KR20220085487A - Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient - Google Patents

Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient Download PDF

Info

Publication number
KR20220085487A
KR20220085487A KR1020200175591A KR20200175591A KR20220085487A KR 20220085487 A KR20220085487 A KR 20220085487A KR 1020200175591 A KR1020200175591 A KR 1020200175591A KR 20200175591 A KR20200175591 A KR 20200175591A KR 20220085487 A KR20220085487 A KR 20220085487A
Authority
KR
South Korea
Prior art keywords
stat5
hif
decoy
atopic dermatitis
odn
Prior art date
Application number
KR1020200175591A
Other languages
Korean (ko)
Other versions
KR102433981B1 (en
Inventor
박관규
권미경
안현진
구혜민
배성재
김정연
임재찬
송권호
Original Assignee
대구가톨릭대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대구가톨릭대학교산학협력단 filed Critical 대구가톨릭대학교산학협력단
Priority to KR1020200175591A priority Critical patent/KR102433981B1/en
Priority to CN202111524764.7A priority patent/CN114634927A/en
Publication of KR20220085487A publication Critical patent/KR20220085487A/en
Application granted granted Critical
Publication of KR102433981B1 publication Critical patent/KR102433981B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Dermatology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

HIF-1α 디코이 올리고핵산, STAT5 디코이 올리고핵산, 및 이들이 연결된 HIF-1α/STAT5 디코이 올리고핵산은 아토피 동물모델에서 HIF-1α 및 STAT5의 작용 억제, 표피 및 진피의 두께 감소, 면역세포의 침윤 억제, 비만세포의 활성화와 탈과립 억제, 비만세포의 과립물질 및 염증성 사이토카인의 발현 억제 등의 효과가 확인되었으므로 아토피피부염 치료 용도로 사용될 수 있다.HIF-1α decoy oligonucleic acid, STAT5 decoy oligonucleic acid, and HIF-1α/STAT5 decoy oligonucleic acid to which they are linked inhibit the action of HIF-1α and STAT5 in an atopic animal model, decrease the thickness of the epidermis and dermis, suppress the invasion of immune cells, It can be used for the treatment of atopic dermatitis because the effects such as activation of mast cells, inhibition of degranulation, and suppression of the expression of granule substances and inflammatory cytokines in mast cells have been confirmed.

Description

HIF-1α 및 STAT5 전사인자를 억제하는 합성 디코이 올리고핵산 및 이를 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 약학적 조성물 {Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient}Synthetic decoy oligonucleic acid that inhibits HIF-1α and STAT5 transcription factors and a pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient {Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient}

본 발명은 HIF-1α 및 STAT5 전사인자를 억제하는 합성 디코이 올리고핵산 및 이를 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 약학적 조성물에 관한 것이다.The present invention relates to a synthetic decoy oligonucleic acid that inhibits HIF-1α and STAT5 transcription factors, and a pharmaceutical composition for preventing or treating atopic dermatitis containing the same as an active ingredient.

아토피피부염(atopic dermatitis: AD)은 만성재발성의 습진질환으로, 염증성 피부염, 소양증 그리고 극심한 피부 건조증을 특징으로 한다. Atopic dermatitis (AD) is a chronic recurrent eczema disease characterized by inflammatory dermatitis, pruritus, and extreme dryness of the skin.

아토피피부염의 발병원인은 면역체계의 이상, 유전적 요인, 피부장벽기능의 소실, 환경적 요인 등 다양한 인자들이 복잡하게 상호작용하여 발생한다고 추정되고 있으나 명확히 규명된 것은 아니다. The cause of atopic dermatitis is presumed to be caused by complex interactions of various factors such as immune system abnormalities, genetic factors, loss of skin barrier function, and environmental factors, but it has not been clearly identified.

아토피피부염은 일차적인 면역학적 이상으로 인해 특정 항원에 대한 IgE 감작(sensitization)이 일어나 혈중 IgE를 상승시키고 제2형 보조 T세포(Th2 cell), 호산구, 수지상세포 등을 활성화시킨다고 알려져 있다. IgE는 특히 비만세포의 표면에 존재하는 고친화성 IgE 수용체(FcεR°와 교차 연결하여 비만세포를 활성화시킨다. 활성화된 비만세포는 히스타민, 케모카인과 사이토카인 등을 포함하는 면역 매개자 등을 분비하게 되는데, 이러한 사이토카인은 Th2-아형 T 세포 반응을 촉진하며 가려움증과 염증반응을 유도하여 아토피피부염을 발병시킨다. 더욱이 비만세포는 탈 과립 후 사멸되지 않고 과립을 재형성하여 새롭게 활성화될 수 있으므로 외부항원에 노출되면 조직 내에서 지속적으로 자극을 줄 수 있다. 비만세포의 초기매개 반응에 따라 산성백혈구, 염기성백혈구 및 림프구의 유입이 발생하며, 후기단계의 반응은 조직의 만성적 염증을 유도한다. 따라서 비만세포의 사멸 및 활성화 조절은 아토피피부염의 치료의 중요한 전략으로 여겨지고 있다.It is known that atopic dermatitis causes IgE sensitization to a specific antigen due to a primary immunological abnormality, which increases blood IgE and activates type 2 helper T cells (Th2 cells), eosinophils, and dendritic cells. In particular, IgE activates mast cells by cross-linking with high affinity IgE receptors (FcεR°) present on the surface of mast cells. The activated mast cells secrete immune mediators including histamine, chemokines and cytokines, etc. These cytokines promote the Th2-subtype T cell response and induce itching and inflammatory responses to cause atopic dermatitis.Moreover, mast cells do not die after degranulation, but regenerate granules to be newly activated, so exposure to external antigens The influx of acid leukocytes, basic leukocytes and lymphocytes occurs according to the initial mediated response of mast cells, and the late-stage response induces chronic inflammation of the tissue. Control of apoptosis and activation is considered an important strategy for the treatment of atopic dermatitis.

