KR102206017B1 - Pharmaceutical composition for treating skin fibrosis comprising PARP1 inhibitor - Google Patents

Abstract

The present invention relates to a pharmaceutical composition and a skin external preparation composition for preventing or treating skin fibrosis diseases, containing a poly(ADP-ribose) polymerase-1 (PARP1) expression or activity inhibitor as an active component, and to a method for preventing or treating skin fibrosis diseases using the compositions. The present invention is the pharmaceutical composition for preventing or treating skin fibrosis diseases containing the PARP1 expression or activity inhibitor as an active component, wherein the PARP1 inhibitor is rucaparib.

Description

Pharmaceutical composition for treating skin fibrosis comprising PARP1 inhibitor {Pharmaceutical composition for treating skin fibrosis comprising PARP1 inhibitor}

It relates to a pharmaceutical composition for treating skin fibrosis disease comprising a PARP1 inhibitor and a method of treating skin fibrosis disease using the same.

Keloids occur when fibrous tissues proliferate excessively without an appropriate stop signal during the wound healing process, and scars widen and bulge beyond the existing damage range. Keloids are strange in appearance and cause cosmetic problems in patients, and may cause severe itching, pain, and ulcers in the scar. In addition, when the joint is invaded, the range of motion is remarkably limited, and most of the patients complain of psychiatric problems, resulting in various secondary problems.

Keloid is a disease that causes enormous obstacles to daily life in terms of not only cosmetic but also functional and mental. Until now, various treatment methods such as surgical resection, compression therapy, radiation therapy, laser therapy, and intralesional injection of steroids have been proposed and applied for keloid treatment.

Various literature reports have been introduced that surgical resection alone leads to recurrence of keloids in 80-100% of cases. Therefore, the standard treatment guidelines for keloids reduce the recurrence rate after surgical resection of the keloids by combining various additional treatments. Compression treatment has been reported relatively successfully, but the anatomical position (eg, ear canal) in which compression is possible is extremely limited, making it difficult to apply to various areas. Although radiation therapy is being performed in some institutions, there are reports of causing breast cancer, thyroid cancer, and malignant melanoma, and it is difficult to apply it to actual clinical practice due to concerns of patients about radiation therapy. Intralesional injection of steroids inhibits the hydroxylation of proline, an important amino acid that makes up collagen, and consequently inhibits collagen synthesis. However, steroid injection treatment temporarily improves the remission of the disease, but it cannot be used as a permanent treatment because it recurs in almost all cases. In addition, it causes severe injection pain, and requires repeated injections every 3 to 4 weeks, causing local side effects such as telangiectasia, depigmentation, and skin atrophy. Because it is wide, systemic side effects may occur due to overdose when a large amount of administration is required.

One aspect is to provide a pharmaceutical composition for the prevention or treatment of skin fibrosis disease comprising a PARP1 (poly [ADP-ribose] polymerase 1) expression or activity inhibitor as an active ingredient.

Another aspect is to provide a method for preventing or treating skin fibrosis disease comprising administering the pharmaceutical composition to an individual in need thereof.

Another aspect is to provide a composition for external application for skin for preventing or improving skin fibrosis disease, including an inhibitor of PARP1 expression or activity.

One aspect provides a pharmaceutical composition for preventing or treating skin fibrosis disease, comprising a PARP1 expression or activity inhibitor as an active ingredient.

As used herein, the term "PARP1 (Poly [ADP-ribose] polymerase 1)" is a molecule involved in the expression of pro-inflammatory genes and the balance of the cellular energy pool, which is completed by DNA repair, necrosis and cell dysfunction, and oxidation Although it is known to be found in various physiological conditions such as inflammatory damage promoted by local stress and DNA damage, there is no known use for the treatment of skin fibrotic diseases through inhibition of PARP1. In one embodiment, it was confirmed that the expression of PARP1 protein and mRNA was increased in keloid tissue, a kind of skin fibrosis disease. The PARP1 may be PARP1 derived from various animals that may cause skin fibrosis disease, and in particular, may be PARP1 derived from human, and its sequence information can be known from NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from an mRNA comprising NM_001618.4 or NM_007415.3, a peptide or a protein comprising the amino acid sequence of NP_001609.2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having biologically equivalent activity may be regarded as an mRNA of PARP1 or a PARP1 protein.

