CN114634927A - Synthetic decoy oligonucleotides inhibiting HIF-1 alpha and STAT5 transcription factors and pharmaceutical compositions containing same - Google Patents

Abstract

The present invention relates to synthetic decoy oligonucleotides that inhibit HIF-1 α and STAT5 transcription factors and pharmaceutical compositions containing the same. HIF-1. alpha. decoy oligonucleotide, STAT5 decoy oligonucleotide, and HIF-1. alpha./STAT 5 decoy oligonucleotide comprising these linked together have been confirmed to have effects of inhibiting the effects of HIF-1. alpha. and STAT5 in an animal model of atopic dermatitis, reducing the thickness of epidermis and dermis, inhibiting infiltration of immune cells, inhibiting the activation and degranulation of mast cells, and inhibiting the expression of particulate matter of mast cells and inflammatory cytokines, and therefore, can be used for the treatment of atopic dermatitis.

Description

Synthetic decoy oligonucleotides inhibiting HIF-1 alpha and STAT5 transcription factors and pharmaceutical compositions containing same

Technical Field

The present invention relates to a synthetic decoy oligonucleotide inhibiting HIF-1 α and STAT5 transcription factors and a pharmaceutical composition for preventing or treating atopic dermatitis containing the same as an active ingredient.

Background

Atopic dermatitis (atopic dermatitis: AD), a chronic recurrent eczema disease, is characterized by inflammatory dermatitis, pruritus and severe xerosis cutis.

The cause of atopic dermatitis is estimated to be caused by complicated interaction of various factors such as abnormality of immune system, genetic factor, loss of skin barrier function, environmental factor, etc., but it is not clearly understood.

Atopic dermatitis is known to cause IgE sensitization (sensitization) to a specific antigen due to primary immune abnormality, thereby elevating IgE in blood and activating T helper type 2 cells (Th2 cells), eosinophils, dendritic cells, and the like. In particular, IgE is intricately associated with the high affinity IgE receptor (fcepsilonr °) present on the surface of mast cells to activate the mast cells. Activated mast cells secrete immune mediators and the like including histamine, chemokines, cytokines and the like, and such cytokines promote Th 2-subtype T cell responses, induce itch and inflammatory responses, thereby causing atopic dermatitis to develop. Moreover, mast cells do not die after degranulation and re-granulate and can thus be reactivated, thereby providing sustained stimulation within the tissue upon exposure to foreign antigens. With the early mediated response of mast cells, influx of acidic leukocytes, basic leukocytes and lymphocytes occurs, and the later phase response induces chronic inflammation of the tissue. Therefore, modulation of apoptosis and activation of mast cells is considered to be an important strategy for the treatment of atopic dermatitis.

As a therapeutic agent for atopic dermatitis, topical corticosteroids, antihistamines, immunosuppressive agents, and the like are used. However, the effect of the above-mentioned therapeutic agents is known to temporarily relieve symptoms, and if used for a long period of time, the effect is reduced and side effects are shown. In particular, the steroid preparations for external use cause various side effects such as skin atrophy, vasodilation, depigmentation and striae distensae when used for a long period of time. Therefore, development of a novel therapeutic agent for the treatment and prevention of atopic dermatitis is required.

In atopic dermatitis, representative of proteins that induce survival and activation of mast cells are HIF-1 α and STAT 5. HIF-1 α has been reported as a result of studies on inhibition of PPAR γ, a protein that induces mast cell apoptosis in inflammatory diseases such as atopic dermatitis, and it is known that STAT5 protein is involved in inflammatory reactions, a transcription factor typically involved in growth, survival and activation of mast cells by inducing expression of Bcl2 family proteins.

Gene therapy refers to a technique for treating and preventing diseases by delivering a gene expression-regulating substance to cells and tissues of a patient to regulate the expression of a specific gene. Decoy oligonucleotides (decoy oligodeoxynucleotides), decoy ODNs, as synthetic gene therapeutics containing a base sequence to which a target transcription factor (transcription factor) is bound, are a tool for effectively inhibiting the expression of disease-related genes by inhibiting the action of transcription factors. That is, the DNA binding site of the transcription factor is bound to the decoy oligonucleotide, so that the transcription factor cannot bind to the promoter of the target gene, and the activity of the transcription factor is inhibited, thereby reducing the expression of the specific gene.