아토피피부염의 치료제로는 국소 코르티코스테로이드, 항히스타민제, 면역억제제 등이 사용되고 있다. 그러나 이 치료제들의 효과는 일시적인 증상 완화이며, 장기간 사용하면 효과가 저하되고 부작용이 나타날 수 있다고 알려져 있다. 특히 국소 스테로이드 제제는 장시간 사용 시 피부 위축, 혈관 확장, 색소 탈실 및 팽창선조의 발생 등의 다양한 부작용을 야기할 수 있다. 따라서 아토피피부염의 치료 및 예방을 위한 새로운 치료제의 개발이 요구되고 있다.As a treatment for atopic dermatitis, topical corticosteroids, antihistamines, and immunosuppressants are used. However, it is known that the effects of these therapeutic agents are temporary symptom relief, and long-term use may reduce their effectiveness and cause side effects. In particular, topical steroid preparations may cause various side effects, such as skin atrophy, vasodilation, loss of pigment, and generation of dilated striatum when used for a long time. Therefore, the development of a new therapeutic agent for the treatment and prevention of atopic dermatitis is required.

아토피피부염에서 비만세포의 생존 및 활성화를 유도하는 단백질 중 대표적인 것이 HIF-1α와 STAT5이다. HIF-1α의 경우 아토피피부염과 같은 염증성 질환에서 비만세포의 사멸을 유도하는 단백질인 PPARγ를 억제한다는 연구결과가 보고되었으며, STAT5 단백질은 염증반응에 관여하며 Bcl2 family 단백질의 발현을 유도하여 비만세포의 성장, 생존 및 활성화에 대표적으로 관여하는 전사인자로 알려져 있다. Representative proteins that induce the survival and activation of mast cells in atopic dermatitis are HIF-1α and STAT5. In the case of HIF-1α, it has been reported that HIF-1α inhibits PPARγ, a protein that induces apoptosis of mast cells in inflammatory diseases such as atopic dermatitis. It is known as a transcription factor typically involved in growth, survival and activation.

유전자 치료법이란 유전자 발현 조절물질을 환자의 세포, 조직에 전달하여 특정 유전자의 발현을 조절함으로써 질병을 치료 및 예방하는 기술이다. 디코이 올리고핵산(decoy oligodeoxynucleotide, decoy ODN)은 타겟 전사인자(transcription factor)가 결합하는 염기서열을 포함하는 합성 유전자치료제로, 전사인자의 작용을 억제하여 질병관련 유전자 발현을 효과적으로 억제시키는 도구이다. 즉, 전사인자의 DNA 결합 부위가 디코이 올리고핵산에 결합됨으로써 전사인자는 대상 유전자의 프로모터에 결합할 수 없게 되고, 전사인자의 활성이 저해되어 특정 유전자의 발현이 감소된다.Gene therapy is a technology for treating and preventing diseases by regulating the expression of specific genes by delivering a gene expression regulator to a patient's cells and tissues. Decoy oligodeoxynucleotide (decoy ODN) is a synthetic gene therapy containing a nucleotide sequence to which a target transcription factor binds. It is a tool that effectively suppresses the expression of disease-related genes by inhibiting the action of transcription factors. That is, since the DNA binding site of the transcription factor is bound to the decoy oligonucleic acid, the transcription factor cannot bind to the promoter of the target gene, and the activity of the transcription factor is inhibited, thereby reducing the expression of a specific gene.

한국공개특허 제2016-0089000호에는 DNA와 RNA를 동시에 억제하는 신규한 합성 올리고디옥시뉴클레오티드 및 이를 유효성분으로 함유하는 섬유화 질환 예방 및 치료용 약학적 조성물이 게시되어 있고, 한국공개특허 제101869308호에는 SREBP-1 디코이 올리고디옥시뉴클레오티드 및 이를 유효성분으로 함유하는 지방간 질환의 예방 또는 치료용 약학 조성물이 개시되어 있지만, 본 발명의 HIF-1α와 STAT5 전사인자를 억제시키는 합성 디코이 올리고핵산 및 이를 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 약학 조성물에 대하여 개시된 바 없다.Korean Patent Application Laid-Open No. 2016-0089000 discloses a novel synthetic oligodeoxynucleotide that simultaneously inhibits DNA and RNA and a pharmaceutical composition for preventing and treating fibrotic diseases containing the same as an active ingredient, and Korean Patent Publication No. 101869308 discloses SREBP-1 decoy oligodeoxynucleotide and a pharmaceutical composition for preventing or treating fatty liver disease containing the same as an active ingredient, but a synthetic decoy oligonucleic acid that inhibits HIF-1α and STAT5 transcription factors of the present invention and effective thereof There is no disclosure of a pharmaceutical composition for preventing or treating atopic dermatitis containing as a component.

대한민국 공개공보 제10-1869308호(2018.06.14)Republic of Korea Publication No. 10-1869308 (2018.06.14)

일 구체예에 따르면 전사인자인 HIF-1α 및 STAT5를 억제함으로써 아토피피부염을 치료하는 디코이 올리고핵산을 제공한다. According to one embodiment, there is provided a decoy oligonucleic acid for treating atopic dermatitis by inhibiting transcription factors HIF-1α and STAT5.

일 구체예에 따르면 HIF-1α 및 STAT5를 억제함으로써 아토피피부염을 치료하는 디코이 올리고핵산을 포함하는 아토피피부염 치료제를 제공한다.According to one embodiment, there is provided a therapeutic agent for atopic dermatitis comprising decoy oligonucleic acid for treating atopic dermatitis by inhibiting HIF-1α and STAT5.

일 양상은 서열번호 1의 염기서열로 이루어진 HIF-1α 디코이 올리고핵산을 제공한다. One aspect provides a HIF-1α decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1.