As used herein, the term "PARP1 inhibitor" refers to an agent that reduces the expression or activity of PARP1 in a cell, for example, directly acting on PARP1 or indirectly acting on an upper regulator of PARP1, It may mean an agent that reduces the expression level of PARP1 or its activity by reducing the expression at the transcriptional level, increasing the degradation of expressed PARP1, or interfering with its activity, and reducing the expression or activity of PARP1 in cells It may be included without limitation as long as it can increase the radiation sensitivity of cells. In one embodiment, as a result of inhibiting PARP1 in keloid fibroblasts, it was confirmed that the growth and mobility of the cells, expression of fibrotic markers were significantly inhibited, and the size and hardness of keloid tissues were significantly reduced.

The PARP1 inhibitor is not particularly limited as long as it is a substance having PARP1 inhibitory activity, but a biological molecule such as a nucleic acid or a polypeptide that can be treated on cells through standard techniques known in the art, a compound, an extract isolated from a bacterium or plant or animal Can be

The PARP1 activity inhibitor may be an antibody specifically binding to PARP1 protein or a fragment thereof, an antigen-binding fragment thereof, a peptide, a protein, or a combination thereof.

The PARP1 expression inhibitor may be a siRNA specific for PARP1, an RNA aptamer, a ribozyme, an antisense nucleic acid molecule that complementarily binds to a nucleotide sequence encoding PARP1, or a combination thereof.

The PARP1 inhibitor may be rucaparib. Lucaparib is an FDA-approved treatment for ovarian cancer. In one embodiment, the therapeutic effect of skin fibrosis disease through PARP1 inhibition was confirmed by using the rucaparib.

The pharmaceutical composition may contain a steroid drug as a combination formulation. For example, the steroid drug may be triamcinolone. The combination formulation may be administered in combination with a PARP1 inhibitor, and may be administered simultaneously, sequentially or in reverse order. In one embodiment, it was confirmed that the combined use of rucaparib and triamcinolone showed a remarkably increased effect in the treatment of skin fibrosis disease.

As used herein, the term "skin fibrosis disease" refers to the occurrence of scarring or development of fibrous tissue due to excessive proliferation of epithelial cells or fibrous connective tissue. When a wound occurs, it is healed through the process of hemostasis, inflammation, proliferation, and remodeling. However, if the skin wound is severe or repeated, dysregulation occurs in the wound healing process, which may cause skin fibrosis disease by forming excessive fibrous connective tissue around the damaged skin tissue.

The skin fibrosis disease may be a concept encompassing fibrosis of any skin tissue and epithelial cells, scars, fibrosis of epithelial cells of the skin and scalp, and the like.

The scar may refer to a fibrous tissue that replaces the normal tissue destroyed by injury or disease. Damage to the outer layer of the skin is healed by rebuilding the tissue, in which case the scarring can be insignificant. However, when the thick layer of tissue under the skin is damaged, the reconstruction becomes more complicated. The body accumulates collagen fibers (a protein that is produced naturally by the body), which usually causes distinct scars.

The skin fibrosis disease is keloid, scleroderma, connective tissue disease, hypertrophic scar, atrophic scar, or stretch marks keloid. ), skin sclerosis (Scleroderma), or connective tissue disease (connective tissue disease).

As used herein, the term "prevention" includes all actions of inhibiting or delaying skin fibrosis disease by administering a pharmaceutical composition according to an aspect to an individual. As used herein, the term "treatment" refers to any action to improve or benefit the symptoms of skin fibrosis disease by administering a pharmaceutical composition according to an aspect to an individual.

The pharmaceutical composition may be administered to mammals including humans by various routes. The mode of administration may be any mode commonly used, and may be administered by, for example, oral, skin, intravenous, intramuscular, or subcutaneous routes.

