cy3 ^™ (570), Alexa ^™ 546 (570), TRITC (572), Magnesium Orange ^™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange ^™ (576), Pyronin Y(580), RhodamineB(580), TAMRA(582), Rhodamine Red ^TM (590), Cy3.5 ^TM (596), ROX(608), Calcium Crimson ^TM (615), Alexa ^TM 594(615), Texas Red (615), Nile Red (628), YO-PRO ^TM -3 (631), YOYO ^TM -3 (631), R-phycocyanin (642), CPhycocyanin (648), TO-PRO ^TM -3 (660) ), TOTO3(660), DiD DilC(5)(665), Cy5 ^TM (67 0), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672) , BiosearchBlue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL FluorRed 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610).

The kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae of the present invention may additionally include a PCR control set for confirming whether the polymerase chain reaction is normally performed.

According to another aspect of the present invention, there is provided a method for detecting macrolide antibiotic-resistant Mycoplasma pneumonia, comprising the steps of:

(a) preparing a nucleic acid from a specimen;

(b) (i) a primer combination for detecting Mycoplasma pneumoniae comprising a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, and a primer consisting of a nucleotide sequence of SEQ ID NO: 3; and

(ii) a first primer combination for antibiotic resistance confirmation comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 5 and a primer consisting of the nucleotide sequence of SEQ ID NO: 6, or a primer consisting of the nucleotide sequence of SEQ ID NO: 11 and the nucleotide of SEQ ID NO: 12 amplifying the target nucleotide sequence in the specimen using a composition for detecting macrolide antibiotic resistance Mycoplasma pneumoniae comprising a second primer combination for antibiotic resistance confirmation comprising a primer comprising the sequence; and

(c) confirming the amplification result.

Hereinafter, the method will be described step by step.

(a) preparing a nucleic acid from a specimen;

As used herein, the term "specimen sample" includes various samples, and the sample sample is analyzed using the method of the present invention. More specifically, it may be a sample obtained by isolating and culturing the macrolide-based antibiotic-resistant Mycoplasma pneumoniae described in the present invention, or a sample isolated from a subject infected with the macrolide-based antibiotic-resistant Mycoplasma pneumoniae. The sample isolated from the subject may be cells, tissues, or body fluids, and the body fluids are blood, serum, plasma, lymph, eye fluid, saliva, tissue extract, throat swab, respiratory swab, nasal aspirate, respiratory aspirate, It may be alveolar lavage fluid and sputum, but is not limited thereto.

The step of preparing the nucleic acid from the sample is a step of processing the sample to be applied to the PCR method. As the treatment method of the specimen, a DNA extraction or RNA extraction method may be applied, and more specifically, a DNA extraction method may be applied. Extraction of DNA or RNA from the sample may be performed according to a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press ( 2001); Tesniere, C. et al., Plant Mol. Biol. Rep., 9:242 (1991); P. et al., Anal. Biochem. 162:156 (1987)).

(b) amplifying the sequence using the above-described primer pair and probe

In one embodiment of the present invention, the amplification is carried out by PCR (polymerase chain reaction).

In another embodiment of the present invention, the amplification is carried out by real-time PCR.

In one embodiment of the present invention, the real-time PCR is performed by the TaqMan probe method.

In one embodiment of the present invention, the probe is bound to a label, and the confirmation of step (c) is carried out by detecting a signal generated from the probe.

Since the method of the present invention uses the kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae, descriptions of common contents between the two are omitted in order to avoid excessive complexity of the present specification.

(c) confirming the amplification result.

In the case of amplifying the sequence using the conventional PCR method, the amplification result can be confirmed by agarose gel or polyacrylamide gel electrophoresis, and more specifically, by agarose gel electrophoresis. can be confirmed, but is not limited thereto. After electrophoresis, the electrophoresis result can be analyzed by a method such as ethidium bromide staining.

In the case of amplifying a sequence using the real-time PCR method, a PCR that reaches a constant fluorescence intensity by measuring the change in the fluorescence intensity of the labeling material for the entire PCR amplification period of the internal control, which is amplified regardless of whether the unknown sample is positive or negative The number of reactions (Cp value or Ct value) can be analyzed and a standard curve of fluorescence intensity can be obtained. The standard curve of the Cp value or Ct value and fluorescence intensity of such an internal control is clearly distinguished from the curve pattern of the Cp value or Ct value and fluorescence intensity of the negative control to provide a criterion for judging whether the unknown sample is positive or negative. can Therefore, by PCR amplifying the specimen, measure the change in fluorescence intensity of the labeling material for the entire PCR amplification period, analyze the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity, and obtain a standard curve of fluorescence intensity After that, it can be confirmed whether the target gene is included in the sample by comparing the Cp value or Ct value of the internal control and the negative control and the curve pattern of the fluorescence intensity.

The method is an exemplary method for confirming the amplification result, and the method for confirming the amplification result is not limited thereto, and a method well known in the art may be used.

In one embodiment of the present invention, the detection method comprises the following steps:

(a) preparing a nucleic acid from a specimen;

(b) (i) a primer consisting of the nucleotide sequence of SEQ ID NO: 1, a primer consisting of the nucleotide sequence of SEQ ID NO: 2. A composition for detecting Mycoplasma pneumoniae comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a probe consisting of the nucleotide sequence of SEQ ID NO: 4; and

(ii) a primer consisting of a nucleotide sequence of SEQ ID NO: 5, a primer consisting of a nucleotide sequence of SEQ ID NO: 6, and a probe consisting of a nucleotide sequence of SEQ ID NO: 7 for antibiotic resistance detection composition 1, or a nucleotide sequence of SEQ ID NO: 11 amplifying the target nucleotide sequence in the specimen using the composition 2 for detecting antibiotic resistance comprising a primer comprising the nucleotide sequence of SEQ ID NO: 12, and a probe comprising the nucleotide sequence of SEQ ID NO: 13; and

(c) confirming the amplification result.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a composition for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

(b) The present invention provides a kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

(c) The present invention provides a method for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae.

