KR20220081067A - Recombinant yeast with enhanced ergothioneine productivity and method for producing ergothioneine using the same - Google Patents

Abstract

The present invention relates to a recombinant yeast having improved ergothioneine-producing ability and a method for producing ergothioneine using the same, wherein the recombinant yeast overexpresses EGT1, EGT2 and MET17 genes, thereby improving the production yield of ergothioneine. It is possible to more effectively produce a high concentration of ergothioneine using yeast.

Description

Recombinant yeast with enhanced ergothioneine productivity and method for producing ergothioneine using the same}

The present invention relates to a recombinant yeast having improved ergothioneine-producing ability and a method for producing ergothioneine using the same.

Ergothioneine is a natural amino acid derivative mainly produced from ergot or mushrooms, and is biosynthesized from histidine. Such ergothioneine is known as a water-soluble antioxidant, and in particular, it has excellent safety and stability, so it can be applied to the production of various products such as health functional foods, cosmetics, and pharmaceuticals.

In general, ergothioneine is extracted from mushrooms or produced through chemical synthesis, but ergothioneine extraction using mushrooms is economical and inefficient because of the long mushroom growth period and low production, and ergothioneine through chemical synthesis. Onein production has a problem that high manufacturing cost is required. In order to overcome this problem, recently, research to develop a recombinant microorganism producing ergothioneine has been conducted, and Escherichia coli, Streptomyces, Attempts have been made to produce ergothioneine in Aspergillus et al. However, the amount of ergothioneine produced from these recombinant microorganisms is insufficient for industrial mass production, and many studies are still needed to develop a method for producing ergothioneine.

Korean Patent No. 10-1704381 Korean Patent Registration No. 10-1832396 Korean Patent Registration No. 10-2116734

An object of the present invention is to provide a recombinant yeast having improved ergothioneine production ability.

Another object of the present invention is to provide a method for producing ergothioneine using the recombinant yeast.

As a result of research to develop a new method for improving the ergothioneine production ability, the present inventors introduced and overexpressed the genes EGT1, EGT2 and MET17 related to ergothioneine production in yeast. The present invention was completed by developing a recombinant yeast having

One aspect of the present invention provides a recombinant yeast having improved ergothioneine production ability by overexpressing EGT1, EGT2 and MET17 genes.

As used in the present invention, “improved productivity” means that the productivity of ergothioneine is increased compared to the parent strain. The parent strain means a wild-type or mutated strain to be mutated, and includes a target to be directly mutated or transformed with a recombinant vector. In the present invention, the parent strain may be yeast, wherein the yeast is not particularly limited and yeast known in the art may be used, but is not limited thereto.

"Recombinant yeast" used in the present invention refers to a yeast mutated to produce ergothioneine at a higher concentration than the parent strain.

The recombinant yeast is Saccharomyces cerevisiae ( S. cerevisiae ), Saccharomyces bayanus ( S. bayanus ), Saccharomyces boulardii ( S. boulardii ), Saccharomyces bulldery ( S. bulderi ), Saccharomyces cariocanus ( S. cariocanus ), Saccharomyces cariocus ( S. cariocus ), Saccharomyces chevalieri ( S. chevalieri ), Saccharomyces dyrenensis ( S. dairenensis ), Saccharomyces ellipsoideus ( S. ellipsoideus ), Saccharomyces eubayanus ( S. eubayanus ), Saccharomyces exigus ( S. exiguus ), Saccharomyces florenti Nous ( S. florentinus ), Saccharomyces kluyveri ( S. kluyveri ), Saccharomyces martiniae ( S. martiniae ), Saccharomyces monacensis ( S. monacensis ), Saccharomyces norben Sis ( S. norbensis ), Saccharomyces paradoxus ( S. paradoxus ), Saccharomyces pastorianus ( S. pastorianus ), Saccharomyces spencerorum ( S. spencerorum ), Saccharomyces selected from the group consisting of S. turicensis, S. unisporus , Saccharomyces ubarum , and S. zonatus. It may be one or more types.

According to one embodiment of the present invention, the recombinant yeast may be Saccharomyces cerevisiae.

According to an embodiment of the present invention, Saccharomyces cerevisiae BY4735 strain Neurospora crassa EGT1 and EGT2 genes introduced vector and Saccharomyces cerevisiae ) MET17 gene By transforming using a vector introduced with EGT1, EGT2 and MET17 genes overexpressed recombinant yeast was prepared.

The EGT1 and EGT2 genes are genes encoding ergothioneine biosynthesis proteins Egt-1 and Egt-2, respectively, which directly act in biosynthesis of ergothioneine from histidine, and are not present in Saccharomyces. Referring to FIG. 1 , Egt-1 catalyzes three methylation through SAM at the α-amino group of histidine to form hercynine, and then combines with cysteine and oxygen (O ₂ ) to Forms hercynylcysteine sulfoxide (Cys-HER), a precursor of ergothioneine, and Egt-2 catalyzes the removal of a cysteine residue from the sulfur (S) of Cys-HER, finally ergothio to form four

According to one embodiment of the present invention, the EGT1 and EGT2 genes may be derived from microorganisms that biosynthesize ergothioneine.

In this case, the ergothioneine biosynthetic microorganism may be Actinobacteria, Cyanobacteria, fungi, lactic acid bacteria, Escherichia coli, Streptococcus, etc., but is limited thereto not.

More specifically, the ergothioneine biosynthetic microorganism is Mycobacterium smegmatis ), Neurospora crassa ) and Schizosaccharomyces pombe ) At least one selected from the group consisting of It may be derived from microorganisms.

According to one embodiment of the present invention, the EGT1 and EGT2 genes may be derived from Neurospora crassa .

Also, according to one embodiment of the present invention, the EGT1 gene may be represented by the nucleotide sequence of SEQ ID NO: 1, and the EGT2 gene may be represented by the nucleotide sequence of SEQ ID NO: 2.

The MET17 gene is a gene encoding cysteine synthase MET17 involved in the homocysteine/cysteine biosynthetic pathway. 2, MET17 catalyzes the conversion of homocysteine from acetyl homoserine (O-acetyl-L-homoserine) and cysteine from acetylserine (O-acetylserine), and the homocysteine produced at this time is It is converted to cystathionine and cysteine by CYS4 and CYS3, respectively. As described above, the cysteine produced by MET17 can be supplied to produce hercynylcysteine sulfoxide, a precursor of ergothioneine.