The pharmaceutical composition may further include an appropriate carrier, excipient, or diluent commonly used in the preparation of a pharmaceutical composition. Preferably, the composition is a tablet, pill, powder, granule, capsule, suspension, solution, emulsion, syrup, sterilized aqueous solution, non-aqueous solvent, suspension, emulsion, freeze-dried preparation, transdermal absorbent, gel, lotion, Ointments, creams, patches, cataplasmas, pastes, sprays, skin emulsions, skin suspensions, transdermal delivery patches, drug-containing bandages and suppositories may have any one formulation selected from the group consisting of, oral or It may be a variety of parenteral formulations, but is not limited thereto.

In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose, or lactose ( lactose), gelatin, etc. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included. have. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The dosage of the pharmaceutical composition may vary depending on the individual's age, weight, sex, dosage form, health condition, and degree of disease, and dividedly administered once a day or several times a day at regular intervals according to the judgment of a doctor or pharmacist. You may. For example, the daily dosage may be 0.1 to 500 mg/kg, preferably 0.5 to 300 mg/kg, based on the content of the active ingredient. The above dosage is an example of an average case, and the dosage may be high or low depending on individual differences. If the daily dosage of the pharmaceutical composition is less than the dosage, a significant effect cannot be obtained, and if it exceeds the dosage, it is not only uneconomical, but also outside the range of the normal dosage, it may cause undesirable side effects. , It is better to fall within the above range.

Another aspect provides a method for preventing or treating skin fibrosis disease comprising administering the pharmaceutical composition to an individual in need thereof.

The pharmaceutical composition, skin fibrosis disease, prevention, treatment, etc. are as described above.

The method includes administering the pharmaceutical composition in a pharmaceutically effective amount to a subject suspected of having a skin fibrosis disease. The individual may refer to all mammals including dogs, cattle, horses, rabbits, mice, rats, chickens, or humans.

The 　 pharmaceutical composition may be administered parenterally, subcutaneously, intraperitoneally, intrapulmonally, and intranasally. Parenteral administration may include intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration. For example, the mode of administration of the pharmaceutical composition may be intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, and instillation. The dosage of the pharmaceutical composition varies depending on the condition and weight of the individual, the degree of disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art.

Since the PARP1 inhibitor exhibits an effect of significantly reducing the proliferation and mobility of cells undergoing skin fibrosis disease, the PARP1 inhibitor is administered to a subject suspected of skin fibrosis disease by administering a pharmaceutical composition containing the active ingredient By preventing the occurrence or progression of skin fibrosis disease can be treated.

Another aspect provides a composition for external application for skin for preventing or improving skin fibrosis disease, including an inhibitor of PARP1 expression or activity.

The PARP1 inhibitor, prevention, skin fibrosis disease, and the like are as described above.

In the present specification, the term "improvement" includes any act of applying the composition for external application for skin to an individual to improve or benefit the symptoms of skin fibrosis disease.

In the present specification, the term “skin 　 external preparation” is a concept that encompasses the general composition used for external use, and various pharmaceuticals such as cosmetic compositions or ointments including various cosmetics such as basic cosmetics, makeup cosmetics, hair cosmetics, and shaving cosmetics To quasi-drugs, and the like.

The skin 　 composition for external use is an ingredient that is usually formulated in 　 external preparations depending on the intended use and 　 external preparation 　 properties in addition to the active ingredient, specifically moisturizers, ultraviolet absorbers, vitamins, extracts of copper water, digestive agents, whitening agents, vasodilators, astringents, and refreshing agents. , Hormones, etc. may be additionally formulated.

The formulation of the skin 　 external composition may take an appropriate form depending on the intended use and the nature of the 　 external preparation 　 composition, specifically aqueous solution, solubilization, emulsification, emulsion, gel, paste, ointment, aerosol, water- It may be an oil two-layer system, water-oil-powder three-layer system, and the formulation and form of the external preparation of the present invention are not limited by the above formulation.