(d) When using the kit and detection method for detecting macrolide-based antibiotic-resistant M. pneumoniae of the present invention, macrolide-based antibiotic-resistant M. pneumoniae can be detected by a single PCR reaction.

1 shows the PCR results performed to measure the detection sensitivity to Mycoplasma pneumoniae.
Figure 2 shows the PCR results performed to measure the detection sensitivity to A2063G.
3 shows the PCR results performed to measure the detection sensitivity to A2064G.
4 shows the PCR results performed on 102 negative standards and 1 positive standard in order to verify the detection specificity of the present invention.
5 shows the PCR results performed on positive standards (MP, A2063G, A2064G) in the presence of an interfering substance to verify the analytical specificity of the present invention.
6 shows the PCR results performed by diluting the detection target with 10X LOD (minimum detection limit), 3X LOD, and 1X LOD to verify the precision of the present invention.
7 shows the PCR results performed by diluting the detection target with 10X LOD (minimum detection limit), 3X LOD, and 1X LOD to verify the precision of the present invention and changing the experimental location.
8 shows the PCR results performed by diluting the detection target with 10X LOD (minimum detection limit), 3X LOD, and 1X LOD in order to verify the precision of the present invention and different experimenters.
9 shows the PCR results performed by diluting the detection target to 10X LOD (minimum detection limit), 3X LOD and 1X LOD in order to verify the precision of the present invention and using different experimental equipment.
10 shows a detection schematic for the detection of macrolide-based antibiotic-resistant Mycoplasma pneumoniae.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (vol/vol) %.

Preparation of test subject positive and negative standards

For this performance test, various negative pathogenic microorganisms and genes were obtained from strain distribution institutions such as the Antibiotic-Resistant Strain Bank, Korea Microbial Conservation Center, Korea Research Institute of Biotechnology (KCTC), and ATCC (American Type Culture Collection). One type of the secured positive standard Mycoplasma pneumoniae e (ATCC qCRM-15531 D) and 102 types of negative standard materials were listed in Table 1. In addition, A2063G and A2064G were synthesized and sequencing-completed positive plasmid DNA was used.

No. resource name resource number No. resource name resource number One Streptococcus pneumoniae NCCP14585 53 Mycobacterium kansasii NCCP15672 2 NCCP14774 54 Corynebacterium ammoniagenes KCTC1018 3 Legionella pneumophila NCCP16506 55 Staphylococcus arlettae KCTC 3588 4 NCCP16509 56 Staphylococcus equorum subsp. equorum KCTC 3589 5 Bordetella pertussis NCCP13671 57 Staphylococcus kloosii KCTC 3590 6 Haemophilus influenzae NCCP14785 58 Staphylococcus pasteuri KCTC 13167 7 NCCP14676 59 Streptococcus alactolyticus KCTC3644 8 Mycoplasma pneumoniae ATCC qCRM-15531D 60 Streptococcus criceti KCTC 3292 9 Chlamydophila penumoniae ATCC 53592DQ 61 Streptococcus downei KCTC 3634 10 Moraxella catarrhalis CCARM 9004 62 Streptococcus ferus KCTC 3637 11 Staphylococcus chromogenes KCTC 3579 63 Streptococcus gallinaceus KCTC 3876 12 Staphylococcus delphini KCTC 3592 64 Streptococcus hyointestinalis KCTC 3660 13 Staphylococcus gallinarum KCTC 3585 65 Streptococcus vestibularis KCTC 3650 14 Klebsiella pneumoniae NCCP14764 66 Streptococcus macacae KCTC3659 15 pseudomonas aeruginosa NCCP14640 67 Streptococcus parauberis KCTC3651 16 Acinetobacter baumannii NCCP14607 68 Mycobacterium tuberculosis KMRC 00110-00001 17 Acinetobacter baumannii NCCP 14654 69 Mycobacterium abscessus KMRC 00136-61038 18 Staphylococcus aureus NCCP14647 70 Mycobacterium arupense KMRC 00136-15004 19 Bacillus cereus NCCP14043 71 Mycobacterium aubagnense KMRC 00136-72001 20 Bacillus subtilis NCCP16297 72 Mycobacterium avium KMRC 00136-41014 21 Campylobacter jejuni NCCP11192 73 Mycobacterium bolletii KMRC 00136-52005 22 Citrobacter freundii NCCP14611 74 Mycobacterium colombiense KMRC 00136-86001 23 Enterobacter aerogenes NCCP14761 75 Mycobacterium conceptionense KMRC 00136-79001 24 Enterobacter cloacae NCCP14620 76 Mycobacterium chitae KMRC 00136-80001 25 Enterococcus faecium NCCP14674 77 Mycobacterium fortuitum KMRC 00136-60003 26 Klebsiella oxytoca NCCP14710 78 Mycobacterium gordonae KMRC 00136-32003 27 Propionibacterium acnes NCCP14784 79 Mycobacterium goodii KMRC 00136-28002 28 Proteus mirabilis NCCP14683 80 Mycobacterium heraklionense KMRC 00136-81001 29 Proteus vulgaris NCCP14765 81 Mycobacterium intracellulare KMRC 00136-43007 30 Serratia marcescens NCCP14721 82 Mycobacterium kansasii KMRC 00136-20004 31 Sphingomonas paucimobilis NCCP 15635 83 Mycobacterium massiliense KMRC 00136-13017 32 Staphylococcus capitis NCCP 14664 84 Mycobacterium marinum KMRC 00136-21108 33 Staphylococcus caprae NCCP15629 85 Mycobacterium neoaurum KMRC 00136-18001 34 Staphylococcus cohnii ssp. urealyticum NCCP15851 86 Mycobacterium peregrinum KMRC 00136-75003 35 Staphylococcus epidermidis NCCP14768 87 Mycobacterium phocaicum KMRC 00136-22005 36 Staphylococcus haemolyticus NCCP14692 88 Mycobacterium phlei KMRC 00136-19002 37 Staphylococcus warneri NCCP15692 89 Mycobacterium xenopi KMRC 00136-42003 38 Streptococcus intermedius NCCP15853 90 Mycobacterium tuberculosis L511P KMRC 00116-00009 39 Streptococcus anginosus NCCP14730 91 Mycobacterium tuberculosis D516V KMRC 00116-00021 40 Streptococcus pyogenes NCCP14783 92 Mycobacterium tuberculosis D516Y KMRC 00116-00001 41 Streptococcus suis NCCP15852 93 Mycobacterium tuberculosis S522L KMRC 00116-00112 42 Streptococcus parasanguinis CCARM4525 94 Mycobacterium tuberculosis H526D KMRC 00116-00043 43 Streptococcus oralis CCARM4546 95 Mycobacterium tuberculosis H526Y KMRC 00116-00032 44 Staphylococcus xylosus CCARM0086 96 Mycobacterium tuberculosis H526L KMRC 00116-00104 45 Corynebacterium glutamicum CCARM 0318 97 Mycobacterium tuberculosis H526R KMRC 00116-00191 46 Stenotrophomonas maltophilia NCCP14648 98 Mycobacterium tuberculosis S531L KMRC 00116-00017 47 Streptococcus gordonii NCCP15691 99 Mycobacterium tuberculosis S531W KMRC 00116-00189 48 Streptococcus lutetiensis NCCP16230 100 Mycobacterium tuberculosis L533P KMRC 00203-00046 49 Streptococcus mitis NCCP14733 101 Mycobacterium tuberculosis S315T (ACC) KMRC 00116-00039 50 Mycobacterium tuberculosis NCCP15986 102 Mycobacterium tuberculosis inhA-15 C>T KMRC 00116-00018 51 Mycobacterium avium NCCP15717 103 Helicobacter pylori ATCC 700392DQ 52 Mycobacterium gordonae NCCP15730