Korean laid-open patent No. 2016-0089000 discloses a novel synthetic oligodeoxynucleotide that inhibits both DNA and RNA and a pharmaceutical composition for prevention and treatment of fibrotic diseases containing the same as an active ingredient, and Korean laid-open patent No. 101869308 discloses a SREBP-1 decoy oligodeoxynucleotide and a pharmaceutical composition for prevention or treatment of fatty liver diseases containing the same as an active ingredient, but does not disclose the synthetic decoy oligonucleotide of the present invention that inhibits HIF-1. alpha. and STAT5 transcription factors and a pharmaceutical composition for prevention or treatment of atopic dermatitis containing the same as an active ingredient.

Documents of the prior art

Patent document

(patent document 0001) Korean laid-open publication No. 10-1869308 (2018.06.14)

Disclosure of Invention

According to one embodiment, a decoy oligonucleotide is provided which treats atopic dermatitis by inhibiting HIF-1 α and STAT5, which are transcription factors.

According to one embodiment, there is provided an atopic dermatitis therapeutic agent comprising a decoy oligonucleotide for treating atopic dermatitis by inhibiting HIF-1 α and STAT 5.

In one embodiment, a HIF-1. alpha. decoy oligonucleotide consisting of the base sequence of SEQ ID NO. 1 is provided.

The bases CACGT 8 to 12 and ACGTG 23 to 27 in SEQ ID NO. 1 constitute a complementary binding structure, and bind to HIF-1. alpha. to inhibit it. (refer to FIG. 1)

The base No. 16 to 19 AAAA in SEQ ID NO. 1 may form a loop (loop).

The backbone of the oligonucleotide may be deoxyribose, ribose, or a modified form thereof, but is not particularly limited.

In another mode, a STAT5 decoy oligonucleotide consisting of the base sequence of SEQ ID NO. 2 is provided.

The bases TTCCCGGAA 7 to 15 and base TTCCGGGAA 24 to 32 in SEQ ID NO. 2 constitute a complementary binding structure, and bind to STAT5, thereby inhibiting it.

The 18 to 21 bases AAAA in SEQ ID NO. 2 may form a loop.

In another embodiment, an HIF-1. alpha. decoy oligonucleotide comprising the base sequence of SEQ ID NO. 1 and an HIF-1. alpha./STAT 5 decoy oligonucleotide comprising a STAT5 decoy oligonucleotide comprising the base sequence of SEQ ID NO. 2 are linked to each other.

The ligation may be performed by ligase (ligation).

The HIF-1 α/STAT5 decoy oligonucleotide described above may comprise 2 loop structures.

The HIF-1 α/STAT5 decoy oligonucleotide described above may comprise 1 stem structure, and in the stem structure described above, a site that can bind to the DNA binding site of HIF-1 α and a site that can bind to the DNA binding site of STAT5 may be included.

The HIF-1. alpha./STAT 5 decoy oligonucleotide can be produced by denaturing (denaturation) and annealing (ligation) a HIF-1. alpha. decoy oligonucleotide comprising the base sequence of SEQ ID NO. 1 and a STAT5 decoy oligonucleotide comprising the base sequence of SEQ ID NO. 2.

In another embodiment, there is provided a composition for preventing or treating atopic dermatitis, which comprises one or more decoy oligonucleotides selected from the group consisting of the HIF-1. alpha. decoy oligonucleotides, STAT5 decoy oligonucleotides, and HIF-1. alpha./STAT 5 decoy oligonucleotides described above.

The composition for preventing or treating atopic dermatitis may be a pharmaceutical composition. In the above composition, a pharmaceutically acceptable carrier, excipient or diluent may be further included. Furthermore, oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols; an external preparation; the suppository and the sterile injection are used in the form of a dosage form, but are not limited thereto. Carriers, excipients and diluents which may be included in the composition may be, for example, lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, the preparation can be carried out using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant, which is generally used. In the solid dosage form for oral administration, it may include tablets, pills, powders, granules, capsulesSuch a solid dosage form may be produced by mixing at least one excipient, such as starch, Calcium carbonate (Calcium carbonate), Sucrose (Sucrose) or Lactose (Lactose), gelatin, or the like, with the extract. Besides simple excipients, lubricants such as magnesium stearate and talc may also be used. The liquid form for oral administration may be in the form of a suspension, an internal liquid, an emulsion, or a syrup, and may contain various excipients such as a wetting agent, a sweetener, an aromatic agent, a preservative, and the like, in addition to water or liquid paraffin, which are commonly used as a simple diluent. In dosage forms for non-oral administration, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories may be included. As the nonaqueous solvent or suspending agent, a vegetable oil such as Propylene glycol (Propylene glycol), polyethylene glycol, or olive oil, an injectable ester such as ethyl oleate, or the like can be used. As the base of suppository, Vitepsol (Witepsol), polyethylene glycol, Tween 61, cacao butter, and laurate can be used

Glycerogelatin, and the like. Suitable pharmaceutically acceptable carriers and dosage forms are described in detail in Remington's pharmaceutical Sciences,19th ed., 1995.