In addition, the 　skin 　 external preparation may additionally contain a base necessary to penetrate or transfer the active ingredient 　 into the skin tissue.

The composition comprising the PARP1 inhibitor according to one aspect as an active ingredient is effective in the treatment or prevention of skin fibrotic diseases by significantly reducing the proliferation and migration of keloid fibroblasts, the expression of skin fibrosis markers, and the size and hardness of keloid tissues. Can be used.

1 is a view showing the results of immunoblot analysis confirming that the protein expression of PARP1, smad3, and phosphorylated smad3 is increased in keloid tissues compared to normal skin tissues.
FIG. 2 is a diagram showing real-time PCR results confirming that rucaparib (20 μM) significantly reduces PARP1 mRNA expression in keloid fibroblasts.
3 is a diagram showing the results of immunoblot analysis confirming that rucaparib (20 μM) inhibits the expression of the PARP1 protein.
Figure 4 is a view showing the results of MTT analysis confirming the growth of keloid cells after treatment with rucaparib at various concentrations (0, 2, 10, or 20 μM).
5 shows that leukaparib (20 μM) alone can inhibit the proliferation of keloid fibroblasts, and in particular, the combination of leukaparib and triamcinolone significantly inhibits keloid fibroblasts compared to the case where leukaparib was treated alone. It is a diagram confirming that it shows an increased effect.
6 is a diagram showing the results of transwell analysis confirming that lucaparib (10 μM) decreases the ability to move skin fibroblasts.
Figure 7 is a rucaparib (20 μM) is a matrix metallopeptidase (MMP: matrix metallopeptidase)-1, 2, 3, 9, α-smooth muscle actin (SMA: α-smooth muscle actin), fibronectin in keloid fibroblasts, and It is a diagram showing the results of real-time PCR confirming that the mRNA expression of connective tissue growth factor (CTGF) is significantly reduced.
FIG. 8 is a view confirming that lucaparib significantly reduces the volume of transplanted keloid tissue derived from a patient compared to a control group.

It will be described in more detail through the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Confirmation of protein expression of PARP1 in keloid tissue

The purpose of this study was to determine the protein expression levels of PARP1, smad3 and phosphorylated smad3 in keloid tissues. Eight keloid patients were finally selected based on the following criteria, and keloid tissues and normal skin tissues were obtained from them through surgical excision: 1) The scar was elevated and expanded beyond the size of the initial injury or lesion, 2) Age 18 years of age or older, 3) surgical resection is scheduled, 4) no additional treatment or medication is received during the following examples or prior to surgical resection, and 5) consent to use data as basis for clinical studies . Fibroblasts were isolated from each tissue through primary cell culture. The skin is about 5 mm ³ It was cut into pieces. The epidermal layer and fat layer were removed using 2% dispase II (Sigma, St. Louis, MO, USA). The connective tissue was dissolved with 0.5 mg/mL collagenase A (Sigma) in a water bath at 37° C. for 3 hours. The digested solution was filtered through a 70 μm strainer (BD biosciences, San Diego, CA, USA). The cell pellet was resuspended and washed with 1Х Dulvesco phosphate buffered saline (Gibco, Gaithersburg, MD, USA). Cells were cultured in DMEM (Dulbecco's modified Eagle's medium, Welgene, Gyeongsan-si, Korea) supplemented with 10% fetal bovine serum (FBS, GenDepot, Barker, TX, USA) in a 5% CO ₂ incubator moisturized at 37°C. The cell culture medium was changed every 2-3 days, and the cells were subcultured when they showed 70% to 80% confluency. Normal human dermal fibroblasts (NHDF) were used as controls. All experiments were performed using the cells passaged 3 times.