Primer design and PCR conditions for real-time PCR

1) Design of primers and probes

Primers and probes for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae were designed as follows (Tables 2 and 3).

Oligomix-1 Primer name Mer order SEQ ID NO: MP P1 F1 21 CAATCTGGCGTGGATCTCTCC One MP P1 F2 21 ACCAATTCGGTGGACCTCTCC 2 MP P1 R 23 TATTAGTATTAGGCGCGAGGTTG 3 MP P1 P 25 CY5-TGGAGGAGGTGTTTCCGTCACTCGT-BHQ3 4 361 outer R 25 GATAACAGTTACCAATTAGAACAGC 5 2063G SNP F4 20 GTTAGGCGCAACGGGACGCG 6 2063G Probe P 28 FAM-TATTGATCAGGACATTATCATGTAGAGA-BHQ1 7 PCRC F 22 CTTCTGCTGAACTATTGCCTGGC 8 PCRC R 22 GAATGCTGCGACTACGATCTGC 9 PCRC P 26 TEXAS RED-CAGCTGATATAGGGCCATCAACATTG-BHQ2 10

Oligomix-2 Primer name Mer order SEQ ID NO: MP P1 F1 21 CAATCTGGCGTGGATCTCTCC One MP P1 F2 21 ACCAATTCGGTGGACCTCTCC 2 MP P1 R 23 TATTAGTATTAGGCGCGAGGTTG 3 MP P1 P 25 CY5-TGGAGGAGGTGTTTCCGTCACTCGT-BHQ3 4 361 outer R4 21 AGAAGGAGGTTAGCGCAAGCG 11 2064G SNP F4 21 AGTAAAGCTTCACGGGGTCGC 12 2064G Probe P 23 FAM-CCTGGATTTCACCGAGTCTATAG-BHQ1 13 PCRC F 22 CTTCTGCTGAACTATTGCCTGGC 8 PCRC R 22 GAATGCTGCGACTACGATCTGC 9 PCRC P 26 TEXAS RED-CAGCTGATATAGGGCCATCAACATTG-BHQ2 10

2) PCR mixture preparation and inspection process

The preparations before the test were as follows: i) Frozen or refrigerated MP-MDR standards and interfering substances (15~25 ℃) to be completely thawed, shake gently to mix, ii) All reagents and standards for performance test Leave the material at room temperature (15-25 ℃) 30 minutes before the start of the experiment and use the reagent after homogenization by shaking lightly, iii) Standard material is 1 ag/μL (10 ag/rxn) from the concentration of 1 fg/μL ) was prepared by diluting 10 times, and 10 ag/rxn, 100 ag/rxn, 1 fg/rxn, 10 fg/rxn were used for the performance test, iv) In the case of an experiment using an interference substance, a standard of 50 pg/μL It was prepared by diluting 10 times by using the interfering substance of the final concentration to be tested with the substance, and standard substances of 100 ag/rxn, 1 fg/rxn, and 10 fg/rxn were used for the performance test of the interference substance.