상기 서열번호 1에서 8 내지 12번째 염기 CACGT 및 23 내지 27번째 염기 ACGTG는 상보결합 구조를 이루고 HIF-1α와 결합하여 이를 억제할 수 있다. (도 1 참고)In SEQ ID NO: 1, the 8th to 12th bases CACGT and the 23rd to 27th bases ACGTG form a complementary structure and bind to and inhibit HIF-1α. (See Fig. 1)

상기 서열번호 1에서 16 내지 19번째 염기 AAAA는 루프를 형성할 수 있다. In SEQ ID NO: 1, the 16th to 19th bases AAAA may form a loop.

상기 올리고핵산의 골격은 디옥시라이보스, 라이보스 또는 이들의 변형체일 수 있으나 특별히 한정되는 것은 아니다. The skeleton of the oligonucleic acid may be deoxyribose, ribose, or a variant thereof, but is not particularly limited.

다른 양상은 서열번호 2의 염기서열로 이루어진 STAT5 디코이 올리고핵산을 제공한다. Another aspect provides a STAT5 decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2.

상기 서열번호 2에서 7 내지 15번째 염기 TTCCCGGAA 및 24 내지 32번째 염기 TTCCGGGAA는 상보결합 구조를 이루고, STAT5와 결합하여 이를 억제할 수 있다. In SEQ ID NO: 2, the 7th to 15th bases TTCCCGGAA and the 24th to 32nd bases TTCCGGGAA form a complementary structure, and can bind to and inhibit STAT5.

상기 서열번호 2에서 18 내지 21번째 염기 AAAA는 루프를 형성할 수 있다. In SEQ ID NO: 2, bases 18 to 21 AAAA may form a loop.

또 다른 양상은 서열번호 1의 염기서열로 이루어진 HIF-1α 디코이 올리고핵산 및 서열번호 2의 염기서열로 이루어진 STAT5 디코이 올리고핵산이 연결된 HIF-1α/STAT5 디코이 올리고핵산을 제공한다. Another aspect provides a HIF-1α/STAT5 decoy oligonucleic acid in which the HIF-1α decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1 and the STAT5 decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2 are linked.

상기 연결은 ligase에 의해 결찰(ligation)된 것일 수 있다. The linkage may be ligated by ligase.

상기 HIF-1α/STAT5 디코이 올리고핵산은 2개의 루프구조를 포함할 수 있다. The HIF-1α/STAT5 decoy oligonucleic acid may include two loop structures.

상기 HIF-1α/STAT5 디코이 올리고핵산은 1개의 스템구조를 포함할 수 있으며, 상기 스템구조에는 HIF-1α의 DNA 결합부위에 결합할 수 있는 부위 및 STAT5의 DNA 결합부위에 결합할 수 있는 부위를 포함할 수 있다. The HIF-1α/STAT5 decoy oligonucleic acid may include one stem structure, and the stem structure includes a site capable of binding to the DNA binding site of HIF-1α and a site capable of binding to the DNA binding site of STAT5. may include

상기 HIF-1α/STAT5 디코이 올리고핵산은 서열번호 1의 염기서열로 이루어진 HIF-1α 디코이 올리고핵산 및 서열번호 2의 염기서열로 이루어진 STAT5 디코이 올리고핵산을 변성(denature) 및 어닐링하고 결찰(ligation)시켜 제조할 수 있다. The HIF-1α/STAT5 decoy oligonucleic acid is obtained by denaturing, annealing, and ligation of HIF-1α decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1 and STAT5 decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2 can be manufactured.

또 다른 양상은 상기 HIF-1α 디코이 올리고핵산, STAT5 디코이 올리고핵산, 및 HIF-1α/STAT5 디코이 올리고핵산 중 선택된 하나 이상의 디코이 올리고핵산을 포함하는 아토피 피부염 예방 또는 치료용 조성물을 제공한다. Another aspect provides a composition for preventing or treating atopic dermatitis comprising at least one decoy oligonucleic acid selected from the HIF-1α decoy oligonucleic acid, the STAT5 decoy oligonucleic acid, and the HIF-1α/STAT5 decoy oligonucleic acid.

상기 아토피 피부염 예방 또는 치료용 조성물은 약학적 조성물일 수 있다. 상기 조성물은 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더 포함할 수 있다. 또한, 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화 하여 사용될수 있으나 이에 한정되는 것은 아니다. 조성물에 포함될 수 있는 담체, 부형제 및 희석제는 예를 들면 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유일 수 있다. 제제화할 경우에는 일반적으로 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함될 수 있으며, 이러한 고형 제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(Calcium carbonate), 수크로스(Sucrose) 또는 락토오스(Lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 형태일 수 있고, 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(Witepsol), 마크로골, 트윈(Tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. 적합한 약학적으로 허용되는 담체 및 제제는 레밍턴의 약학적 과학(Remington's Pharmaceutical Sciences, 19th ed., 1995)에 상세히 기재되어 있다. The composition for preventing or treating atopic dermatitis may be a pharmaceutical composition. The composition may further include a pharmaceutically acceptable carrier, excipient or diluent. In addition, it may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories and sterile injection solutions according to conventional methods, but is not limited thereto. . Carriers, excipients and diluents that may be included in the composition are, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose. , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, it can be prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. generally used. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ( Sucrose) or lactose (Lactose), gelatin, etc. may be mixed and prepared. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral use may be in the form of suspensions, solutions, emulsions, and syrups, and various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. may be included in addition to commonly used simple diluents such as water and liquid paraffin. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, macrogol, Tween 61, cacao butter, laurin fat, glycerogelatin, etc. may be used. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

상기 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 변경될 수 있다. 상기 조성물에 포함되는 유효성분의 농도는 치료 목적, 환자의 상태, 필요기간 등을 고려하여 결정할 수 있으며, 특정 범위의 농도로 한정되지 않는다.A suitable dosage of the composition may be variously changed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity of the patient. The concentration of the active ingredient included in the composition may be determined in consideration of the purpose of treatment, the condition of the patient, the required period, etc., and is not limited to a concentration within a specific range.