Thereafter, the cells were lysed with lysis buffer for 20 minutes on ice and centrifuged at 14,000 g for 10 minutes at 4°C. The obtained samples were analyzed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a nitrocellulose membrane, diluted 1:1000, and an appropriate primary antibody (Biosource International , Camarillo, CA, USA). In addition, electrophoresis of protein extracts derived from keloid or normal skin tissue was performed using a Tris-glycerin buffer system, followed by blotting. The bound antibodies were visualized using a chemiluminescent substrate (ECL; Amersham, Arlington Heights, IL, USA) and exposed to a Kodak X-OMAT film (Kodak, New Heaven, CT, USA). The primary antibody against rabbit anti-PARP1 was purchased from Cell Signaling Technology (Danvers, MA, USA), and goat anti-actin antibody was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Densitometer analysis was performed with Image J software (National Institutes of Health, Bethesda, MD, USA).

As a result, as shown in FIG. 1, it was confirmed that the protein expression levels of PARP1 and smad3 were significantly increased in keloid tissues compared to normal skin tissues.

Example 2. Verification of efficacy of inhibitors of PARP1

In order to verify the efficacy of rucaparib as an inhibitor of PARP1, expression of PARP1 mRNA and protein according to rucaparib (20 μM) treatment in keloids obtained in the same manner as in Example 1 or fibroblasts of normal skin tissue Real-time PCR analysis and immunoblot analysis were performed to confirm the change.

Specifically, to confirm the expression level of PARP1 mRNA, total RNA was isolated using a reagent (15596026, Thermo Fisher Scientific, Waltham, MA USA), and Maxime ^TM RT-PCR PreMix (25131, iNtRON Biotechnology, Gyeonggi, Korea ) Was used to synthesize cDNA from total RNA of cells treated with mock-reagent or indicated-reagent. PCR using SYBR® Premix Ex Taq ^TM (Tli RNaseH Plus), (Cat.#RR420L, TAKARA BIO INC, Shiga, Japan) and CFX Connect ^TM real-time PCR detection system (Bio-Rad Laboratories, Inc, Hercules, California) Was performed. The expression level of PARP1 mRNA was normalized to 18S rRNA. The primer sequences for each gene are shown in Table 1 below. The experiment was repeated 9 times, and numerically expressed as an average (± standard deviation) and shown in Table 2 below.

Primer name Primer sequence Sequence number PARP1 forward GGAGTGGATGAAGTGGCGAA One PARP1 reverse CTACTCGGTCCAAGATCGCC 2 18s rRNA forward AAACGGCTACCACATCCAAG 3 18s rRNA reverse TACAGGGCCTCGAAAGAGTC 4

As a result, as shown in Table 2 and FIG. 2 below, when treatment with lucaparib, the level of mRNA expression of PARP1 was reduced in both normal skin tissue and keloid tissue, and in particular, the level of mRNA expression of PARP1 in fibroblasts of keloid tissue. It was confirmed that was significantly decreased.

Rucaparib (-) Rucaparib (+) Keloid fibroblasts 0.969 (± 0.12) 0.378 (± 0.21) Fibroblasts of normal skin (NHDF) 0.692 (± 0.11) 0.521 (± 0.01)

In addition, immunoblot analysis was performed to confirm the expression level of the PARP1 protein. After culturing a total of 30 Х10 ⁴ cells and treating the PRO-PREP ^TM protein extraction solution (17081, iNtRON Biotechnology, Gyeonggi, Korea) to isolate the protein, 30 ug of protein was added with 5X SDS sample buffer (250mM Tris-HCl, pH 6.8, 0.5M DTT, 10% SDS, 0.5% bromophenol blue, 50% glycerol) was added and then boiled for 5 minutes to perform SDS-PAGE and Western blotting. PARP1-specific (1:1000, 9542, Cell Signaling Technology, Danvers, MA, USA) or β-Actin-specific (1:5000, sc-47778, Santa Cruz Biotechnology, Inc, St. Louis, MO, USA) ) The antibody was diluted in 5% skim milk with TBS-Tween 20, incubated overnight at 4° C., washed and HRP-conjugated secondary antibodies (1:5000, GTX213110-01 and GTX213111-01, Gene tex, California, USA ) And incubated. For protein expression, chemifluorescence images were obtained using a G:BOX chemiluminescence system (XX6, Syngene, Maryland, USA).