Calculated at a magnification increased by 1.1 times than the number of PCR reactions, the samples were placed in a 1.5 ml tube in the order of the contents of Table 4. 15 μL of the reaction solution was dispensed into PCR tubes or 96-well PCR plates. 5 μL of the prepared template was added to each PCR well. BIO-RAD CFX96 PCR was set according to the PCR conditions (Table 5) and PCR was performed (PCR reaction volume was set to 20 μL).

PCR contents Volume (μL) 2X PCR Enzyme Mix 10 Oligomix-1 or Oligomix-2 5 template 5 total amount 20

No. step temperature hour cycle One UDG reaction 50 ℃ 3 minutes One 2 Initial PCR activation 95 ℃ 15 minutes One 3 denaturalization 95 ℃ 20 seconds 45 4 Annealing & Extension 60 ℃ 30 seconds 6 final extension 72 ℃ 5 minutes One

Example 1: Verification of detection sensitivity of PCR using designed primers and probes

In order to evaluate the detection sensitivity of the primers and probes designed in the present invention, PCR tests were performed using the sold Mycoplasma pneumoniae standards and synthesized plasmid DNAs (A2063G, A2064G).

The verification range was serially diluted 10-fold from ^{10 3} Copies/rxn to 100 copies/rxn, repeated 20 times for each dilution section, and the dilution rate detected over 95% was designated as the limit of detection (LOD). . Since the target minimum detection limit of the present invention is set to 100-10 copies, the detection rate of the target minimum detection limit dilution section of Mycoplasma pneumoniae, A2063G and A2064G must satisfy 95% or more.

As a result of PCR, all of Mycoplasma pneumoniae, A2063G and ^A2064G showed ¹⁰⁰ % detection rates in the 101 section, and 15%, 40%, and 50% detection rates in 100, respectively. At this time, all the targets showed a value of Ct value 42 or less. Therefore, the sensitivity detection limit of the present invention was confirmed to be 10 copies/rxn or more (FIGS. 1 to 3, Tables 6 and 7).

Detection rate by dilution section target 10 ³ Copies/rxn 10 ² Copies/rxn 10 ¹ Copies/rxn 10 ⁰ Copies/rxn MP 100% (20/20) 100% (20/20) 100% (20/20) 15% (3/20) A2063G 100% (20/20) 100% (20/20) 100% (20/20) 40% (8/20) A2064G 100% (20/20) 100% (20/20) 100% (20/20) 50% (10/20)

[Table 7]

Result value by detection target

Example 2: Verification of detection specificity of PCR using designed primers and probes

In order to evaluate the detection specificity of the primers and probes designed in the present invention, PCR was performed using 102 types of M. pneumoniae positive and negative standards that were sold.

As a result of PCR, it was confirmed that only the positive standard was detected, and it was confirmed that there was no specific reaction to the negative standard (Fig. 4 and Table 8).