일 구체예에 따른 디코이 올리고핵산은 HIF-1α 및/또는 STAT5의 발현을 억제하므로 아토피 피부염 치료에 사용될 수 있다.The decoy oligonucleic acid according to one embodiment inhibits the expression of HIF-1α and/or STAT5, so it can be used to treat atopic dermatitis.

도 1은 HIF-1α/STAT5 디코이 ODN 제작 과정을 나타낸 것이다.
도 2는 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 HIF-1α 및 STAT5 발현 억제 효과를 확인한 결과이다.
도 3은 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 피부조직 손상, 표피 및 진피의 두께 증가, 및 염증세포 침윤 억제 효과를 확인한 결과이다.
도 4는 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 피부조직 비만세포 수 및 탈과립화 증가 억제 효과를 확인한 결과이다.
도 5는 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 피부 조직 내 TNF-α 발현 억제 효과를 면역화학염색으로 확인한 결과이다.
도 6은 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 피부 조직 내 TNF-α 및 IL-1β 발현 억제 효과를 웨스턴 블롯으로 확인한 결과이다.
도 7은 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 Tryptase 발현 억제 효과를 면역화학염색으로 확인한 결과이다.
도 8은 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 Tryptase 발현 억제 효과를 웨스턴 블롯으로 확인한 결과이다.
도 9는 아토피 피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 필라그린 발현 회복 효과를 확인한 결과이다.
Figure 1 shows the HIF-1α / STAT5 decoy ODN production process.
2 is a result confirming the inhibitory effect of HIF-1α and STAT5 expression of HIF-1α/STAT5 decoy ODN in atopic dermatitis animal model.
3 is a result confirming the effect of HIF-1α/STAT5 decoy ODN to damage skin tissue, increase the thickness of the epidermis and dermis, and inhibit inflammatory cell infiltration in atopic dermatitis animal model.
4 is a result confirming the inhibitory effect of HIF-1α/STAT5 decoy ODN in increasing the number and degranulation of skin tissue mast cells in atopic dermatitis animal model.
5 is a result confirming the TNF-α expression inhibitory effect of HIF-1α/STAT5 decoy ODN in skin tissue in an atopic dermatitis animal model by immunochemical staining.
6 is a result confirming the inhibitory effect of HIF-1α/STAT5 decoy ODN in skin tissue on TNF-α and IL-1β expression in atopic dermatitis animal model by Western blot.
7 is a result confirming the tryptase expression inhibitory effect of HIF-1α/STAT5 decoy ODN in an atopic dermatitis animal model by immunochemical staining.
8 is a result confirming the tryptase expression inhibitory effect of HIF-1α/STAT5 decoy ODN in an atopic dermatitis animal model by Western blot.
9 is a result confirming the effect of restoring filaggrin expression of HIF-1α/STAT5 decoy ODN in atopic dermatitis animal model.

이하 하나 이상의 구체예를 실시예를 통해 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다. Hereinafter, one or more specific embodiments will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.

실시예 1: HIF-1α/STAT5 디코이 ODN 제작Example 1: HIF-1α/STAT5 decoy ODN construction

HIF-1α/STAT5 디코이 올리고핵산(oligodeoxynucleotide, ODN) 및 Scr(scramble) ODN의 염기서열은 하기 표 1과 같다. Scr ODN은 아무 효과가 없는 ODN으로써 비교군으로 사용되었다. The nucleotide sequences of HIF-1α/STAT5 decoy oligonucleotide (ODN) and Scr (scramble) ODN are shown in Table 1 below. Scr ODN was used as a control group as an ODN with no effect.

SEQ IDSEQ ID NameName Sequence (5' -> 3')Sequence (5' -> 3') 1One HIF-1α ODNHIF-1α ODN AATTCGTCACGTATGAAAACATACGTGACGAATTCGTCACGTATGAAAACATACGTGACG 22 STAT5 ODNSTAT5 ODN AATTCTTTCCCGGAAACAAAAGTTTCCGGGAAAGAATTCTTTCCCGGAAAAAAAGTTTCCGGGAAAG 33 Scr ODNScr ODN GAATTCCAGGTACGGCAAAAAATTGCCGTACCTGGAATTCCAGGTACGGCAAAAAATTGCCGTACCTG

HIF-1α ODN 및 STAT5 ODN은 각각 스템루프 구조를 이루고 있다. 이들을 95℃에서 3분간 변성시킨 후, 80℃에서 25℃까지 온도를 낮추면서 어닐링(annealing)하였다. 어닐링된 HIF-1α/STAT5 ODN은 T4 ligase를 넣어 16 내지 18시간 동안 ligation시켜 구형의 HIF-1α/STAT5 디코이 ODN을 제작하였다. (도 1 참고)HIF-1α ODN and STAT5 ODN each form a stem-loop structure. After denaturing them at 95°C for 3 minutes, annealing was performed while lowering the temperature from 80°C to 25°C. The annealed HIF-1α/STAT5 ODN was ligated with T4 ligase for 16 to 18 hours to prepare a spherical HIF-1α/STAT5 decoy ODN. (See Fig. 1)

실시예 2: DNCB 및 집먼지 진드기 추출물(DfE)에 의해 유도된 아토피피부염 동물모델 제작Example 2: Preparation of animal model for atopic dermatitis induced by DNCB and house dust mite extract (DfE)