According to one embodiment of the present invention, the MET17 gene may be derived from yeast that biosynthesizes cysteine.

The yeast is Saccharomyces cerevisiae ( S. cerevisiae ), Saccharomyces bayanus ( S. bayanus ), Saccharomyces boulardii ( S. boulardii ), Saccharomyces bulderi ( S. bulderi ) ), Saccharomyces cariocanus ( S. cariocanus ), Saccharomyces cariocus ( S. cariocus ), Saccharomyces chevalieri ( S. chevalieri ), Saccharomyces dyrenensis ( S dairenensis ), Saccharomyces ellipsoideus ( S. ellipsoideus ), Saccharomyces eubayanus ( S. eubayanus ), Saccharomyces exigus ( S. exiguus ), Saccharomyces florentinus ( S. florentinus ), Saccharomyces kluyveri ( S. kluyveri ), Saccharomyces martiniae ( S. martiniae ), Saccharomyces monacensis ( S. monacensis ), Saccharomyces norbensis ( S. norbensis ), Saccharomyces paradoxus ( S. paradoxus ), Saccharomyces pastorianus ( S. pastorianus ), Saccharomyces spencerorum ( S. spencerorum ), Saccharomyces turi Sensis ( S. turicensis ), Saccharomyces Unisporus ( S. unisporus ), Saccharomyces Uvarum ( S. uvarum ) and Saccharomyces zonatus ( S. zonatus ) 1 selected from the group consisting of It may be more than a species.

According to one embodiment of the present invention, the MET17 gene may be derived from Saccharomyces cerevisiae.

In addition, according to one embodiment of the present invention, the MET17 gene may be one represented by the nucleotide sequence of SEQ ID NO: 10.

According to an embodiment of the present invention, it was confirmed that the recombinant yeast (RY-3) overexpressing the EGT1, EGT2 and MET17 genes produced ergothioneine compared to the yeast (RY-1) to which the genes were not introduced, Compared to recombinant yeast (RY-2) in which only EGT1 and EGT2 genes are overexpressed, ergothioneine production is increased by more than 2 times, specifically 2 to 15 times, or 3 to 10 times, so that 200 to 400 mg of ergo per 1 liter of culture medium is increased. Thionein was produced.

In addition, according to an embodiment of the present invention, as a result of examining the effect of CYS3 and CYS4 involved in cysteine biosynthesis on ergothioneine production, overexpression of CYS3 or CYS4 genes together with EGT1, EGT2 and MET17 genes or CYS3 and CYS4 When all genes were overexpressed (RY-4, RY-5, RY-6), ergothioneine production was rather decreased compared to the case where only EGT1, EGT2 and MET17 genes were overexpressed (RY-3).

Recombinant yeast according to an embodiment of the present invention can be implemented through a recombinant vector containing the EGT1, EGT2 and MET17 genes in the parent strain.

As used herein, "recombinant vector" is an expression vector capable of expressing a target protein in a host cell, and refers to a genetic construct including essential regulatory elements operably linked to express a gene insert. Here, 'operably linked' refers to a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein are functionally linked to perform a general function. The operable linkage with the recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be easily performed using enzymes generally known in the art. have.

According to one embodiment of the present invention, the expression vector includes a promoter, an initiation codon, a stop codon, a polyadenylation signal, and a signal sequence for membrane targeting or secretion in addition to expression control elements such as an enhancer. may include Generic promoters may be constitutive or inducible. Prokaryotic cells include, but are not limited to, lac, tac, T3 and T7 promoters. Eukaryotic cells include simian virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, human immunodeficiency virus (HIV), such as the long terminal repeat (LTR) promoter of HIV, Moloney virus (Mo-MSV); There are promoters derived from cytomegalovirus (CMV), Epstein Barr virus (EBV), and Loose Sacoma virus (RSV), as well as promoters derived from the β-actin promoter, human hemoglobin, human muscle creatine, and human metallothionein. not limited

As used in the present invention, "transformation" refers to introducing a gene into a host cell so that it can be expressed in the host cell, and if the transformed gene can be expressed in the host cell, it is inserted into the chromosome of the host cell or added to the chromosome other than the chromosome. It may be included without limitation whatever is located. According to one embodiment of the present invention, the transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, lithium acetate method, polyethylene glycol (PEG) method, DEAE-dextran method , cationic liposome method, lithium acetate-DMSO method, etc. may be used, but is not limited thereto. According to an embodiment of the present invention, a lithium acetate method may be used.

The host cells include cells transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro. A host cell comprising the recombinant vector of the present invention is a recombinant host cell, a recombinant cell or a recombinant microorganism.

In addition, the recombinant vector according to the present invention may include a selection marker, the selection marker is for selecting a transformant (host cell) transformed with the vector, and the selection marker is processed or grown Since only the cells expressing the selection marker can survive in the medium from which the specific components required for the transformation have been removed, the selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, antibiotics kanamycin, streptomycin, chloramphenicol, or amino acids or nucleic acids essential for growth, such as histidine, leucine, tryptophan, and uracil.

Genes inserted into the recombinant vector for transformation of the present invention can be substituted into host cells such as yeast and the like due to homologous recombination crossover.

In addition, another aspect of the present invention comprises the steps of i) culturing the recombinant yeast in a medium; and ii) recovering ergothioneine from the recombinant yeast or the culture medium in which the recombinant yeast is cultured.

The culture may be made according to an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.

According to one embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner, and may be appropriately modified by a person skilled in the art. According to an embodiment of the present invention, as the culture medium for yeast, YPD (Yeast extract-Peptone-Dextrose) medium may be used.

According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source may also be used individually or as a mixture, but is not limited thereto. Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. In addition, precursors suitable for the culture medium may be used. The medium or individual components may be added batchwise or continuously by an appropriate method to the culture medium during the culturing process, but is not limited thereto.

According to one embodiment of the present invention, it is possible to adjust the pH of the culture medium by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microorganism culture medium in an appropriate manner during culture. In addition, it is possible to suppress the formation of bubbles by using an antifoaming agent such as fatty acid polyglycol ester during culture. Additionally, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas (eg, air) may be injected into the culture. The temperature of the culture medium may be usually 20 °C to 45 °C, for example, 25 °C to 40 °C. The incubation period may be continued until a useful substance is obtained in a desired production amount, and may be, for example, 10 to 160 hours.

According to one embodiment of the present invention, the step of recovering ergothioneine from the cultured recombinant yeast or culture medium (culture medium) is ergothioneine produced from the medium using a suitable method known in the art according to the culture method. can be collected or retrieved. e.g. centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g. ammonium sulfate precipitation), chromatography (e.g. ion exchange, affinity, hydrophobicity and size exclusion) may be used, but is not limited thereto.

According to one embodiment of the present invention, in the step of recovering ergothioneine, biomass is removed by high-speed centrifugation of the culture, and the obtained supernatant is filtered and then separated through liquid chromatography.

According to one embodiment of the present invention, the step of recovering ergothioneine may include a step of purifying ergothioneine.

Since the recombinant yeast according to the present invention overexpresses the EGT1, EGT2 and MET17 genes, the yield of ergothioneine production is improved, and thus, it is possible to more effectively produce ergothioneine at a high concentration using the recombinant yeast.

1 is a production pathway of ergothioneine by ergothioneine biosynthetic proteins Egt-1 and Egt-2.
2 is a production pathway of cysteine by MET17, CYS3 and CYS4 in Saccharomyces cerevisiae .

Hereinafter, the present invention will be described in more detail. However, these descriptions are provided for illustrative purposes only to help the understanding of the present invention, and the scope of the present invention is not limited by these illustrative descriptions.

Example 1. Preparation of Recombinant Yeast

1-1. Preparation of vector for EGT1 and EGT2 gene introduction

Neurospora crassa ( Neurospora crassa ) Codon optimization (codon optimization) was performed with respect to the EGT1 and EGT2 genes, the EGT1 gene represented by the nucleotide sequence of SEQ ID NO: 1 and the EGT2 gene represented by the nucleotide sequence of SEQ ID NO: 2 obtained. The nucleotide sequence (SEQ ID NO: 3, CYC terminator-GPD promoter) linking the CYC terminator and GPD promoter for inserting the genes of EGT1 and EGT2 side by side into the p424 vector was also obtained through gene synthesis.

Among the obtained genes, EGT1 was amplified by PCR (repeat 28 times at 94°C for 3 minutes at 94°C, 30 seconds at 94°C, for 30 seconds at 54°C and 3 minutes at 72°C, for 5 minutes at 72°C) using primers 1 and 2 to obtain the PCR product. After purification, it was inserted into the p424 vector using restriction enzymes BamHI and SalI. PCR using primers 3 and 4 for insertion of the CYC terminator-GPD promoter sequence after the EGT1 gene (repeat 28 times at 94°C for 3 minutes, at 94°C for 30 seconds, at 54°C for 30 seconds and at 72°C for 1 minute and 30 seconds, 72°C 5 min), the amplified nucleotide sequence was separated and purified, and then inserted into the p424 vector with PstI, and clones with the correct gene orientation were selected. PCR using primers 5 and 6 to insert the EGT2 gene after the CYC terminator-GPD promoter (repeat 28 times at 94°C 3 minutes, then 94°C 30 seconds, 54°C 30 seconds, and 72°C 1 minute 30 seconds, 72°C 5 min) to amplify EGT2. After purifying the PCR amplification product, it was cloned into the p424 vector into which the EGT1 and CYC terminator-GPD promoters were inserted using restriction enzymes NotI and SalI, and the p424 vector for EGT1-EGT2 gene introduction (hereinafter '' EGT1-EGT2 p424 vector ') was prepared. The primers used here are shown in Table 1 below.

number Primer name Primer sequence (5'>3') SEQ ID NO: One EGT1-Bam-F AAGGATCCATGCCATCTGCTGAATCT 4 2 EGT1-PstSalI-R AAGTCGACCTGCAGTCACAAATCTCTAACAAC 5 3 CYC-GPD-PstI-F AACTGCAGTCATGTAATTAGTTATGTCACG 6 4 CYC-GPD-NotPstI-R TTCTGCAGGCGGCCGCTTCTAGAATCCGTCGAAACTAAG 7 5 EGT2-NotI-F AAGCGGCCGCATGGTTGCTACTACTGTTGAATTG 8 6 EGT2-Sal-R TTGTCGACTTAAGCAGATTCTTTGTAC 9

1-2. Preparation of vector for MET17 and/or CYS4 gene introduction

Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) Codon optimization was performed for MET17 and CYS4 genes, and the MET17 gene represented by the nucleotide sequence of SEQ ID NO: 10 was obtained. The CYS4 gene represented by the nucleotide sequence of SEQ ID NO: 11 is placed in front of the CYS4 gene by placing the CYC terminator-GPD promoter sequence in front of the CYS4 gene to insert the MET17 gene into the p425 vector in parallel with the CYC terminator-GPD promoter-CYS4 nucleotide sequence (sequence No. 12).

Among the obtained genes, MET17 was amplified by PCR (repeat 28 times at 94°C for 3 minutes at 94°C, 30 seconds at 94°C, 30 seconds at 54°C, and 1 minute and 30 seconds at 72°C, 72°C for 5 minutes) using primers 1 and 2 among the obtained genes. After the product was purified, it was inserted into the p425 vector using restriction enzymes SpeI and BamHI, and clones without error in the gene sequence were selected (hereinafter referred to as 'MET17 p425 vector'). PCR with primers 3 and 4 for insertion of the CYC terminator-GPD promoter-CYS4 gene sequence after the MET17 gene (repeat 28 times, 94°C 30 seconds, 54°C 30 seconds and 72°C 3 minutes after 94°C 3 minutes, 72°C 5 min), the amplified nucleotide sequence is separated and purified, inserted with BamHI and PstI, and clones without error in the gene sequence are selected to obtain the p425 vector for MET1-CYS4 gene introduction (hereinafter referred to as the 'MET17-CYS4 p425 vector'). prepared. The primers used here are shown in Table 2 below.

number Primer name Primer sequence (5'>3') SEQ ID NO: One Met17-Spe-F AAAATAGTATGCCATCTCACTTTGATACC 13 2 Met17-BamH-R TTGGATCCTTATGGCTTTTGACCAGCAA 14 3 GPD400-BamNhe-F TTGGATCCTCATGTAATTAGTTATGTCACGCT 15 4 Cys4-Pst-R TTCTGCAGTTAAGCCAAGTAAGACAACAA 16

1-3. Preparation of vector for EGT1 and/or CYS3 gene introduction

Codon optimization was performed on the CYS3 gene of Saccharomyces cerevisiae , and the CYS3 gene represented by the nucleotide sequence of SEQ ID NO: 17 was obtained.

The nucleotide sequences linking the EGT1 gene and the CYC terminator and the GPD promoter (CYC terminator-GPD promoter) were respectively the nucleotide sequences of SEQ ID NOs: 1 and 3.

The EGT1 gene was cloned into the p426 vector in the same way as the p426 vector cloning using primers 1 and 2 in Table 1 (hereinafter referred to as 'EGT1 p426 vector'). PCR using primers 1 and 2 of Table 3 below for insertion of the CYC terminator-GPD promoter sequence after the EGT1 gene (repeated 28 times after 94°C 3 minutes, 94°C 30 seconds, 54°C 30 seconds, and 72°C 1 minute, 28 times; 72° C. for 5 minutes) and inserted into the p426 vector using restriction enzyme SalI, and clones with the correct gene orientation were selected. To insert the CYS3 gene after the CYC terminator-GPD promoter sequence, PCR (28 times at 94°C 3 minutes, 94°C 30 seconds, 54°C 30 seconds, and 72°C 1 minute 30 seconds) using primers 3 and 4 in Table 3 below Repeat, 72° C. 5 min). After purifying the PCR amplification product, use the restriction enzyme NotI to clone the p426 vector into which the EGT1 and CYC terminator-GPD promoter sequences are inserted, and then select the clones without the gene sequence to select the p426 vector for EGT1-CYS3 gene introduction (hereinafter 'EGT1-CYS3 p426 vector') was prepared.

number Primer name Primer sequence (5'>3') SEQ ID NO: One CYC-GPD-SalI-F AAGTCGACTCATGTAATTAGTTATGTCACG 18 2 CYC-GPD-NotISalI-R TTGTCGACGCGGCCGCTTCTAGAATCCGTCGAAACTAAG 19 3 CYS3-NotI-F AAGCGGCCGCATGACTTTGCAAGAATCTGATA 20 4 CYS3-NotI-R TTGCGGCCGCTTAGTTAGTAGCTTGCTTCAAG 21

1-4. Preparation of Recombinant Yeast Using Saccharomyces cerevisiae

To prepare a recombinant yeast, Saccharomyces cerevisiae BY4735 (ATCC 200897) was used as the parent strain to be transformed, and a lithium acetate method was used as the transformation method.

First, the Saccharomyces cerevisiae BY4735 strain was inoculated in YPD (Yeast extract-Peptone-Dextrose) liquid medium, and then cultured at 30° C. and 200 rpm for 12 to 16 hours to achieve an OD ₆₀₀ value of 0.8 to 1.0. Thereafter, 10 mL of the culture solution was centrifuged at 500 g for 4 minutes, the supernatant was discarded, and the precipitated Saccharomyces cerevisiae BY4735 strain was washed once with TE buffer, and finally reproduced in 1 mL of 0.1M lithium acetate solution. It was cloudy to prepare a competent cell (competent cell).

In order to prepare a recombinant yeast introduced with the vector of the combination shown in Table 4 below, competent cells and each empty vector (EV), EGT1-EGT2 p424 vector, MET17 p425 vector, MET17-CYS4 p425 vector, EGT1 After mixing the p426 vector and the EGT1-CYS3 p426 vector, a transformation solution (containing polyethyleneglycol, lithium acetate and Salmon sperm DNA) was added and mixed, followed by heat shock at 42°C for 40 minutes. After the thermal shock was finished, centrifugation was performed at 500 g for 3 minutes, and the supernatant was removed and a precipitate was obtained. The precipitate was smeared on a solid selective medium (containing Glucose, Yeast nitrogen base, CSM-His-Leu-Trp-Ura, Histidine and Bactoagar) and cultured at 30°C for 3 to 4 days.

recombinant yeast p424 vector p425 vector p426 vector RY-1 EV EV EV RY-2 EGT1-EGT2 EV EGT1 RY-3 EGT1-EGT2 MET17 EGT1 RY-4 EGT1-EGT2 MET17 EGT1-CYS3 RY-5 EGT1-EGT2 MET17-CYS4 EGT1 RY-6 EGT1-EGT2 MET17-CYS4 EGT1-CYS3

Example 2. Comparison of Ergothioneine Productivity of Recombinant Yeast

The ergothioneine productivity was compared with respect to the recombinant yeast RY-1 to RY-6 prepared in Example 1.

One loop each of the recombinant yeast colonies cultured in the solid selective medium of Example 1-4 were inoculated into a liquid selective medium (containing Glucose, Yeast nitrogen base and CSM-Leu-Trp-Ura), and 72 at 30 ° C. After time incubation, 5 mL of yeast culture was taken and centrifuged at 3,000 rpm for 10 minutes to obtain only cells. Into the obtained cells, 2 mL of distilled water was added, and ergothioneine (EGT) was extracted while incubating for 1 hour in a thermostat at 95°C. Thereafter, the supernatant was separated by vortexing and centrifugation at 3,000 rpm for 10 minutes, followed by filtration through a 0.45 μm nitrocellulose filter to obtain a filtrate.

The amount of ergothioneine was measured from the filtrate using an ergothioneine standard (L-(+)-Ergothioneine, Sigma aldrich) and HPLC (Agilent 1200 series), and the results are shown in Table 5 below.

recombinant yeast Ergothioneine (mg/L) RY-1 - RY-2 59.47 RY-3 308.07 RY-4 20.15 RY-5 39.39 RY-6 -

As shown in Table 5, ergothioneine production was not confirmed in the control group (RY-1) into which the gene was not introduced, but recombinant yeast RY-3 overexpressing the EGT1, EGT2 and MET17 genes did not overexpress the MET17 gene. The productivity of ergothioneine was increased by about 5.2 times compared to the recombinant yeast RY-2 without the CYS3 gene, and the productivity of ergothioneine was about 15.3 times higher than that of the recombinant yeast RY-4 overexpressing the CYS3 gene, and the CYS4 gene was further overexpressed. It was confirmed that the productivity of ergothioneine was increased by about 7.8 times compared to that of the recombinant yeast RY-5.

On the other hand, the production of ergothioneine was not confirmed in the recombinant yeast RY-6, which simultaneously overexpresses EGT1, EGT2, MET17, CYS3 and CYS4 genes.

As a result, in the present invention, by inducing overexpression of EGT1, EGT2 and MET17 genes, a recombinant yeast having improved ergothioneine production ability compared to the parent strain was obtained, and using this recombinant yeast, a high concentration of ergothioneine could be produced in high yield. confirmed that there is.

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Kolon Industries, Inc. <120> Recombinant yeast with enhanced ergothioneine productivity and method for producing ergothioneine using the same <130> PN200346 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 2631 <212> DNA <213> Artificial Sequence <220> <223> EGT1 <400> 1 atgccatctg ctgaatctat gactccatct tctgctttgg gtcaattgaa agctactggt 60 caacatgtct tgtccaagtt gcaacaacaa acttccaacg ccgatatcat cgatattaga 120 agagttgccg ttgagatcaa cttgaaaacc gaaattacct ccatgttcag accaaaagat 180 ggtccaagac aattgccaac cttgttgttg tataacgaaa gaggcttgca gttgttcgaa 240 agaattactt acttggaaga gtactacttg accaacgacg agattaagat tttgactaag 300 cacgctactg aaatggcctc ttttattcca tctggtgcca tgattatcga actaggttct 360 ggtaatttga ggaaggtcaa cttgttgtta gaagctttgg ataatgctgg taaggccatt 420 gattattacg ccttggattt gtccagagaa gaattggaaa gaaccttggc tcaagtccca 480 tcttacaaac atgttaagtg tcatggtttg ttgggtactt acgatgatgg tagagattgg 540 ttgaaagctc cagaaaacat caacaagcaa aagtgcatac tgcatctggg ttcttctatt 600 ggtaacttca atagatctga tgctgccact tttttgaagg gtttcactga tg ttttgggt 660 ccaaacgata agatgttgat tggtgttgat gcttgtaacg atccagctag agtttaccat 720 gcttacaatg ataaggttgg tatcacccac gaattcatct tgaatggttt gagaaacgcc 780 aacgaaatta ttggtgaaac cgctttcatt gaaggtgatt ggagagttat cggtgaatac 840 gtttatgatg aagaaggtgg tagacatcaa gctttttatg ctccaactag agataccatg 900 gttatgggtg aattgatcag atcccatgac agaatccaaa tcgaacagtc tctgaagtac 960 tccaaagagg aatctgaaag attgtggtct actgctggtt tggaacaagt ttctgaatgg 1020 acttacggta atgaatacgg tttacatttg ttggccaagt ccagaatgtc cttctcattg 1080 attccatcag tttacgctag atctgctttg ccaactttgg atgattggga agctttgtgg 1140 gctacttggg atgttgttac tagacaaatg ttgccacaag aggaattatt ggagaagcca 1200 atcaagttga gaaatgcctg cattttctac ttgggtcata tcccaacttt cttggatatt 1260 cagttgacta agactaccaa gcaagctcca tctgaaccag ctcatttctg taagattttc 1320 gaaaggggta tcgatccaga tgttgacaat ccagaattgt gtcatgccca ttctgaaatt 1380 ccagatgaat ggccaccagt tgaagaaatt ttgacttacc aagaaaccgt cagatctaga 1440 ttgagaggtc tatatgctca tggtattgcc aacattccaa gaaatgtcgg tagagctatt 150 0 tgggttggtt tcgaacatga attgatgcac atcgagactc tgttgtacat gatgttgcaa 1560 tctgacaaga ccttgattcc aactcatatt ccaagaccag atttcgataa gttggctaga 1620 aaagccgaat cagaaagggt tccaaatcaa tggtttaaga tcccagctca agaaatcact 1680 attggtttgg atgaccctga agatggttcc gatattaaca aacattacgg ttgggataac 1740 gagaagccac caagaagagt tcaagttgct gcttttcaag ctcaaggtag accaattaca 1800 aacgaagaat acgcccaata cttgttggaa aagaacattg ataagttgcc agcttcttgg 1860 gctagattgg ataacgaaaa catttctaac ggcaccacca attctgtttc tggtcatcat 1920 tctaacagaa cctccaaaca acaactgcca tcttcattct tggaaaaaac tgctgttaga 1980 accgtttacg gtttggttcc attgaaacat gctttggatt ggccagtttt tgcttcctat 2040 gatgaattgg ctggttgtgc tgcttatatg ggtggtagaa ttccaacttt cgaagaaacc 2100 agatctatct acgcttatgc tgatgctctg aagaagaaga aagaagctga aagacaactg 2160 ggtagaactg ttccagctgt taatgctcat ttgactaaca acggtgttga aattactcct 2220 ccatcatcac catcatctga aactccagca gaatcttctt caccatctga ttctaacact 2280 accttgatta ccaccgagga tttgttctct gatttggatg gtgctaatgt tggtttccat 2340 aatt ggcatc caatgcctat tacttctaag ggtaatacct tggtcggtca aggtgaatta 2400 ggtggtgttt gggaatggac atcttccgtt ttgagaaaat gggaaggttt tgagccaatg 2460 gaattatacc caggttacac tgctgatttc tttgacgaaa agcacaacat cgttttaggt 2520 ggttcatggg ctactcatcc aagaattgct ggtagaaagt cttttgtcaa ctggtatcaa 2580 agaaactacc catatgcatg ggttggtgct agagttgtta gagatttgtg a 2631 <210> 2 <211> 1422 <212> DNA <213> Artificial Sequence <220> <223> EGT2 <400> 2 atggttgcta ctactgttga attgccattg caacaaaaag ctgatgctgc tcaaactgtt 60 actggtccat tgccatttgg taacagcttg ttgaaagaat tcgttttgga tccagcctac 120 agaaacttga atcatggttc ttttggtact atcccatccg ctattcaaca gaagttgaga 180 tcttatcaaa ctgctgctga agctagacca tgtccatttt tgagatatca aaccccagtt 240 ttgttggacg aatctagagc tgctgttgct aatttgttga aggttccagt tgaaaccgtt 300 gttttcgttg ctaatgctac tatgggtgtc aacactgttt tgagaaatat cgtttggtct 360 gctgatggta aggacgaaat cttgtacttt gatacaatct acggtgcttg cggtaagacc 420 attgattatg ttatcgaaga taagaggggc atcgtttcag ccg agattt accttcct ctagatgt ga tgttgttgca gcttttagag atgccatcaa gaagtctaga 540 gaagaaggta aaagaccaag attggccgtt atcgatgttg tttcttctat gccaggtgtt 600 agattcccat tcgaagatat cgttaagatc tgcaaagagg aagagatcat ttcttgcgtt 660 gatggtgctc aaggtattgg tatggttgat ttgaagatta ccgaaaccga tccagacttc 720 ctgatttcta attgtcataa gtggttgttc accccaagag gttgtgctgt tttttatgtt 780 ccagtcagaa accagcactt gatcagatct actttgccaa cttctcatgg tttcgttcca 840 caagttggta atagattcaa tccattggtt ccagctggta acaagtctgc ttttgtttct 900 aacttcgaat tcgttggtac tgtcgataac tctccattct tctgtgttaa ggatgctatt 960 aagtggcgtg aagaggtttt aggtggtgaa gaaagaatta tggagtacat gactaagttg 1020 gctagagaag gtggtcaaaa ggttgctgaa attttgggta ctagagtctt ggaaaactct 1080 accggtacat tgattagatg cgccatggtt aatattgcct tgccttttgt tgttggtgaa 1140 gatccaaaag ctccagttaa gttgaccgaa aaagaagaaa aagacgtcga aggcttgtac 1200 gaaattccac atgaagaggc taatatggct ttcaagtgga tgtacaacgt attgcaagat 1260 gagttcaata ccttcgttcc aatgaccttt catagacgta gattttgggc tagattgtcc 1320 gctcaagttt acttggaaat gtctgatttt gaatgggctg gcaagacctt aaaagaattg 1380 tgtgaaaggg ttgctaaggg cgagtacaaa gaatctgctt aa 1422 <210> 3 <211> 913 <212> DNA <213> Artificial Sequence <220> <223> CYC terminator-GPD promoter <400> ccagttatacgtcacctagttac agttagacaa cctgaagtct aggtccctat ttattttttt atagttatgt 120 tagtattaag aacgttattt atatttcaaa tttttctttt ttttctgtac agacgcgtgt 180 acgcatgtaa cattatactg aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt 240 taatttgcgg ccggtactca ttatcaatac tcgccatttc aaagaatacg taaataatta 300 atagtagtga ttttcctaac tttatttagt caaaaaatta gccttttaat tctgctgtaa 360 cccgtacatg cccaaaatag ggggcgggtt acacagaata tataacatcg taggtgtctg 420 ggtgaacagt ttattcctgg catccactaa atataatgga gcccgctttt taagctggca 480 tccagaaaaa aaaagaatcc cagcaccaaa atattgtttt cttcaccaac catcagttca 540 taggtccatt ctcttagcgc aactacagag aacaggggca caaacaggca aaaaacgggc 600 acaacctcaa tggagtgatg caacctgcct ggagtaaaatg tgactcactag g ttac cttctgctct ctctgatttg 720 gaaaaagctg aaaaaaaagg ttgaaaccag ttccctgaaa ttattcccct acttgactaa 780 taagtatata aagacggtag gtattgattg taattctgta aatctatttc ttaaacttct 840 taaattctac ttttatagtt agtctttttt ttagttttaa aacaccagaa cttagtttcg 900 acggattcta gaa 913 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223 > EGT1-Bam-F <400> 4 aaggatccat gccatctgct gaatct 26 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> EGT1-PstSalI-R <400> 5 aagtcgacct gcagtcacaa atctctaaca ac 32 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CYC-GPD-PstI-F <400> 6 aactgcagtc atgtaattag ttatgtcacg 30 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CYC-GPD-NotPstI-R <400> 7 ttctgcaggc ggccgcttct agaatccgtc gaaactaag 39 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223 > EGT2-NotI-F <400> 8 aagcggccgc atggttgcta ctactgttga attg 34 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> EGT2-Sal-R <400> 9 ttgtcgactt aagcagattc tttg tac 27 <210> 10 <211> 1335 <212> DNA <213> Artificial Sequence <220> <223> MET17 <400> 10 atgccatctc actttgatac cgttcaatta catgctggtc aagaaaaccc aggcgataac 60 gctcatagat ctagatta taggctgt tccaatcta gt tattattattt cggtaatta gttattattattt cggtaatta 180 aacccaactt ctaacgtctt ggaagaaaga atcgctgctt tggaaggtgg tgctgctgcc 240 ttggctgttt cttccggtca agctgctcaa acattggcta ttcaaggttt agctcacact 300 ggtgacaaca ttgtttctac ttcttacttg tacggtggta cttacaacca attcaaaatt 360 tcattcaaaa gatttggtat tgaagctaga ttcgttgaag gcgataatcc agaagaattt 420 gaaaaggttt ttgatgaaag aactaaagct gtttatttgg aaactattgg taacccaaag 480 tacaatgttc ctgatttcga aaagattgtt gctattgctc ataagcatgg tattccagtt 540 gtcgttgata atactttcgg tgctggtggt tatttctgtc aaccaattaa gtacggtgct 600 gatattgtta cccattctgc tactaagtgg attggtggtc atggcactac tatcggtggt 660 attatcgttg attccggtaa attcccttgg aaggattacc cagaaaagtt cccacaattc 720 acctcaaccag ctgaaggtta ccatggcact 780 ctacaaccagg ctgaaggtta ccatggcact acatcgttc atgttagaac tgaattattg agagatttgg gtccattgat gaatccattc 840 gcttcattcc tacttttaca aggtgttgaa accttgtctt taagagccga aagacatggt 900 gaaaacgcct taaagttggc taaatggttg gaacaatccc catatgtctc ttgggtctct 960 tatccaggtt tggcttcaca ttcccatcat gaaaacgcta agaagtactt gtccaatggt 1020 ttcggtggtg ttttgtcttt tggtgttaaa gatttgccaa atgctgataa agaaactgat 1080 ccattcaagt tatctggtgc tcaagttgtt gataacttaa agttagcttc taatttggct 1140 aacgttggtg acgccaagac tttggtcatt gctccatact tcactactca taagcaattg 1200 aatgacaagg agaagttggc ttctggtgtt actaaggatt tgattagagt ttctgttggt 1260 attgagttta ttgatgatat tattgctgat ttccaacaat cttttgaaac tgtttttgct 1320 ggtcaaaagc cataa 1335 <210> 11 <211> 1524 <212> DNA <213> Artificial Sequence <220> <223> CYS4 <400> 11 atgactaagt ctgaacaaca agctgattct agacataatg ttattgatct agtcggtaac 60 actccattga ttgctttaaa gaaattgcca aaggctttgg gtattaagcc acaaatctac 120 gctaagttgg aattgtataa cccaggtggt agtattaagg atagaattgc taagtcaatg 180 gtacttgaagaag ctgaggcttc cggtcgtatt tt gattgaacct 240 acttcaggta atactggtat tggtttagcc ttgattggtg ctattaaggg ttacagaact 300 atcattacct tgcctgaaaa gatgagtaat gaaaaagttt ctgttttgaa ggctttaggt 360 gctgaaatta tcagaactcc aacagctgct gcttgggatt ccccagaatc tcacattggt 420 gtcgctaaaa aattagaaaa ggaaattcca ggtgctgtta ttttagatca atacaacaat 480 atgatgaatc cagaagctca ttacttcggt actggtcgtg aaattcaaag gcaattggaa 540 gatttgaact tgttcgataa tttgagagct gtcgttgccg gtgctggtac tggtggtacc 600 atctccggta tttcaaagta cttgaaggaa caaaacgata aaattcaaat cgttggtgcc 660 gatccttttg gttctatctt ggctcaacct gaaaacttaa ataagactga tattactgac 720 tacaaggttg aaggtattgg ttatgatttt gttccacaag ttttagatag aaagttgatt 780 gatgtttggt ataagactga cgataagcca tctttcaaat acgctagaca attaatttct 840 aacgaaggtg ttttggtcgg tggttcctcc ggttctgcct ttactgctgt cgttaaatat 900 tgtgaagatc accctgaact aaccgaagat gatgttattg ttgctatttt tccagattcc 960 atcagatcat acttgactaa gttcgttgat gatgaatggt tgaagaagaa caatttgtgg 1020 gatgatgacg ttttagccag attcgactct tctaaattag aagccagcac aactaagtac 1080 gctgatgttt ttggtaatgc cactgttaag gatttgcatt tgaagccagt tgtctccgta 1140 aaggaaactg ctaaagttac tgatgtcatt aagatcttga aagataacgg ttttgatcaa 1200 ttgccagttt tgactgaaga tggtaaattg tctggtttgg ttaccttgtc tgagttgtta 1260 agaaagttgt ccattaacaa ctctaacaat gataatacta ttaagggcaa gtatttggac 1320 ttcaagaagt tgaacaactt caacgatgtt tcttcttaca acgaaaacaa gtctggcaag 1380 aagaaattca tcaagttcga tgaaaattct aagttgtctg atttgaatag attcttcgag 1440 aaaaattcat ctgctgttat tactgatggt ttgaagccaa ttcatattgt tactaagatg 1500 gatttgttgt cttacttggc ttaa 1524 <210> 12 <211> 2437 <212> DNA <213> Artificial Sequence <220> <223> CYC terminator-GPD promoter-CYS4 <400> 12 tcatgtaatt agttatgtca cgcttacatt cacgccctcc cgacattagtct gctctaacct ttagtagtacta cct attatagatagtt atagt 120 tagtattaag aacgttattt atatttcaaa tttttctttt ttttctgtac agacgcgtgt 180 acgcatgtaa cattatactg aaaaccttgc ttgagaaggt tttgggac tacaatac tcgaaggcttt 240 c taggtatagac ttacaatac tcgaaggctta tttcctaac tttatttagt caaaaaatta gccttttaat tctgctgtaa 360 cccgtacatg cccaaaatag ggggcgggtt acacagaata tataacatcg taggtgtctg 420 ggtgaacagt ttattcctgg catccactaa atataatgga gcccgctttt taagctggca 480 tccagaaaaa aaaagaatcc cagcaccaaa atattgtttt cttcaccaac catcagttca 540 taggtccatt ctcttagcgc aactacagag aacaggggca caaacaggca aaaaacgggc 600 acaacctcaa tggagtgatg caacctgcct ggagtaaatg atgacacaag gcaattgacc 660 cacgcatgta tctatctcat tttcttacac cttctattac cttctgctct ctctgatttg 720 gaaaaagctg aaaaaaaagg ttgaaaccag ttccctgaaa ttattcccct acttgactaa 780 taagtatata aagacggtag gtattgattg taattctgta aatctatttc ttaaacttct 840 taaattctac ttttatagtt agtctttttt ttagttttaa aacaccagaa cttagtttcg 900 acggattcta gaaatgacta agtctgaaca acaagctgat tctagacata atgttattga 960 tctagtcggt aacactccat tgattgcttt aaagaaattg ccaaaggctt tgggtattaa 1020 gccacaaatc tacgctaagt tggaattgta taacccaggt ggtagtatta aggatagaat 1080 tgctaagtca atggttgaag aagctgaggc ttccggtcgt attcatccat ctagaagtac 1140 tttgattgaa cctacttcag gtaatac tgg tattggttta gccttgattg gtgctattaa 1200 gggttacaga actatcatta ccttgcctga aaagatgagt aatgaaaaag tttctgtttt 1260 gaaggcttta ggtgctgaaa ttatcagaac tccaacagct gctgcttggg attccccaga 1320 atctcacatt ggtgtcgcta aaaaattaga aaaggaaatt ccaggtgctg ttattttaga 1380 tcaatacaac aatatgatga atccagaagc tcattacttc ggtactggtc gtgaaattca 1440 aaggcaattg gaagatttga acttgttcga taatttgaga gctgtcgttg ccggtgctgg 1500 tactggtggt accatctccg gtatttcaaa gtacttgaag gaacaaaacg ataaaattca 1560 aatcgttggt gccgatcctt ttggttctat cttggctcaa cctgaaaact taaataagac 1620 tgatattact gactacaagg ttgaaggtat tggttatgat tttgttccac aagttttaga 1680 tagaaagttg attgatgttt ggtataagac tgacgataag ccatctttca aatacgctag 1740 acaattaatt tctaacgaag gtgttttggt cggtggttcc tccggttctg cctttactgc 1800 tgtcgttaaa tattgtgaag atcaccctga actaaccgaa gatgatgtta ttgttgctat 1860 ttttccagat tccatcagat catacttgac taagttcgtt gatgatgaat ggttgaagaa 1920 gaacaatttg tgggatgatg acgttttagc cagattcgac tcttctaaat tagaagccag 1980 cacaactaag tacgctgatg tttttggtaa tg ccactgtt aaggatttgc atttgaagcc 2040 agttgtctcc gtaaaggaaa ctgctaaagt tactgatgtc attaagatct tgaaagataa 2100 cggttttgat caattgccag ttttgactga agatggtaaa ttgtctggtt tggttacctt 2160 gtctgagttg ttaagaaagt tgtccattaa caactctaac aatgataata ctattaaggg 2220 caagtatttg gacttcaaga agttgaacaa cttcaacgat gtttcttctt acaacgaaaa 2280 caagtctggc aagaagaaat tcatcaagtt cgatgaaaat tctaagttgt ctgatttgaa 2340 tagattcttc gagaaaaatt catctgctgt tattactgat ggtttgaagc caattcatat 2400 tgttactaag atggatttgt tgtcttactt ggcttaa 2437 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Met17-Spe-F <400> 13 aaaatagtat gccatctcac tttgatacc 29 <210> 14 <211> 28 <212> DNA < 213> Artificial Sequence <220> <223> Met17-BamH-R <400> 14 ttggatcctt atggcttttg accagcaa 28 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPD400-BamNhe- F <400> 15 ttggatcctc atgtaattag ttatgtcacg ct 32 <210> 16 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Cys4-Pst-R <400> 16 ttctgcagtt aagccaagta agacaacaa 29 <210> 17 <211> 1185 <212> DNA <213> Artificial Sequence <220> <223> CYS3 <400> 17 atgactttgc aagaatctga taaattcgct actaaggcta ttcatgctgg tgaacatgtt 60 gatgttcatg gttctgttat tgaaccaatt tctttatcta ctactttcaa gcaatcttcc 120 ccagctaatc caattggtac ttacgaatat tctagatccc aaaatccaaa cagagaaaac 180 ttagaaagag ctgttgctgc tttagaaaac gctcaatacg gtttggcctt ctcttccggt 240 tctgctacta ccgctactat tttgcaatct ttgccacaag gttctcatgc tgtttctatc 300 ggagatgttt acggtggtac tcatagatat tttactaaag ttgctaacgc tcacggtgtt 360 gaaacctcct tcactaacga tttgttgaac gacttaccac aattgattaa ggaaaataca 420 aaattggttt ggattgaaac accaactaac ccaactttaa aggttaccga cattcaaaaa 480 gtcgctgatt tgattaagaa acatgctgct ggtcaagatg ttattttagt tgttgataat 540 actttcttgt ctccatatat ctctaaccca ttgaacttcg gtgctgatat cgttgtgcat 600 tctgctacca agtacattaa cggtcactct gatgttgttt taggtgtttt agctactaac 660 aataagccat tatacgaaag attgcaattc ttacaaaatg ctatcggtgc tattccatct 720 ccacattcgatg cttggttgac t tcacagatgttag acaa t gaacagtgt t ttgt ctgctaacaa gatcgctgaa tttttggctg ctgataagga aaacgtcgtt 840 gctgttaact accctggttt aaagactcat ccaaactacg atgttgtctt gaagcaacac 900 agagatgctt taggtggtgg tatgatttct ttcagaatta agggtggtgc tgaagctgct 960 tctaaattcg cttcttctac tagattgttt acattggctg aatctttggg tggtattgaa 1020 tctttgttgg aagttccagc tgttatgacc cacggtggta ttccaaagga agctagagaa 1080 gcctctggtg ttttcgatga tttggttaga atttccgttg gtattgaaga tactgatgat 1140 ttgttggaag atattaagca agccttgaag caagctacta actaa 1185 <210 > 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CYC-GPD-SalI-F <400> 18 aagtcgactc atgtaattag ttatgtcacg 30 <210> 19 <211> 39 <212> DNA <213 > Artificial Sequence <220> <223> CYC-GPD-NotISalI-R <400> 19 ttgtcgacgc ggccgcttct agaatccgtc gaaactaag 39 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> CYS3- NotI-F <400> 20 aagcggccgc atgactttgc aagaatctga ta 32 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> CYS3-NotI-R<400> 21 ttgcggccgc ttagttagta gcttgcttca ag 32

Claims (4)

Recombinant yeast with improved ergothioneine production ability by overexpressing EGT1, EGT2 and MET17 genes.
The method according to claim 1,
The EGT1 gene is represented by the nucleotide sequence of SEQ ID NO: 1,
The EGT2 gene is represented by the nucleotide sequence of SEQ ID NO: 2,
The MET17 gene is a recombinant yeast represented by the nucleotide sequence of SEQ ID NO: 10.
The method according to claim 1,
The recombinant yeast is Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) The recombinant yeast,
i) culturing the recombinant yeast of claim 1 in a medium; and
ii) recovering ergothioneine from the recombinant yeast or the culture medium in which the recombinant yeast is cultured
A method for producing ergothioneine comprising a.

Images