Detection specificity results No. resource name resource number test concentration detected or not MP A2063G A2064G One Streptococcus pneumoniae NCCP14585 10^3 / rxn N/D N/D N/D 2 Streptococcus pneumoniae NCCP14774 10^3 / rxn N/D N/D N/D 3 Legionella pneumophila NCCP16506 10^3 / rxn N/D N/D N/D 4 Legionella pneumophila NCCP16509 10^3 / rxn N/D N/D N/D 5 Bordetella pertussis NCCP13671 10^3 / rxn N/D N/D N/D 6 Haemophilus influenzae NCCP14785 10^3 / rxn N/D N/D N/D 7 Haemophilus influenzae NCCP14676 10^3 / rxn N/D N/D N/D 8 Mycoplasma pneumoniae ATCC qCRM-15531D 10^3 / rxn 29.88 N/D N/D 29.98 N/D N/D 9 Chlamydophila penumoniae ATCC 53592DQ 10^3 / rxn N/D N/D N/D 10 Moraxella catarrhalis CCARM 9004 10^3 / rxn N/D N/D N/D 11 Staphylococcus chromogenes KCTC 3579 10^3 / rxn N/D N/D N/D 12 Staphylococcus delphini KCTC 3592 10^3 / rxn N/D N/D N/D 13 Staphylococcus gallinarum KCTC 3585 10^3 / rxn N/D N/D N/D 14 Klebsiella pneumoniae NCCP14764 10^3 / rxn N/D N/D N/D 15 pseudomonas aeruginosa NCCP14640 10^3 / rxn N/D N/D N/D 16 Acinetobacter baumannii NCCP14607 10^3 / rxn N/D N/D N/D 17 Acinetobacter baumannii NCCP 14654 10^3 / rxn N/D N/D N/D 18 Staphylococcus aureus NCCP14647 10^3 / rxn N/D N/D N/D 19 Bacillus cereus NCCP14043 10^3 / rxn N/D N/D N/D 20 Bacillus subtilis NCCP16297 10^3 / rxn N/D N/D N/D 21 Campylobacter jejuni NCCP11192 10^3 / rxn N/D N/D N/D 22 Citrobacter freundii NCCP14611 10^3 / rxn N/D N/D N/D 23 Enterobacter aerogenes NCCP14761 10^3 / rxn N/D N/D N/D 24 Enterobacter cloacae NCCP14620 10^3 / rxn N/D N/D N/D 25 Enterococcus faecium NCCP14674 10^3 / rxn N/D N/D N/D 26 Klebsiella oxytoca NCCP14710 10^3 / rxn N/D N/D N/D 27 Propionibacterium acnes NCCP14784 10^3 / rxn N/D N/D N/D 28 Proteus mirabilis NCCP14683 10^3 / rxn N/D N/D N/D 29 Proteus vulgaris NCCP14765 10^3 / rxn N/D N/D N/D 30 Serratia marcescens NCCP14721 10^3 / rxn N/D N/D N/D 31 Sphingomonas paucimobilis NCCP 15635 10^3 / rxn N/D N/D N/D 32 Staphylococcus capitis NCCP 14664 10^3 / rxn N/D N/D N/D 33 Staphylococcus caprae NCCP15629 10^3 / rxn N/D N/D N/D 34 Staphylococcus cohnii ssp. urealyticum NCCP15851 10^3 / rxn N/D N/D N/D 35 Staphylococcus epidermidis NCCP14768 10^3 / rxn N/D N/D N/D 36 Staphylococcus haemolyticus NCCP14692 10^3 / rxn N/D N/D N/D 37 Staphylococcus warneri NCCP15692 10^3 / rxn N/D N/D N/D 38 Streptococcus intermedius NCCP15853 10^3 / rxn N/D N/D N/D 39 Streptococcus anginosus NCCP14730 10^3 / rxn N/D N/D N/D 40 Streptococcus pyogenes NCCP14783 10^3 / rxn N/D N/D N/D 41 Streptococcus suis NCCP15852 10^3 / rxn N/D N/D N/D 42 Streptococcus parasanguinis CCARM4525 10^3 / rxn N/D N/D N/D 43 Streptococcus oralis CCARM4546 10^3 / rxn N/D N/D N/D 44 Staphylococcus xylosus CCARM0086 10^3 / rxn N/D N/D N/D 45 Corynebacterium glutamicum CCARM 0318 10^3 / rxn N/D N/D N/D 46 Stenotrophomonas maltophilia NCCP14648 10^3 / rxn N/D N/D N/D 47 Streptococcus gordonii NCCP15691 10^3 / rxn N/D N/D N/D 48 Streptococcus lutetiensis NCCP16230 10^3 / rxn N/D N/D N/D 49 Streptococcus mitis NCCP14733 10^3 / rxn N/D N/D N/D 50 Mycobacterium tuberculosis NCCP15986 10^3 / rxn N/D N/D N/D 51 Mycobacterium avium NCCP15717 10^3 / rxn N/D N/D N/D 52 Mycobacterium gordonae NCCP15730 10^3 / rxn N/D N/D N/D 53 Mycobacterium kansasii NCCP15672 10^3 / rxn N/D N/D N/D 54 Corynebacterium ammoniagenes KCTC1018 10^3 / rxn N/D N/D N/D 55 Staphylococcus arlettae KCTC 3588 10^3 / rxn N/D N/D N/D 56 Staphylococcus equorum subsp. equorum KCTC 3589 10^3 / rxn N/D N/D N/D 57 Staphylococcus kloosii KCTC 3590 10^3 / rxn N/D N/D N/D 58 Staphylococcus pasteuri KCTC 13167 10^3 / rxn N/D N/D N/D 59 Streptococcus alactolyticus KCTC3644 10^3 / rxn N/D N/D N/D 60 Streptococcus criceti KCTC 3292 10^3 / rxn N/D N/D N/D 61 Streptococcus downei KCTC 3634 10^3 / rxn N/D N/D N/D 62 Streptococcus ferus KCTC 3637 10^3 / rxn N/D N/D N/D 63 Streptococcus gallinaceus KCTC 3876 10^3 / rxn N/D N/D N/D 64 Streptococcus hyointestinalis KCTC 3660 10^3 / rxn N/D N/D N/D 65 Streptococcus vestibularis KCTC 3650 10^3 / rxn N/D N/D N/D 66 Streptococcus macacae KCTC3659 10^3 / rxn N/D N/D N/D 67 Streptococcus parauberis KCTC3651 10^3 / rxn N/D N/D N/D 68 Mycobacterium tuberculosis KMRC 00110-00001 10^3 / rxn N/D N/D N/D 69 Mycobacterium abscessus KMRC 00136-61038 10^3 / rxn N/D N/D N/D 70 Mycobacterium arupense KMRC 00136-15004 10^3 / rxn N/D N/D N/D 71 Mycobacterium aubagnense KMRC 00136-72001 10^3 / rxn N/D N/D N/D 72 Mycobacterium avium KMRC 00136-41014 10^3 / rxn N/D N/D N/D 73 Mycobacterium bolletii KMRC 00136-52005 10^3 / rxn N/D N/D N/D 74 Mycobacterium colombiense KMRC 00136-86001 10^3 / rxn N/D N/D N/D 75 Mycobacterium conceptionense KMRC 00136-79001 10^3 / rxn N/D N/D N/D 76 Mycobacterium chitae KMRC 00136-80001 10^3 / rxn N/D N/D N/D 77 Mycobacterium fortuitum KMRC 00136-60003 10^3 / rxn N/D N/D N/D 78 Mycobacterium gordonae KMRC 00136-32003 10^3 / rxn N/D N/D N/D 79 Mycobacterium goodii KMRC 00136-28002 10^3 / rxn N/D N/D N/D 80 Mycobacterium heraklionense KMRC 00136-81001 10^3 / rxn N/D N/D N/D 81 Mycobacterium intracellulare KMRC 00136-43007 10^3 / rxn N/D N/D N/D 82 Mycobacterium kansasii KMRC 00136-20004 10^3 / rxn N/D N/D N/D 83 Mycobacterium massiliense KMRC 00136-13017 10^3 / rxn N/D N/D N/D 84 Mycobacterium marinum KMRC 00136-21108 10^3 / rxn N/D N/D N/D 85 Mycobacterium neoaurum KMRC 00136-18001 10^3 / rxn N/D N/D N/D 86 Mycobacterium peregrinum KMRC 00136-75003 10^3 / rxn N/D N/D N/D 87 Mycobacterium phocaicum KMRC 00136-22005 10^3 / rxn N/D N/D N/D 88 Mycobacterium phlei KMRC 00136-19002 10^3 / rxn N/D N/D N/D 89 Mycobacterium xenopi KMRC 00136-42003 10^3 / rxn N/D N/D N/D 90 Mycobacterium tuberculosis L511P KMRC 00116-00009 10^3 / rxn N/D N/D N/D 91 Mycobacterium tuberculosis D516V KMRC 00116-00021 10^3 / rxn N/D N/D N/D 92 Mycobacterium tuberculosis D516Y KMRC 00116-00001 10^3 / rxn N/D N/D N/D 93 Mycobacterium tuberculosis S522L KMRC 00116-00112 10^3 / rxn N/D N/D N/D 94 Mycobacterium tuberculosis H526D KMRC 00116-00043 10^3 / rxn N/D N/D N/D 95 Mycobacterium tuberculosis H526Y KMRC 00116-00032 10^3 / rxn N/D N/D N/D 96 Mycobacterium tuberculosis H526L KMRC 00116-00104 10^3 / rxn N/D N/D N/D 97 Mycobacterium tuberculosis H526R KMRC 00116-00191 10^3 / rxn N/D N/D N/D 98 Mycobacterium tuberculosis S531L KMRC 00116-00017 10^3 / rxn N/D N/D N/D 99 Mycobacterium tuberculosis S531W KMRC 00116-00189 10^3 / rxn N/D N/D N/D 100 Mycobacterium tuberculosis L533P KMRC 00203-00046 10^3 / rxn N/D N/D N/D 101 Mycobacterium tuberculosis S315T (ACC) KMRC 00116-00039 10^3 / rxn N/D N/D N/D 102 Mycobacterium tuberculosis inhA-15 C>T KMRC 00116-00018 10^3 / rxn N/D N/D N/D 103 Helicobacter pylori ATCC 700392DQ 10^3 / rxn N/D N/D N/D