The appropriate dosage of the above composition may be variously modified depending on the formulation method, administration mode, age, body weight, sex, disease state, diet, administration time, administration route, excretion rate, reaction sensitivity and the like of the patient. The concentration of the active ingredient contained in the above composition may be determined in consideration of the purpose of treatment, the state of the patient, the required time, and the like, and is not limited to a specific range of concentration.

Effects of the invention

The decoy oligonucleotide according to one embodiment inhibits expression of HIF-1 α and/or STAT5, and thus can be used in the treatment of atopic dermatitis.

Drawings

FIG. 1 shows the process of making HIF-1 α/STAT5 decoy ODNs.

FIG. 2 is a result of confirming the inhibitory effect of HIF-1 α/STAT 5-decoy ODN on HIF-1 α and STAT5 expression in an atopic dermatitis animal model.

FIG. 3 is a result of confirming the inhibitory effects of HIF-1 α/STAT 5-decoy ODN on skin tissue damage, increase in thickness of epidermis and dermis, and infiltration of inflammatory cells in an animal model of atopic dermatitis.

FIG. 4 is a result of confirming the inhibitory effect of HIF-1 α/STAT 5-decoy ODN on the increase in the number of mast cells and degranulation in skin tissues in an animal model of atopic dermatitis.

FIG. 5 is a result of confirming the inhibitory effect of HIF-1 α/STAT 5-decoy ODN on TNF- α expression in skin tissues in an atopic dermatitis animal model by immunochemical staining.

FIG. 6 is a result of confirming the effect of HIF-1 α/STAT 5-decoy ODN on the inhibition of TNF- α and IL-1 β expression in skin tissues in an animal model of atopic dermatitis by Western blotting.

FIG. 7 is a result of confirming the inhibitory effect of HIF-1 α/STAT 5-decoy ODN on Tryptase (Tryptase) expression in an atopic dermatitis animal model by immunochemical staining.

FIG. 8 is a result of confirming the inhibitory effect of HIF-1 α/STAT 5-decoy ODN on Tryptase (Tryptase) expression in an atopic dermatitis animal model by Western blotting.

FIG. 9 shows the results of confirming the restoring effect of HIF-1 α/STAT 5-decoy ODN on filaggrin expression in an animal model of atopic dermatitis.

Detailed Description

One or more specific examples will be described in more detail below with reference to examples. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

Example 1: production of HIF-1. alpha./STAT 5 decoy ODN

The base sequences of HIF-1. alpha./STAT 5 decoy oligonucleotides (oligodeoxynucleotides), ODNs, and Scr (scrambled) ODNs are shown in Table 1 below. The Scr ODN was used as an ODN without any effect as a control group.

[ Table 1]

SEQ ID	Name(s)	Sequence (5' ->3’)
			1	HIF-1αODN	AATTCGTCACGTATGAAAACATACGTGACG
2	STAT5 ODN	AATTCTTTCCCGGAAACAAAAGTTTCCGGGAAAG
			3	Scr ODN	GAATTCCAGGTACGGCAAAAAATTGCCGTACCTG

HIF-1. alpha. ODN and STAT5 ODN each constitute a stem-loop structure. These were denatured at 95 ℃ for 3 minutes, and then annealed while decreasing the temperature from 80 ℃ to 25 ℃. The annealed HIF-1 α/STAT5 ODN was ligated (ligation) for 16 to 18 hours by adding T4 ligase (T4 ligation), thereby producing a globular HIF-1 α/STAT5 decoy ODN. (refer to FIG. 1)

Example 2: preparation of animal model of atopic dermatitis induced by DNCB and house dust mite extract (DfE)