아토피피부염 동물모델을 제작하기 위하여 체중 20~25g의 암컷 Balb/c 마우스를 구입하여 약 7 일간 안정화하였다. 안정화 기간이 지난 후 마우스 등의 귀 하단부에서 꼬리 상단부까지 제모하고 피부의 미세 상처가 자연 치유되도록 24시간 방치하였다. 그 후 1% DNCB(2,4-dinitrochlorobenzene) 용액(아세톤:올리브오일=3:1) 200ul를 제모 부위에 도포하여 피부감작을 유도하였다. 첫 DNCB 도포일로부터 1주일이 경과한 후에, 매주 1% DNCB 200ul를 재도포하고 4일 뒤 DfE(dermatophagoides farinae extrate, 집먼지진드기 추출물) 200ul를 도포하는 과정을 총 4회 반복하여 아토피성 피부염을 유발시켰다. DfE를 도포하는 동안 1주 간격으로 Scr ODN, HIF-1α 디코이 ODN, STAT5 디코이 ODN, 및 HIF-1α/STAT5 디코이 ODN을 각각 10㎍ 만큼 쥐의 꼬리정맥을 통해 주입하였다. (한마리당 TransIT 용액 600ul에 decoy ODN 10㎍을 혼합하여 꼬리 정맥주사로 투여)To prepare an atopic dermatitis animal model, female Balb/c mice weighing 20-25 g were purchased and stabilized for about 7 days. After the stabilization period, hair was removed from the lower end of the ear to the upper end of the tail of the mouse and left for 24 hours to allow the micro-wounds on the skin to heal naturally. Then, 200ul of 1% DNCB (2,4-dinitrochlorobenzene) solution (acetone:olive oil=3:1) was applied to the hair removal area to induce skin sensitization. After 1 week has elapsed from the first DNCB application, 200ul of 1% DNCB is reapplied every week, and 200ul of DfE (dermatophagoides farinae extrate, house dust mite extract) 200ul is repeated 4 days later to induce atopic dermatitis. made it During DfE application, Scr ODN, HIF-1α decoy ODN, STAT5 decoy ODN, and HIF-1α/STAT5 decoy ODN by 10 μg each were injected through the tail vein of rats at weekly intervals. (For each animal, 600ul of TransIT solution is mixed with 10㎍ of decoy ODN and administered by tail vein injection)

실시예 3: HIF-1α/STAT5 디코이 ODN의 HIF-1α 및 STAT5 발현 억제 효과Example 3: HIF-1α/STAT5 decoy ODN inhibitory effect on HIF-1α and STAT5 expression

Scr ODN, HIF-1α 디코이 ODN, STAT5 디코이 ODN, 및 HIF-1α/STAT5 디코이 ODN을 각각 실시예 2의 아토피피부염 동물모델에 주입하였다. 동물모델의 피부조직을 적출하고 웨스턴블롯(Western blot)을 수행하여 타겟 단백질 발현을 확인하였다. Scr ODN, HIF-1α decoy ODN, STAT5 decoy ODN, and HIF-1α/STAT5 decoy ODN were each injected into the atopic dermatitis animal model of Example 2. The target protein expression was confirmed by extracting the skin tissue of the animal model and performing Western blot.

도 2에 따르면, DNCB + DfE 및 Scr을 투여한 군에서는 normal control(NC)보다 HIF-1α와 STAT5의 발현이 증가하였다.(Scr ODN은 아무 효과가 없는 ODN이므로 DNCB 및 DfE 투여에 의해 HIF-1α 및 STAT5의 발현이 증가함을 알 수 있다) DNCB 및 DfE를 투여한 군에 HIF-1α 디코이 ODN, STAT5 디코이 ODN, 또는 HIF-1α/STAT5 디코이 ODN를 주입하였을 때 이들의 발현이 감소하였다. 특히 HIF-1α/STAT5 디코이 ODN을 투여한 실험군은 HIF-1α 디코이 ODN 또는 STAT5 디코이 ODN을 투여한 실험군보다 HIF-1α 및 STAT5 각각의 발현이 더욱 억제되어 상승 효과가 있음을 확인할 수 있었다. According to FIG. 2, in the group administered with DNCB + DfE and Scr, the expression of HIF-1α and STAT5 was higher than that of the normal control (NC). (Scr ODN is an ODN with no effect, so HIF- It can be seen that the expression of 1α and STAT5 is increased) When DNCB and DfE were administered, HIF-1α decoy ODN, STAT5 decoy ODN, or HIF-1α/STAT5 decoy ODN was injected, their expression was decreased. In particular, it was confirmed that the experimental group administered with HIF-1α/STAT5 decoy ODN had a synergistic effect by more inhibiting the expression of each of HIF-1α and STAT5 than the experimental group administered with HIF-1α decoy ODN or STAT5 decoy ODN.

실시예 4: HIF-1α/STAT5 디코이 ODN의 아토피 피부염에 의한 피부조직 손상 및 염증세포의 침윤 억제 효과Example 4: Inhibitory effect of HIF-1α/STAT5 decoy ODN on skin tissue damage and inflammatory cell infiltration due to atopic dermatitis

상기 실시예 2에 따른 아토피피부염 동물모델에서 피부를 적출하여 파라핀 절편으로 제작하고 이를 H&E으로 염색하여 피부조직의 변화와 염증세포 침윤을 관찰하였다. The skin was extracted from the atopic dermatitis animal model according to Example 2, prepared into paraffin sections, and stained with H&E to observe changes in skin tissue and infiltration of inflammatory cells.