As a result, as shown in FIG. 3, when the treatment with leukaparib, the expression of the PARP1 protein was reduced, and in particular, it was confirmed that the expression of the PARP1 protein was completely inhibited by the leukaparib after 24 hours.

Example 3. Confirmation of keloid proliferation inhibitory effect of PARP1 inhibitor

MTT that can evaluate the viability of keloid cells after treatment with various concentrations of rucaparib (0, 2, 10, 20 μM) in order to confirm the effect of keloid treatment by PARP1 inhibitor alone therapy or PARP1 inhibitor and combination therapy of triamcinolone Analysis was carried out. Specifically, using Cell Titer 96 Aqueous One Solution cell proliferation assay (Promega, Madison, WI), 3-(4,5-dimethylthiazol-2-yl, a colorimetric reagent by dehydrogenase found in metabolic proliferative cells) )-2,5-diphenyltetrazolium bromide (MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) based on cellular conversion to soluble promazan Was measured. After treatment with PARP1 inhibitor, rucaparib alone or with triamcinolone, 20 μL of dye solution was added to each well of a 96-well plate and incubated for 2 hours. Thereafter, absorbance was recorded at a wavelength of 490 nm using an ELISA plate reader (Molecular Devices, Sunnyvale, CA, USA).

As a result, as shown in Table 3 and FIG. 4, it was confirmed that when lucaparib was treated alone as a PARP1 inhibitor, proliferation of keloid fibroblasts could be inhibited at a concentration of 10 uM or 20 uM.

Cell viability (%, average) Standard deviation (STDEV) Lucaparib 0 uM 100 3.845 Lucaparib 2 uM 100.097 0.982 Lucaparib 10 uM 97.365 2.687 Lucaparib 20 uM 84.805 2.602

In addition, as shown in Table 4 and FIG. 5, it was confirmed that the combination of leukaparib and triamcinolone inhibited the proliferation of keloid fibroblasts more significantly compared to the case of treatment with leukaparib alone.

Cell viability (%, mean ± standard deviation) Control 100 (± 5.92) Lucaparib 20 uM 65.35 (± 4.25) Lucaparib 20 uM + Triamcinolone 20 uM 61.84 (± 1.24) Lucaparib 20 uM + Triamcinolone 50 uM 48.83 (± 3.30)

Example 4. Confirmation of effect of PARP1 inhibitor to inhibit migration of keloid fibroblasts

The migration of fibroblasts was measured using a 6.5 mm Transwell® with 8.0 μm Pore Polycarbonate Membrane Insert (3422, Corning Incorporated, New York, US). DMEM (Dulbecco's modified Eagle's medium, Welgene, Gyeongsan-si, Korea) containing 1% FBS was added to the lower well of the transwell, and fibroblasts were respectively 1.2 Х 10 ⁴ or 2 Х 10 ⁴ cells/mL in serum-free DMEM. It was incubated on the insert for 24 hours under the condition of. After removal of the medium, it was dried for 30 minutes, and then treated in 4% paraformaldehyde solution (PFA) for 5 minutes. After washing the transwell twice with 1X PBS, 700ul of 0.1% crystal violet was added and incubated at room temperature for 30 minutes. After removing the crystal violet stain and washing twice with 1X PBS, the inside of the insert was gently wiped using a cotton wool to remove unmoved cells. After 200 μL of 100% acetic acid was added to each well, 150 μL was transferred to a 96-well place and absorbance was measured at OD 564 nm using an ELISA microplate reader (Versamax, Molecular Devices, California, USA).

As a result, as shown in Table 5 and FIG. 6, it was confirmed that rucaparib as a PARP1 inhibitor significantly reduced the migration of keloid fibroblasts.