To prepare an atopic dermatitis animal model, female Balb/c mice weighing 20-25 g were purchased and stabilized for about 7 days. After the stabilization period, the hair from the lower ear to the upper tail of the mice was removed and left for 24 hours to allow the skin to heal spontaneously. Then, 200ul of a 1% DNCB (2,4-dinitrochlorobenzene)) solution (acetone: olive oil ═ 3:1) was applied to the unhaired site, thereby inducing skin sensitization. After 1 week from the initial DNCB application day, 200ul of 1% DNCB was repeatedly applied 4 times per week, and 200ul of DfE (dermophagoides farinaceae extract) was applied 4 days later, thereby inducing atopic dermatitis. During the coating DfE, the Scr ODN, the HIF-1. alpha. decoy ODN, the STAT5 decoy ODN, and the HIF-1. alpha./STAT 5 decoy ODN were injected at 1-week intervals through the tail vein of the mice at 10. mu.g, respectively. (10. mu.g of the decoy ODN were each mixed with 600ul of TransIT solution and administered by tail vein injection)

Example 3: inhibitory Effect of HIF-1 α and STAT5 expression in HIF-1 α/STAT 5-decoy ODN

Scr ODN, HIF-1. alpha. decoy ODN, STAT5 decoy ODN, and HIF-1. alpha./STAT 5 decoy ODN were injected into the atopic dermatitis animal model of example 2, respectively. Skin tissues of the animal model were extracted and subjected to Western blotting (Western blot), thereby confirming the expression of the target protein.

According to FIG. 2, in the group to which DNCB + DfE and Scr were administered, HIF-1. alpha. and STAT5 were expressed more than in the normal control group (normal control (NC)). (Scr ODN is an ODN having no effect, and thus it is known that expressions of HIF-1. alpha. and STAT5 were increased by administration of DNCB and DfE.) when HIF-1. alpha. decoy ODN, STAT5 decoy ODN, or HIF-1. alpha./STAT 5 decoy ODN were injected into a group to which DNCB and DfE were administered, expressions of them were decreased. In particular, it was confirmed that the expression of HIF-1. alpha. and STAT5 was further suppressed and a synergistic effect was observed in the experimental group to which the HIF-1. alpha./STAT 5-decoy ODN was administered, as compared with the experimental group to which the HIF-1. alpha. -decoy ODN or STAT 5-decoy ODN was administered.

Example 4: inhibitory Effect of HIF-1 α/STAT 5-decoy ODN on skin tissue damage and inflammatory cell infiltration caused by atopic dermatitis

The skin of the atopic dermatitis animal model according to the above example 2 was taken and made into a paraffin section, which was stained with H & E to observe the change of skin tissue and infiltration of inflammatory cells.

As shown in fig. 3, in the skin tissue of the animals coated with DNCB and DfE and injected with Scr ODN, the skin tissue damage, the thickness of epidermis (epidermis) and dermis (dermis), and the infiltration degree of inflammatory cells were significantly increased compared to the normal control group (normal control (NC)). (in A of FIG. 3, DNCB + DfE is represented by D)

In contrast, in animals coated with DNCB and DfE and injected with HIF-1 α decoy ODN, STAT5 decoy ODN, or HIF-1 α/STAT5 decoy ODN, skin tissue damage, epidermal and dermal thickness, and infiltration of inflammatory cells were inhibited. In particular, HIF-1 α/STAT5 was found to be the most effective in inducing ODN.

Example 5: inhibitory Effect of HIF-1 α/STAT 5-decoy ODN on infiltration and degranulation of mast cells in skin tissues of animal models of atopic dermatitis

The skin extracted from the atopic dermatitis animal model according to the above example 2 was prepared into paraffin sections, and then applied with giemm (Giemsa) staining, thereby observing the infiltration, proliferation and degranulation degree of mast cells in the skin tissue.

As shown in fig. 4, in the skin of the animals coated with DNCB and DfE and injected with Scr ODN, the number of mast cells and the degree of degranulation were increased as compared with the NC group. (in A of FIG. 4, DNCB + DfE is represented by D)

However, in animals injected with HIF-1 α decoy ODN, STAT5 decoy ODN, or HIF-1 α/STAT5 decoy ODN, increases in the number of mast cells and degranulation were suppressed. In particular, it was confirmed that the increase in the number of mast cells and degranulation was significantly suppressed in the skin tissues of animals coated with DNCB and DfE and injected with HIF-1 α/STAT 5-decoy ODN.