도 3에 나타난 바와 같이 DNCB와 DfE를 도포하고 Scr ODN을 주입한 동물의 피부조직은 피부조직의 손상, 표피(epidermis) 및 진피(dermis)의 두께, 및 염증세포의 침윤 정도가 normal control(NC)보다 현저히 증가하였다. (도 3의 A에서는 DNCB+DfE가 D로 표시됨)As shown in FIG. 3 , the skin tissue of the animals coated with DNCB and DfE and injected with Scr ODN showed that the damage to the skin tissue, the thickness of the epidermis and dermis, and the degree of infiltration of inflammatory cells were normal control (NC). ) was significantly increased. (In A in FIG. 3, DNCB+DfE is indicated by D)

반면에, DNCB와 DfE를 도포하고 HIF-1α 디코이 ODN, STAT5 디코이 ODN, 또는 HIF-1α/STAT5 디코이 ODN을 주입한 동물에서는 피부조직의 손상, 표피 및 진피의 두께, 및 염증세포의 침윤이 억제되었다. 특히 HIF-1α/STAT5 디코이 ODN의 효과가 가장 우수하였다. On the other hand, in animals to which DNCB and DfE were applied and injected with HIF-1α decoy ODN, STAT5 decoy ODN, or HIF-1α/STAT5 decoy ODN, skin tissue damage, epidermis and dermis thickness, and inflammatory cell infiltration were suppressed. became In particular, the effect of HIF-1α/STAT5 decoy ODN was the most excellent.

실시예 5: HIF-1α/STAT5 디코이 ODN의 아토피피부염 동물모델의 피부조직에서 비만세포의 침윤 및 탈과립화 억제 효과Example 5: Inhibitory effect of HIF-1α/STAT5 decoy ODN on invasion and degranulation of mast cells in skin tissue of atopic dermatitis animal model

상기 실시예 2에 따른 아토피피부염 동물모델에서 적출된 피부를 파라핀 절편으로 제작한 후 Giemsa 염색을 실시하여 피부조직 내 비만세포의 침윤, 증식 및 탈과립화 정도를 관찰하였다. The skin extracted from the atopic dermatitis animal model according to Example 2 was prepared as a paraffin section, and then Giemsa staining was performed to observe the degree of infiltration, proliferation and degranulation of mast cells in the skin tissue.

도 4에 나타난 바와 같이 DNCB와 DfE를 도포하며 Scr ODN을 주입한 동물의 피부에서 비만세포의 수와 탈과립화 정도가 NC 그룹에 비해 증가하였다. (도 4의 A에서는 DNCB+DfE가 D로 표시됨)As shown in FIG. 4 , the number of mast cells and the degree of degranulation were increased in the skin of animals injected with Scr ODN while applying DNCB and DfE compared to the NC group. (DNCB+DfE is indicated by D in A in FIG. 4)

그러나 HIF-1α 디코이 ODN, STAT5 디코이 ODN, 또는 HIF-1α/STAT5 디코이 ODN을 주입한 동물에서 비만세포의 수와 탈과립화 증가가 억제되었다. 특히 DNCB와 DfE를 도포하며 HIF-1α/STAT5 디코이 ODN을 주입한 동물의 피부조직은 비만세포의 수와 탈과립화 증가가 현저히 억제된 것을 확인할 수 있었다. However, the increase in the number and degranulation of mast cells was suppressed in animals injected with HIF-1α decoy ODN, STAT5 decoy ODN, or HIF-1α/STAT5 decoy ODN. In particular, it was confirmed that the increase in the number and degranulation of mast cells was significantly suppressed in the skin tissues of animals coated with DNCB and DfE and injected with HIF-1α/STAT5 decoy ODN.

아토피피부염 진행에 의한 혈청 IgE 증가를 HIF-1α/STAT5 디코이 ODN가 억제할 수 있는지 확인하기 위하여, 실시예 2에 따른 아토피피부염 동물모델의 혈청으로 ELISA(enzyme-linked immunosorbent assay, enzyme-linked immunospecific assay)를 수행하여 IgE의 발현량을 확인하였다. 그 결과, NC 그룹에 비하여 DNCB와 DfE를 도포한 그룹, 및 DNCB와 DfE를 도포하며 Scr ODN을 주입한 그룹은 혈중 IgE의 수치가 증가하였다. 그러나 HIF-1α/STAT5 디코이 ODN을 주입한 실험군은 혈중 IgE 수치가 유의하게 감소하였다. In order to confirm whether HIF-1α/STAT5 decoy ODN can inhibit the increase in serum IgE caused by the progression of atopic dermatitis, ELISA (enzyme-linked immunosorbent assay, enzyme-linked immunospecific assay) with the serum of the atopic dermatitis animal model according to Example 2 ) to confirm the expression level of IgE. As a result, compared to the NC group, the group to which DNCB and DfE was applied, and the group to which DNCB and DfE were applied and Scr ODN was injected, increased the level of IgE in the blood. However, in the experimental group injected with HIF-1α/STAT5 decoy ODN, blood IgE levels were significantly reduced.

실시예 6: 아토피피부염 동물모델에서 HIF-1α/STAT5 디코이 ODN의 염증관련 인자 억제 효과Example 6: Inhibitory effect of HIF-1α/STAT5 decoy ODN on inflammation-related factors in atopic dermatitis animal model

상기 실시예 4의 결과를 바탕으로 아토피피부염 동물모델에서 염증관련 인자의 발현 변화를 관찰하였다. 실시예 2의 아토피피부염 동물모델에서 적출된 피부를 파라핀 절편으로 제작한 후 면역화학염색하여 피부 조직 내의 TNF-α의 발현을 확인하였다. Based on the results of Example 4, changes in the expression of inflammation-related factors were observed in the atopic dermatitis animal model. The skin extracted from the atopic dermatitis animal model of Example 2 was prepared as a paraffin section and then immunochemically stained to confirm the expression of TNF-α in the skin tissue.

도 5에 따르면, DNCB 및 DfE를 도포하고 Scr ODN을 주입한 경우 TNF-α의 발현이 현저하게 증가하였으나, DNCB 및 DfE를 도포하고 HIF-1α/STAT5 디코이 ODN를 주입한 군은 TNF-α의 발현이 현저히 감소하였다. According to FIG. 5, when DNCB and DfE were applied and Scr ODN was injected, the expression of TNF-α was significantly increased, but the group coated with DNCB and DfE and injected with HIF-1α/STAT5 decoy ODN was Expression was significantly reduced.