Example 3: Analytical specificity verification of PCR using designed primers and probes

In order to verify that the primers and probes designed in the present invention do not cause an interference reaction, PCR was performed on positive standards (MP, A2063G, A2064G) in the presence of an interference material.

Interfering substances were selected by referring to the CLSI guidelines (Hemoglobin, Bilirubin, Immunoglobulin G, BSA, Collagen, Clarithromycin, Amoxicillin) (Table 9), and the minimum limit of detection (LOD) was 10 copies within the suggested interference concentration range. The detection of a positive standard material was evaluated.

Through the experiment, each detection target positive standard material (10 copies/rxn: minimum detection limit) in the state including 7 types of interfering substances (Hemoglobin, Bilirubin, Immunoglobulin G, Glucose, BSA, Clarithromycin, Amoxicillin) was detected and confirmed, It was confirmed that there was no significant difference in the measured values by the interference material. Therefore, it was proved that the interference effect of 7 types of interfering substances was very insignificant (FIG. 5 and Table 10).

No. Interfering substances Interfering substances
origin high concentration low concentration One Hemoglobin blood 2.5ug/rxn 0.15ug/rxn 2 Bilirubin blood 40 μM 17 μM 3 Immunoglobulin G (IgG) blood 4.1ug/ml 0.1ug/ml 4 BSA group 5% 3.5% 5 Glucose group 0.12% 0.08% 6 Clarithromycin Antibiotic 10ug/ml 0.2ug/ml 7 Amoxicillin Antibiotic 20ug/ml 0.4ug/ml

Interference reaction result No. Interfering substances Concentration.(rxn) target Detection value (Ct value) 1 repeat 2 repetitions 3 repetitions One Control (Non spiking) 0 MP 35.28 34.40 35.94 A2063G 38.24 36.36 38.87 A2064G 38.62 37.74 39.25 2 Hemoglobin 0.15 ug MP 35.62 35.12 35.63 A2063G 38.52 37.90 38.59 A2064G 38.90 38.28 38.97 2.5 ug MP 34.34 35.06 35.32 A2063G 37.30 38.02 38.28 A2064G 37.68 38.40 38.66 3 Bilirubin 17 μM MP 35.19 35.42 34.83 A2063G 37.93 36.94 38.79 A2064G 38.31 37.32 39.17 40 μM MP 35.23 34.80 34.26 A2063G 37.72 38.76 37.22 A2064G 38.10 39.14 37.60 4 Immunoglobulin G (IgG) 0.1 ug/ml MP 35.16 34.93 35.50 A2063G 37.52 36.94 38.46 A2064G 37.90 37.32 38.84 0.41 ug/ml MP 35.99 35.50 35.08 A2063G 37.84 37.42 37.85 A2064G 38.22 37.80 37.66 5 BSA 3.50% MP 34.40 35.94 36.90 A2063G 36.36 38.87 38.52 A2064G 36.74 39.25 38.90 5% MP 35.12 35.63 34.34 A2063G 37.90 38.59 37.30 A2064G 38.28 38.97 37.68 6 Glucose 0.08% MP 35.06 35.32 35.19 A2063G 38.02 38.28 37.93 A2064G 38.40 38.66 38.31 0.12% MP 35.42 35.83 35.23 A2063G 36.94 38.79 37.72 A2064G 37.32 39.17 38.10 7 Clarithromycin 0.2 ug/ml MP 35.80 34.26 35.16 A2063G 38.76 37.22 37.52 A2064G 39.14 37.60 37.90 0.4 ug/ml MP 35.93 35.50 35.99 A2063G 36.94 38.46 37.84 A2064G 37.32 38.84 38.22 8 Amoxicillin 0.4 ug/ml MP 35.50 35.32 35.19 A2063G 37.42 37.85 38.28 A2064G 37.80 35.66 37.90 20 ug/ml MP 35.42 34.83 35.23 A2063G 34.85 38.76 37.90 A2064G 38.40 37.32 38.28

Example 4: Verification of precision of PCR using designed primers and probes

In order to verify the precision of the primers and probes designed in the present invention, the detection target was diluted with 10X LOD, 3X LOD, and 1X LOD and repeated 3 times (Table 11), 3 experimenters (Table 12), 3 experimental sites (Table 13) or three test equipments (Table 14) were repeated twice to verify the precision of the product, and the standard deviation for each experimental section was based on an error range of less than 1.000 and %CV less than 5%.

As a result of the experiment, the standard deviation for each experimental section satisfies the criteria for an error range of less than 1.000 and %CV less than 5%, thereby verifying that the precision of the present invention is high ( FIGS. 6 to 9 and Tables 11 to 14).

target density Precision between finished products (LOT) Detection rate (%) Ct value analysis result LOT 1 LOT 2 LOT 3 AVG SD %CV MP 10 x LODs 100.0 100.0 100.0 31.92 0.54 1.68 3 x LODs 100.0 100.0 100.0 33.24 0.65 1.96 1 x LOD 100.0 100.0 100.0 36.93 0.85 2.31 A2063G 10 x LODs 100.0 100.0 100.0 34.79 0.34 0.98 3 x LODs 100.0 100.0 100.0 36.48 0.89 2.43 1 x LOD 100.0 100.0 100.0 38.87 0.64 1.64 A2064G 10 x LODs 100.0 100.0 100.0 35.01 0.34 0.97 3 x LODs 100.0 100.0 100.0 36.59 0.41 1.13 1 x LOD 100.0 100.0 100.0 39.24 0.92 2.35

target density Lab analysis results Detection rate (%) Ct value analysis result Lab 1 Lab 2 lab 3 AVG SD %CV MP 10 x LODs 100.0 100.0 100.0 31.92 0.54 1.68 3 x LODs 100.0 100.0 100.0 33.24 0.65 1.96 1 x LOD 100.0 100.0 100.0 36.93 0.85 2.31 A2063G 10 x LODs 100.0 100.0 100.0 34.79 0.34 0.98 3 x LODs 100.0 100.0 100.0 36.48 0.89 2.43 1 x LOD 100.0 100.0 100.0 38.87 0.64 1.64 A2064G 10 x LODs 100.0 100.0 100.0 35.01 0.34 0.97 3 x LODs 100.0 100.0 100.0 36.59 0.41 1.13 1 x LOD 100.0 100.0 100.0 39.24 0.92 2.35

target density Inter-Test Analysis Results Detection rate (%) Ct value analysis result tester 1 tester 2 tester 3 AVG SD %CV MP 10 x LODs 100.0 100.0 100.0 31.87 0.52 1.62 3 x LODs 100.0 100.0 100.0 33.13 0.65 1.96 1 x LOD 100.0 100.0 100.0 36.83 0.93 2.54 A2063G 10 x LODs 100.0 100.0 100.0 34.79 0.36 1.05 3 x LODs 100.0 100.0 100.0 36.44 1.01 2.77 1 x LOD 100.0 100.0 100.0 38.86 0.67 1.71 A2064G 10 x LODs 100.0 100.0 100.0 35.02 0.37 1.05 3 x LODs 100.0 100.0 100.0 36.60 0.43 1.17 1 x LOD 100.0 100.0 100.0 39.20 0.91 2.33

target density Analysis Detection rate (%) Ct value analysis result equipment A equipment B equipment C AVG SD %CV MP 10 x LODs 100.0 100.0 100.0 31.89 0.53 1.67 3 x LODs 100.0 100.0 100.0 33.22 0.65 1.95 1 x LOD 100.0 100.0 100.0 36.87 0.87 2.37 A2063G 10 x LODs 100.0 100.0 100.0 34.77 0.35 1.02 3 x LODs 100.0 100.0 100.0 36.45 0.94 1.95 1 x LOD 100.0 100.0 100.0 38.86 0.66 1.69 A2064G 10 x LODs 100.0 100.0 100.0 35.00 0.36 1.02 3 x LODs 100.0 100.0 100.0 36.61 0.42 1.15 1 x LOD 100.0 100.0 100.0 39.21 0.94 2.39

In conclusion, the primers and probes of the present invention showed a detection rate of 100% in the 10 ¹ Copies/rxn interval of i) Mycoplasma pneumoniae, A2063G and A2064G, and 15%, 40% and 40% in the 10 ⁰ Copies/rxn interval. It showed a detection rate of 50%, ii) did not show a specific reaction in all negative standards (102 types) except for positive standards, iii) 7 types of interfering substances (Hemoglobin, Bilirubin, Immunoglobulin G, BSA, Collagen) , Clarithromycin, Amoxicillin) had little interference effect, and iv) the precision was high even under various experimental conditions.

<110> EONE Life Science Institute <120> Kits for Detecting Macrolide drug Resistant Mycoplasma pneumoniae <130> PN210159 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MP P1 F1 primer <400> 1 caatctggcg tggatctctc c 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MP P1 F2 primer <400> 2 accaattcgg tggacctctc c 21 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MP P1 R primer <400> 3 tattagtatt aggcgcgagg ttg 23 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MP P1 P probe <400> 4 tggaggaggt gtttccgtca ctcgt 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 361 outer R primer <400> 5 gataacagtt accaattaga acagc 25 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2063G SNP F4 primer <400> 6 gttaggcgca acgggacgcg 20 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 2063G Probe P probe <400> 7 tattgatcag gacattatca tgtagaga 28 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCRC F primer <400> 8 ctctgctgaa ctattgcctg gc 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCRC R primer <400> 9 gaatgctgcg actacgatct gc 22 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PCRC P probe <400> 10 cagctgatat agggccatca acattg 26 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 361 outer R4 primer <400> 11 agaaggaggt tagcgcaagc g 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 2064G SNP F4 primer <400> 12 agtaaagctt cacggggtcg c 21 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 2064G Probe P probe <400> 13 cctggatttc accgagtcta tag 23

Claims (14)

(i) a primer combination for detecting Mycoplasma pneumoniae comprising a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, and a primer consisting of a nucleotide sequence of SEQ ID NO: 3; and
(ii) a first primer combination for antibiotic resistance confirmation comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 5 and a primer consisting of the nucleotide sequence of SEQ ID NO: 6, or a primer consisting of the nucleotide sequence of SEQ ID NO: 11 and the nucleotide of SEQ ID NO: 12 A composition for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae comprising a second primer combination for confirming antibiotic resistance comprising a primer comprising a sequence.
The composition for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae according to claim 1, wherein the primer combination for detecting Mycoplasma pneumoniae and the primer combination for antibiotic resistance confirmation is a primer combination for real-time PCR.
[Claim 3] The composition for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae according to claim 2, wherein the composition further comprises the following probes:
(i) a combination of primers for detecting Mycoplasma pneumoniae is a probe consisting of the nucleotide sequence of SEQ ID NO: 4; or
(ii) the first primer combination for confirming antibiotic resistance is a probe consisting of the nucleotide sequence of SEQ ID NO: 7, or the second primer combination for confirming antibiotic resistance is a probe consisting of the nucleotide sequence of SEQ ID NO: 13.
According to claim 3, wherein the 5'-end of the nucleotide sequence of SEQ ID NOs: 4, 7 and 13 is one type of fluorescence selected from the group consisting of FAM, TET, HEX, JOE, ROX, TMR, Cy5 and Cal Red 610. Labeled with a substance (fluorophore), the 3'-end is modified with a quencher (quencher) of BHQ-1, BHQ-2 or BHQ-3, macrolide-based antibiotic-resistant composition for detecting Mycoplasma pneumoniae.
A kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae comprising the composition of any one of claims 1 to 4.
The kit for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae according to claim 5, wherein the kit is carried out by gene amplification.
The kit for detecting macrolide-based antibiotic-resistant Mycoplasma pneumoniae according to claim 6, wherein the gene amplification is carried out by polymerase chain reaction (PCR).
The kit for detecting macrolide antibiotic-resistant Mycoplasma pneumoniae according to claim 6, wherein the gene amplification is carried out by real-time PCR.
A method for detecting macrolide antibiotic-resistant Mycoplasma pneumonia, comprising the steps of:
(a) preparing a nucleic acid from a specimen;
(b) (i) a primer combination for detecting Mycoplasma pneumoniae comprising a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, and a primer consisting of a nucleotide sequence of SEQ ID NO: 3; and
(ii) a first primer combination for antibiotic resistance confirmation comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 5 and a primer consisting of the nucleotide sequence of SEQ ID NO: 6, or a primer consisting of the nucleotide sequence of SEQ ID NO: 11 and the nucleotide of SEQ ID NO: 12 amplifying the target nucleotide sequence in the specimen using a composition for detecting macrolide antibiotic resistance Mycoplasma pneumoniae comprising a second primer combination for antibiotic resistance confirmation comprising a primer comprising the sequence; and
(c) confirming the amplification result.
10. The method of claim 9, wherein the detection composition further comprises the following probes, macrolide-based antibiotic-resistant Mycoplasma pneumoniae detection method:
(i) a combination of primers for detecting Mycoplasma pneumoniae is a probe consisting of the nucleotide sequence of SEQ ID NO: 4; or
(ii) the first primer combination for confirming antibiotic resistance is a probe consisting of the nucleotide sequence of SEQ ID NO: 7, or the second primer combination for confirming antibiotic resistance is a probe consisting of the nucleotide sequence of SEQ ID NO: 13.
The method of claim 9, wherein the amplification is carried out by polymerase chain reaction (PCR).
The method of claim 10, wherein the amplification is performed by real-time PCR.
The method of claim 12, wherein the real-time PCR is performed by the TaqMan probe method, macrolide-based antibiotic-resistant Mycoplasma pneumoniae detection method.
The method of claim 10, wherein the probe is bound to a label, and the confirmation of step (c) is carried out by detecting a signal generated from the probe. .

Images