1.2Х10 ⁴ cells/mL 2Х10 ⁴ cells/mL Control Lucaparib 10 μM Control Lucaparib 10 μM Average 0.242 0.188 0.287 0.247 Standard deviation (STDEV) 0.015 0.008 0.008 0.011

Example 5. Confirmation of the effect of PARP1 inhibitor on reducing the expression of fibrosis markers

Total RNA was isolated using TRIZOL ^TM reagent (15596026, Thermo Fisher Scientific, Waltham, MA USA), and mock-reagent or indicated- using Maxime ^TM RT-PCR PreMix (25131, iNtRON Biotechnology, Gyeonggi, Korea). CDNA was synthesized from total RNA of cells treated with reagents. Using ^{SYBR® Premix Ex Taq TM (Tli RNaseH} Plus), (Cat. # RR420L, TAKARA BIO INC, Shiga, Japan) and CFX Connect ^TM Real-time PCR detection system (Bio-Rad Laboratories, Inc, Hercules, California, USA) Then, PCR was performed. Gene expression was normalized with 18S rRNA. Primer sequences for PARP1 and 18s rRNA genes are shown in Table 1, and primer sequences for other genes are shown in Table 6 below.

Primer name Primer sequence Sequence number MMP1 forward CAGAGATGAAGTCCGGTTTTTC 5 MMP1 reverse GGGGTATCCGTGTAGCACAT 6 MMP2 forward CCACTGCCTTCGATACAC 7 MMP2 reverse GAGCCACTCTCTGGAATCTTAAA 8 MMP3 forward CAAAACATATTTCTTTGTAGAGGACAA 9 MMP3 reverse TTCAGCTATTTGCTTGGGAA 10 MMP9 forward ATTCAGGGAGACGCCCATTT 11 MMP9 reverse CTGCGTTTCCAAACCGAGTT 12 SMA forward GACAATGGCTCTGGGCTCTGTAA 13 SMA reverse CTGTGCTTCGTCACCCACGTA 14 fibronectin forward CAGTGGGAGACCTCGAGAAG 15 fibronectin reverse TCCCTCGGAACATCAGAAAC 16 CTGF forward AATGCTGCGAGGAGTGGGT 17 CTGF reverse GGCTCTAATCATAGTTGGGTCT 18 TGF-β1 forward GGACACCAACTATTGCTTCAG 19 TGF-β1 reverse TCCAGGCTCCAAATGTAGG 20

As a result, as shown in Table 7 and FIG. 6, it was confirmed that rucaparib as a PARP1 inhibitor significantly inhibited the mRNA expression of fibrotic markers including MMP1, MMP2, MMP3, MMP9, α-SMA, fibronectin, and CTGF. I did.

Relative expression level by fibrosis marker gene (mean ± standard deviation (STDEV)) Control Lucaparib 20 uM MMP1 1.0 ± 0.01865 0.00569 ± 0.00099 MMP2 1.0 ± 0.07129 0.13684 ± 0.00456 MMP3 1.0 ± 0.00328 0.00463 ± 0.00104 MMP9 1.0 ± 0.01960 0.15621 ± 0.00608 α-SMA 1.0 ± 0.00575 0.00445 ± 0.00167 fibronectin 1.0 ± 0.04475 0.01702 ± 0.00226 CTGF 1.0 ± 0.01211 0.02046 ± 0.01988 PARP1 1.0 ± 0.03899 0.26047 ± 0.00485 TGFb1 1.0 ± 0.04753 0.00332 ± 0.0

Example 6. Confirmation of keloid treatment effect of PARP1 inhibitor through animal model experiment

Experiments were conducted using a patient-derived keloid xenograft model of four 7-week-old ICR mice (Orient Bio co., Seongnam, South Korea). The environment of the light dark cycle was maintained at intervals of 12 hours at a temperature of 20°C to 22.8°C. Two rats were randomly assigned into two groups, and keloid tissues derived from patients were transplanted into the backs of all mice. From 7 days after transplantation, lucaparib (1 mM, 0.5 mL) was injected subcutaneously into the experimental group for 1 week, and PBS (0.5 mL) was subcutaneously injected into the control group for 1 week. Twelve weeks after transplantation, the transplanted keloid tissue was collected by sterile draping, and the size and hardness of the tissue were checked.