또한 실시예 2의 아토피피부염 동물모델에서 적출한 피부조직으로 웨스턴블롯(Western blot)을 수행하여 염증관련 인자인 TNF-α와 IL-1β의 단백질 발현을 확인하였다. In addition, Western blot was performed with the skin tissue extracted from the atopic dermatitis animal model of Example 2 to confirm the protein expression of inflammatory factors, TNF-α and IL-1β.

도 6에 따르면, DNCB와 DfE 도포에 의해 TNF-α와 IL-1β의 발현이 현저히 증가하였으나, HIF-1α/STAT5 디코이 ODN를 처리한 군은 이들의 발현이 현저히 감소하였다. According to FIG. 6, the expression of TNF-α and IL-1β was significantly increased by the application of DNCB and DfE, but the group treated with HIF-1α/STAT5 decoy ODN significantly decreased their expression.

실시예 7. 아토피피부염 동물모델에서 본 발명 HIF-1α/STAT5 디코이 ODN에 의한 비만세포관련 인자의 발현 변화 Example 7. Changes in the expression of mast cell-related factors by the present invention HIF-1α/STAT5 decoy ODN in atopic dermatitis animal model

상기 실시예 2에 따른 아토피피부염 동물모델에서 비만세포의 탈과립화 물질 중 하나인 Tryptase의 발현을 관찰하였다. Tryptase의 피부조직 내의 발현을 확인하기 위하여 면역화학염색을 수행하였고, Tryptase의 단백질 발현을 웨스턴블롯(Western blot)을 수행하여 확인하였다. In the atopic dermatitis animal model according to Example 2, the expression of Tryptase, which is one of the degranulation substances of mast cells, was observed. Immunochemical staining was performed to confirm the expression of Tryptase in the skin tissue, and the protein expression of Tryptase was confirmed by performing Western blot.

도 7 및 도 8에 따르면, DNCB와 DfE에 의하여 tryptase의 조직 내 발현과 단백질 발현이 현저하게 증가하였고, HIF-1α/STAT5 디코이 ODN를 주입하였을 때 tryptase의 발현이 현저하게 감소하는 것을 확인할 수 있었다. 7 and 8, the expression of tryptase in tissues and protein expression were significantly increased by DNCB and DfE, and it was confirmed that the expression of tryptase was significantly decreased when HIF-1α/STAT5 decoy ODN was injected. .

실시예 8. 아토피피부염 동물모델에서 본 발명 HIF-1α/STAT5 디코이 ODN에 의한 피부장벽관련 인자의 발현 변화Example 8. Changes in the expression of skin barrier-related factors by the present invention HIF-1α/STAT5 decoy ODN in atopic dermatitis animal model

상기 실시예 2에 따른 아토피피부염 동물모델에서 피부장벽의 주요인자인 필라그린(filaggrin)의 발현을 관찰하였다. 피부조직에서 필라그린(filaggrin)의 발현을 확인하기 위하여 아토피피부염 동물모델에서 적출된 피부를 파라핀 절편으로 제작한 후 면역형광염색을 수행하였다. Expression of filaggrin, a major factor of the skin barrier, was observed in the atopic dermatitis animal model according to Example 2. In order to confirm the expression of filaggrin in the skin tissue, the skin extracted from the atopic dermatitis animal model was prepared as a paraffin section and then immunofluorescent staining was performed.

도 9에 따르면, DNCB와 DfE를 도포하고 Scr ODN을 주입한 동물의 피부조직에서 필라그린(filaggrin)의 발현으로 나타나는 녹색 형광이 현저히 감소하였다. 그러나 HIF-1α/STAT5 디코이 ODN를 주입하한 실험군은 필라그린(filaggrin)의 발현으로 나타나는 녹색 형광이 NC와 유사한 수준으로 회복되었다. According to FIG. 9 , green fluorescence indicated by the expression of filaggrin in the skin tissues of animals coated with DNCB and DfE and injected with Scr ODN was significantly reduced. However, in the experimental group injected with HIF-1α/STAT5 decoy ODN, the green fluorescence indicated by the expression of filaggrin was restored to a level similar to that of NC.

<110> DAEGU CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Synthetic decoy oligodeoxynucleotide that inhibits HIF-1alpha and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient <130> PN200408 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HIF-1alpha ODN <400> 1 aattcgtcac gtatgaaaac atacgtgacg 30 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> STAT5 ODN <400> 2 aattctttcc cggaaacaaa agtttccggg aaag 34 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Scr ODN <400> 3 gaattccagg tacggcaaaa aattgccgta cctg 34 <110> DAEGU CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Synthetic decoy oligodeoxynucleotide that inhibits HIF-1alpha and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient <130> PN200408 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HIF-1alpha ODN <400> 1 aattcgtcac gtatgaaaac atacgtgacg 30 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> STAT5 ODN <400> 2 aattctttcc cggaaacaaa agtttccggg aaag 34 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Scr ODN <400> 3 gaattccagg tacggcaaaa aattgccgta cctg 34

Claims (4)