To confirm whether the HIF-1 α/STAT 5-decoy ODN can inhibit serum IgE increase due to the development of atopic dermatitis, ELISA (enzyme-linked immunosorbent assay), enzyme-linked immunospecific assay (ELISA)) was performed using the serum of the atopic dermatitis animal model according to example 2, thereby confirming the expression amount of IgE. As a result, the values of blood IgE increased for the DNCB-and DfE-coated group and the DNCB-and DfE-coated and Scr ODN-injected group compared to the NC group. However, the group injected with HIF-1 α/STAT5 decoy ODN showed a significant reduction in blood IgE values.

Example 6: inhibitory effects of HIF-1 alpha/STAT 5-decoy ODN on inflammation-associated factors in animal models of atopic dermatitis

Based on the results of the above example 4, the expression change of inflammation-related factors of the atopic dermatitis animal model was observed. After the skin extracted from the atopic dermatitis animal model of example 2 was prepared into paraffin sections, immunochemical staining was performed to confirm the expression of TNF- α in the skin tissue.

According to fig. 5, the expression of TNF- α was significantly increased in the case of DNCB-coated and DfE-injected and Scr ODN-injected, but significantly decreased in the group of DNCB-coated and DfE-injected HIF-1 α/STAT 5-decoy ODN-injected.

In addition, protein blotting (Western blot) was performed using skin tissues extracted from the animal model of atopic dermatitis of example 2, and the expression of TNF-. alpha.and IL-1. beta.proteins, which are factors involved in inflammation, was confirmed.

According to FIG. 6, the expression of TNF-. alpha.and IL-1. beta. was significantly increased due to the coating of DNCB and DfE, but its expression was significantly decreased in the HIF-1. alpha./STAT 5-decoy ODN-treated group.

Example 7 Change in expression of mast cell-related factors by the HIF-1 α/STAT5 decoy ODN of the invention in an animal model of atopic dermatitis

The expression of Tryptase (Tryptase), one of degranulated materials of mast cells, was observed in the animal model of atopic dermatitis according to the above example 2. In order to confirm the expression of Tryptase (trypsin) in skin tissue, immunochemical staining was performed, and the expression of Tryptase (trypsin) protein was confirmed by Western blotting (Western blot).

From FIGS. 7 and 8, it was confirmed that the in-tissue expression and protein expression of Tryptase (Tryptase) were significantly increased due to DNCB and DfE, and the expression of Tryptase (Tryptase) was significantly decreased when HIF-1 α/STAT 5-decoy ODN was injected.

Example 8 changes in expression of skin Barrier-associated factors caused by the HIF-1 α/STAT5 decoy ODN of the invention in an animal model of atopic dermatitis

The expression of filaggrin (filaggrin), which is a major factor of the skin barrier, was observed in the animal model of atopic dermatitis according to example 2 above. In order to confirm the expression of filaggrin (filaggrin) in skin tissues, the skin taken from an atopic dermatitis animal model was prepared as a paraffin section, and then subjected to immunofluorescence staining.

According to fig. 9, in the skin tissue of the animals coated with DNCB and DfE and injected with Scr ODN, green fluorescence exhibited by the expression of filaggrin (filaggrin) was significantly reduced. However, in the experimental group injected with HIF-1 α/STAT5 decoy ODN, green fluorescence exhibited due to the expression of filaggrin (filaggrin) was restored to a level similar to NC.

<110> university school labor force team of Qiu and Tu Li university

<120> synthetic decoy oligonucleotide inhibiting HIF-1 alpha and STAT5 transcription factors and pharmaceutical composition containing the same

<130> PN200408

<160> 3

<170> KoPatentIn 3.0

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> HIF-1α ODN

<400> 1

aattcgtcac gtatgaaaac atacgtgacg 30

<210> 2

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> STAT5 ODN

<400> 2

aattctttcc cggaaacaaa agtttccggg aaag 34

<210> 3

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Scr ODN

<400> 3

gaattccagg tacggcaaaa aattgccgta cctg 34

Claims (4)

1. A HIF-1 alpha decoy oligonucleotide consists of a base sequence of SEQ ID NO. 1.

2. A STAT5 decoy oligonucleotide consisting of the base sequence of SEQ ID NO. 2.

3. An HIF-1 alpha/STAT 5 decoy oligonucleotide is formed by connecting an HIF-1 alpha decoy oligonucleotide composed of a base sequence of SEQ ID NO. 1 and a STAT5 decoy oligonucleotide composed of a base sequence of SEQ ID NO. 2.

4. A composition for preventing or treating atopic dermatitis, comprising one or more decoy oligonucleotides selected from the group consisting of the decoy oligonucleotides according to any one of claims 1 to 3.

Images