As a result, as shown in FIG. 8, it was confirmed that the size of the keloid tissue was reduced to about 55% and the relative tissue hardness was decreased in the mouse treated with lucaparib compared to the control mouse. From the above results, it can be confirmed that rucaparib as a PARP1 inhibitor significantly reduces the size and hardness of the keloid tissue to exhibit a therapeutic effect.

<110> CHA University Industry-Academic Cooperation Foundation <120> Pharmaceutical composition for treating skin fibrosis comprising PARP1 inhibitor <130> PN128024 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PARP1 forward <400> 1 ggagtggatg aagtggcgaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PARP1 reverse <400> 2 ctactcggtc caagatcgcc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s rRNA forward <400> 3 aaacggctac cacatccaag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s rRNA reverse <400> 4 tacagggcct cgaaagagtc 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MMP1 forward <400> 5 cagagatgaa gtccggtttt tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP1 reverse <400> 6 ggggtatccg tgtagcacat 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MMP2 foward <400> 7 ccactgcctt cgatacac 18 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MMP2 reverse <400> 8 gagccactct ctggaatctt aaa 23 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MMP3 forward <400> 9 caaaacatat ttctttgtag aggacaa 27 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP3 reverse <400> 10 ttcagctatt tgcttgggaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP9 forward <400> 11 attcagggag acgcccattt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP9 reverse <400> 12 ctgcgtttcc aaaccgagtt 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SMA forward <400> 13 gacaatggct ctgggctctg taa 23 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SMA reverse <400> 14 ctgtgcttcg tcacccacgt a 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fibronectin forward <400> 15 cagtgggaga cctcgagaag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fibronectin reverse <400> 16 tccctcggaa catcagaaac 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF forward <400> 17 aatgctgcga ggagtgggt 19 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CTGF reverse <400> 18 ggctctaatc atagttgggt ct 22 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TGF-beta1 forward <400> 19 ggacaccaac tattgcttca g 21 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TGF-beta1 reverse <400> 20 tccaggctcc aaatgtagg 19

Claims (11)

PARP1 (poly [ADP-ribose] polymerase 1) As a pharmaceutical composition for the prevention or treatment of skin fibrosis disease comprising an expression or activity inhibitor as an active ingredient, the PARP1 inhibitor is a pharmaceutical composition that is rucaparib (rucaparib). The pharmaceutical composition according to claim 1, wherein the PARP1 activity inhibitor is an antibody that specifically binds to PARP1 protein or a fragment thereof, an antigen-binding fragment thereof, a peptide, a protein, or a combination thereof. The pharmaceutical composition of claim 1, wherein the PARP1 expression inhibitor is a siRNA specific for PARP1, an RNA aptamer, a ribozyme, an antisense nucleic acid molecule complementarily binding to a nucleotide sequence encoding PARP1, or a combination thereof. delete The pharmaceutical composition according to claim 1, comprising a steroid drug as a combination formulation. The pharmaceutical composition of claim 5, wherein the steroid drug is triamcinolone. The method according to claim 1, wherein the skin fibrosis disease is keloid, scleroderma, connective tissue disease, hypertrophic scar, atrophic scar, or stretch marks. marks) is a pharmaceutical composition. The pharmaceutical composition of claim 1, wherein the PARP1 inhibitor exhibits any one or more selected from the following properties:
(a) suppression of expression of one or more genes selected from the group consisting of Matrix metalloproteinase 1 (MMP1), MMP2, MMP3, MMP9, α-smooth muscle actin (α-SMA), fibronectin, and connective tissue growth factor (CTGF);
(b) inhibition of proliferation of keloid fibroblasts;
(b) inhibition of migration of keloid fibroblasts; And
(c) Reduction in size and hardness of keloid tissue. A composition for external application for skin for the prevention or improvement of skin fibrosis diseases comprising a PARP1 expression or activity inhibitor, wherein the PARP1 inhibitor is rucaparib. The composition for external application for skin according to claim 9, comprising a steroid drug as a combination formulation. The method of claim 9, wherein the skin fibrosis disease is keloid, scleroderma, connective tissue disease, hypertrophic scar, atrophic scar, or stretch marks. marks) that the external composition for skin.

Images