서열번호 1의 염기서열로 이루어진 HIF-1α 디코이 올리고핵산.HIF-1α decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1. 서열번호 2의 염기서열로 이루어진 STAT5 디코이 올리고핵산.STAT5 decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2. 서열번호 1의 염기서열로 이루어진 HIF-1α 디코이 올리고핵산 및 서열번호 2의 염기서열로 이루어진 STAT5 디코이 올리고핵산이 연결된 HIF-1α/STAT5 디코이 올리고핵산.HIF-1α/STAT5 decoy oligonucleic acid in which the HIF-1α decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1 and the STAT5 decoy oligonucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2 are linked. 제1항 내지 제3항의 디코이 올리고핵산 중 선택된 하나 이상의 디코이 올리고핵산을 포함하는 아토피 피부염 예방 또는 치료용 조성물.
A composition for preventing or treating atopic dermatitis comprising at least one decoy oligonucleic acid selected from the decoy oligonucleic acids of claims 1 to 3.
KR1020200175591A 2020-12-15 2020-12-15 Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient KR102433981B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020200175591A KR102433981B1 (en) 2020-12-15 2020-12-15 Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient
CN202111524764.7A CN114634927A (en) 2020-12-15 2021-12-14 Synthetic decoy oligonucleotides inhibiting HIF-1 alpha and STAT5 transcription factors and pharmaceutical compositions containing same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200175591A KR102433981B1 (en) 2020-12-15 2020-12-15 Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient

Publications (2)

Publication Number Publication Date
KR20220085487A true KR20220085487A (en) 2022-06-22
KR102433981B1 KR102433981B1 (en) 2022-08-19

Family

ID=81946617

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200175591A KR102433981B1 (en) 2020-12-15 2020-12-15 Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient

Country Status (2)

Country Link
KR (1) KR102433981B1 (en)
CN (1) CN114634927A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050215503A1 (en) * 2003-12-03 2005-09-29 Mcevoy Leslie M HIF oligonucleotide decoy molecules
WO2017004357A1 (en) * 2015-07-02 2017-01-05 City Of Hope Compounds and compositions including phosphorothioated oligodeoxynucleotide, and methods of use thereof
KR101869308B1 (en) 2017-02-28 2018-06-20 대구가톨릭대학교산학협력단 SREBP-1 decoy oligodeoxynucleotide and pharmaceutical composition for preventing or treating fatty liver disease containing the same as active ingredient

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050215503A1 (en) * 2003-12-03 2005-09-29 Mcevoy Leslie M HIF oligonucleotide decoy molecules
WO2017004357A1 (en) * 2015-07-02 2017-01-05 City Of Hope Compounds and compositions including phosphorothioated oligodeoxynucleotide, and methods of use thereof
KR101869308B1 (en) 2017-02-28 2018-06-20 대구가톨릭대학교산학협력단 SREBP-1 decoy oligodeoxynucleotide and pharmaceutical composition for preventing or treating fatty liver disease containing the same as active ingredient

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
INTERNATIONAL JOURNAL OF ONCOLOGY 46: 215_222, 2015 [DOI: 10.3892/IJO.2014.2715] *
THE JOURNAL OF GENE MEDICINE, 2016; VOL, 18, P. 180-192. [DOI: 10.1002/JGM.2891] *

Also Published As

Publication number Publication date
KR102433981B1 (en) 2022-08-19
CN114634927A (en) 2022-06-17

Similar Documents

Publication Publication Date Title
KR101262813B1 (en) The composition comprising picrasma quassioides extract for preventing and treating atopic dermatitis or allergic skin diseases
JP2009545623A (en) Use of escin
Huang et al. Therapeutic synergy and complementarity for ischemia/reperfusion injury: β1-adrenergic blockade and phosphodiesterase-3 inhibition
KR102433981B1 (en) Synthetic decoy oligodeoxynucleotide that inhibits HIF-1α and STAT5 transcription factors and pharmaceutical composition for the prevention or treatment of atopic dermatitis containing the same as an active ingredient
Dong et al. Salvianolic acid B ameliorates CNS autoimmunity by suppressing Th1 responses
KR101866620B1 (en) Composition comprising an extract of Artemisia lvandulaefolial or Aster scaberl for treating insect disease
KR102206017B1 (en) Pharmaceutical composition for treating skin fibrosis comprising PARP1 inhibitor
KR20230028182A (en) Method for treating immune disease using calcineurin inhibitor and stem cell
Jeon et al. Anti-allergic effects of white rose petal extract and anti-atopic properties of its hexane fraction
KR101452313B1 (en) Cosmetic composition having anti-inflammation and skin regeneration effect
JP7349362B2 (en) Compounds, methods for producing compounds, enriched extracts, active fractions of enriched extracts, methods for producing enriched extracts, methods for selecting plant biomass to produce enriched extracts, treating immune disorders Compositions for and their uses
KR20180120906A (en) Composition for anti-pruritic comprising grape pruning stem extract as effective component
KR101869308B1 (en) SREBP-1 decoy oligodeoxynucleotide and pharmaceutical composition for preventing or treating fatty liver disease containing the same as active ingredient
KR20220081768A (en) Composition comprising trifuhalol A or its physiologically acceptable salt, and use thereof
KR101761349B1 (en) Composition for treating inflammatory disease or allergic disease comprising Cynanchum paniculatum extract or fraction thereof
KR102464516B1 (en) Composition for preventing or treating skin diseases comprising combination of coenzyme q10, zinc and microbiome
Rogerio et al. Anti-eosinophilic effect of Lafoensia pacari in toxocariasis
KR101746158B1 (en) Composition for ameliorating atopic dermatitis comprising Gypsophila oldhamiana extract and use thereof
CN102038699A (en) Novel application of paeoniflorin to inflammation resistance
KR100674222B1 (en) A compound comprising prodigiosin isolated from Serratia marcescence B-1231 KCTC 0386BP for provention and treatment of acute graft-versus-host disease
KR101339728B1 (en) Composition comprising malabaricone C for treating or preventing vascular diseases
KR102153338B1 (en) Pharmaceutical composition for preventing or treating an inflammatory disease, comprising an extract of Canarium subulatum as an active ingredient
CN116236486B (en) Use of myeloperoxidase inhibitors in the preparation of cardioprotective agents
KR20190136773A (en) Composition for alleviating histamine-independent itching comprising myrrh extract as effective component
JP2002053488A (en) Active fraction of cordycops sinensis (berk) sacc, pharmaceutical composition containing active compound and method for ameliorating renal function by using the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant