KR20220038869A - Method for producing genome-edited tomato plant with increased Potyvirus resistance by eIF4E1 gene editing and genome-edited tomato plant with increased Potyvirus resistance produced by the same method - Google Patents

Abstract

The present invention relates to a method for producing a genome-edited tomato plant increased in potyvirus resistance by editing a tomato-derived eukaryotic translation initiation factor 4E-1 (eIF4E1) gene with a CRISPR/Cas system. The genome-edited plant production method of the present invention is expected to be cost-saving and time-saving, unlike genetically modified organism (GMO) crops that require much time and cost for safety and environmental hazard assessment, as no foreign genes are inserted and only small variations indistinguishable from natural variations are given.

Description

Method for producing genome-edited tomato plant with increased fortivirus resistance by eIF4E1 gene editing and genome-edited tomato plant with increased fortivirus resistance prepared by the method {Method for producing genome-edited tomato plant with increased Potyvirus resistance by eIF4E1 gene editing and genome-edited tomato plant with increased Potyvirus resistance produced by the same method}

The present invention relates to a method for producing a genome-edited tomato plant with increased fortivirus resistance by eIF4E1 gene editing, and to a genome-modified tomato plant with increased fortivirus resistance produced by the method.

Tomato ( Solanum lycopersicum ) is a plant belonging to the Solanaceae family and is most widely cultivated in the world, and is one of the crops with great agricultural value. In addition, as an excellent model organism in molecular biology, it is being actively studied in many fields such as fruit color, disease resistance, and aging process.

Plant diseases are one of the major factors affecting crop production worldwide. Recently, the damage caused by viruses is increasing, and methods such as pesticides or physical control may be used to control plant diseases, but these methods are not sustainable and effective. Therefore, the most effective way to suppress the virus at present is to develop virus-resistant strains.

Potyvirus accounts for about 30% of existing plant viruses and is known to cause enormous damage to plants. Fortivirus has a single-stranded positive RNA genome in which a genome-bound viral protein (VPg) and a poly (A) tail are attached to the 5' and 3' ends, respectively. The monopartite genome of about 10 kb encodes a single polyprotein cleaved by proteolytic enzymes.

Plant viruses are simple, structured intracellular parasites with minimal genes, and their life cycle and systemic movements depend on the host. Eukaryotes have eukaryotic initiation factor (eIF), and eukaryotic translation initiation factor 4E (eIF4E) is one of the components of multiple complex proteins involved in the mRNA translation process. It initiates protein translation by enabling recognition and interaction with the cap structure of mRNA.

Fortivirus viral genome-linked protein (VPg) is covalently linked to the 5' end of viral RNA, and can replace the role of the mRNA cap structure during protein translation. . In a previous study, it was reported that the physical interaction between the host factor eIF4E (or its homolog, eIF(iso)4E) and VPg is very important for infection of several photiviruses. It has also been reported that mutations occurring in these host factors inhibit the interaction between the host factor and VPg and consequently prevent viral infection (Duprat et al., (2002) Plant J. 32, 927-934; Lellis et al. al., (2002) Curr. Biol. 12, 1046-1051; Sato et al., (2005) FEBS Lett. 579, 1167-1171).

CRISPR/Cas9 (Clustered Regularly Interspaced Palindromic Repeats/CRISPR-associated protein9) is one of the gene editing technologies derived from the immune system responding to the viral infection of Streptococcus pyogenes . CRISPR/Cas9 has been used as a technology that can induce site-specific mutation in various organisms, including microorganisms, animals, human cells, and plants. In CRISPR/Cas9, a target DNA sequence located 5' of a protospacer adjacent motif (PAM) and a gRNA of 20 bp in size are complementary to each other, and a double-stranded break (DSB) is caused by the Cas9 enzyme. Through this process, non-homologous end joining (NHEJ), an intracellular repair mechanism, occurs, and during this process, random mutations such as insertions, deletions, and substitutions occur. These mutations can alter the protein's open reading frame (ORF) and cause premature stop codons.

On the other hand, Korea Patent Application Publication No. 2019-0043841 discloses 'a method for reducing ethylene production by LeMADS-RIN gene editing using the CRISPR/Cas9 system in plants', and Korean Patent Application Publication No. 2017-0129186 discloses ' Although the Pvr4 gene having fortivirus resistance and its use is disclosed, the 'method for producing a genome-edited tomato plant with increased fortivirus resistance by eIF4E1 gene editing of the present invention and the method for increasing the fortivirus resistance produced by the method There is no disclosure about the 'genome-corrected tomato plant'.

The present invention was derived from the above needs, and the present inventors reported that the eIF4E protein coding gene interacts with the VPg (viral genome-linked protein) of the fortivirus in order to increase the fortivirus resistance of tomato plants. Targeted CRISPR/Cas9 system to induce mutation of the tomato eIF4E1 gene, and to develop eIF4E1 homozygous or heterozygous mutations in E0 plants with insertions, deletions, and substitutions that do not contain the wild-type eIF4E1 allele. As a result of confirming TEV (Tobacco etch virus) and PepMoV (Pepper mottle virus) resistance among photiviruses using E1 and E2 generations, the resistance to PepMov in tomato plants with eIF4E1 genome editing was significantly increased compared to wild-type plants. The invention was completed.

In order to solve the above problems, the present invention is (a) tomato-derived eIF4E1 (Eukaryotic translation initiation factor 4E-1) DNA encoding a guide RNA (guide RNA) specific to the target nucleotide sequence of the gene and endonuclease (endonuclease) ) introducing the protein into tomato plant cells to correct the genome; And (b) re-differentiating the tomato plant from the tomato plant cells in which the genome has been corrected; it provides a method for producing a genome-corrected tomato plant comprising, a fortivirus resistance increased.

In addition, the present invention provides a genome-edited tomato plant with increased fortivirus resistance prepared by the above method and seeds thereof.

In addition, the present invention provides a recombinant vector comprising a DNA encoding a guide RNA specific to the target nucleotide sequence of the tomato-derived eIF4E1 gene and a nucleic acid sequence encoding an endonuclease protein; Or a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the eIF4E1 gene derived from tomato; It provides a composition for genome editing for increasing the fortivirus resistance of tomato plants, containing as an active ingredient.

Genetically modified GMO (genetically modified) production method of the present invention does not insert an external gene and has only a small mutation indistinguishable from a natural mutation. organism), it is expected to save cost and time unlike crops. In addition, the production method of the present invention can be expected to increase the production and economic effect by increasing the virus resistance of tomato plants.

1A is a schematic diagram of the CRISPR / Cas9 vector structure, a cassette in which the corn codon-optimized Cas9 gene controlled for 35S promoter expression and eIF4E1-gRNA controlled by the Arabidopsis U6-26 promoter expression is expressed ( pHSE401 - eIF4E1 ) is a schematic diagram, 1B shows the eIF4E1 gene target location and gRNA sequence of the CRISPR/Cas9 system. The red text indicates the PAM sequence.
Figure 2 shows the Agrobacterium-mediated tomato (cv. 'Micro-Tom') transformation process, seed germination (A), co-culture in sections (B), shoot induction in sections (C), shoot elongation ( D), a plant with roots (E), and a plant transferred to the soil (F).
3 is a screening result of a tomato 'Micro-Tom' transformant, and is a result of confirming the presence or absence of Cas9 and Hpt genes in eIF4E1 E0 transformant gDNA by PCR. NC: wild type representing negative control, PC: Cas9 plasmid representing positive control.
Figure 4 is the result of analyzing the mutant sequence through direct sequencing in the PCR product, (A) is the nucleotide sequence alignment result of the eIF4E1 target gene corrector E0-1 in which the inserted gene is confirmed When compared with the nucleotide sequence of the wild type, The base sequence of a single peak at the target site of the eIF4E1 gene was shown, and the subject was considered as a non-mutant. 4(B) is a nucleotide sequence alignment result of the eIF4E1 target gene corrector E0-8 in which the inserted gene was confirmed, and the base sequence in the form of a mixed peak due to InDel mutation at the target site of the eIF4E1 gene compared to the nucleotide sequence of the wild type , the individual was considered a mutant.
5 is a mutant sequence alignment result of the E0 line, (A) is a 4 colony sequence alignment result of wild-type and eIF4E1 E0-3 line, (B) 5 colony sequence alignment of wild-type and eIF4E1 E0-8 line sort result. The number indicated on the right side of the sequence indicates the number of inserted or deleted bases in each base sequence compared to the wild-type (WT) sequence.
6(A) is the result of confirming the inserted gene through PCR in E1 individuals of the eIF4E1 gene corrector E0-3 line, and FIG. 6(B) is the inserted gene in the E1 individuals of the eIF4E1 gene corrector E0-8 line. is the result of checking
7 is an analysis of the mutation pattern of the eIF4E1 gene-corrected plant, (A) is a homozygous mutant line eIF4E1 3-8 (E1), (B) is a biallelic mutant line eIF4E1 3-11 (E1), (C) shows the sequence variation of the target site of the chimeric mutant line eIF4E1 3-19 (E1).
8 is a sequence alignment result of the target base region of the E1 line having a homozygous mutation among the eIF4E1 gene-corrected plants.
9 is a photograph showing the phenotype of the E1 line having a homozygous mutation among the eIF4E1 gene-corrected plants.
10 is a result of analyzing the resistance to photivirus of eIF4E1 gene-corrected plants (E1 generation), and DAS-ELISA results for TEV-HAT (A) and PepMoV (B), respectively. Asterisks indicate significant differences between 'mock' and the experimental group.
11 is a result of analysis of the resistance to photivirus of the eIF4E1 gene-corrected plant (E2 generation) by DAS-ELISA, (A) is the result for TEV-HAT (A), (B) is the result for PepMoV. mock: negative control, PepMoV-WT: wild-type inoculated with PepMoV as a positive control, E2-3-9 I: inoculum of E2 individuals of lines 3-9, E2-3-9 S: E2 individuals of lines 3-9 upper lobe of

In order to achieve the object of the present invention, the present invention is (a) tomato-derived eIF4E1 (Eukaryotic translation initiation factor 4E-1) DNA encoding a DNA and an endonuclease specific to the target nucleotide sequence of the gene (guide RNA) (endonuclease) correcting the genome by introducing the protein into tomato plant cells; And (b) re-differentiating the tomato plant from the tomato plant cells in which the genome has been corrected; it provides a method for producing a genome-corrected tomato plant comprising, a fortivirus resistance increased.

As used herein, the term 'genome/gene editing' is a technology capable of introducing a target-directed mutation into the genome sequence of animal and plant cells, including human cells, and one or more nucleic acid molecules by DNA cleavage. It refers to a technology that can knock-out or knock-in a specific gene by deletion, insertion, substitution, etc., or introduce a mutation into a non-coding DNA sequence that does not produce a protein .

As used herein, the term “target gene” refers to some DNA in the genome of a plant to be corrected through the present invention. That is, in principle, it is not limited to the type of the gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome-corrected plant to be prepared, depending on the purpose.

In the method for producing a genome-corrected tomato plant with increased fortivirus resistance according to an embodiment of the present invention, the target gene may be a tomato-derived eIF4E1 gene, preferably a gene consisting of the nucleotide sequence of SEQ ID NO: 1 , but not limited thereto.

In addition, in the manufacturing method according to an embodiment of the present invention, the guide RNA (guide RNA) is specifically designed for the target nucleotide sequence of the eIF4E1 gene, and the target nucleotide sequence of the eIF4E1 gene is preferably SEQ ID NO: 2 It may consist of a nucleotide sequence, but is not limited thereto. That is, the target nucleotide sequence consisting of the nucleotide sequence of SEQ ID NO: 2 according to the present invention is a sequence targeted by the guide RNA.

The term “guide RNA” refers to an RNA specific for DNA encoding a base sequence of a target gene, and all or part of the target DNA base sequence and all or a part are complementary to each other to form an endonuclease as the target DNA base sequence It refers to ribonucleic acid that plays a role in guiding the endonuclease protein. The guide RNA may include two RNAs, that is, a dual RNA including crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or it refers to a single-chain guide RNA (sgRNA) form comprising a first site comprising a sequence that is completely or partially complementary to a nucleotide sequence in the target DNA and a second site comprising a sequence that interacts with an RNA-guided nuclease. , as long as the RNA-guided nuclease can have activity in the target nucleotide sequence, it may be included in the scope of the present invention without limitation. The guide RNA according to the present invention may preferably be in the form of a single-stranded guide RNA, but is not limited thereto, and according to known techniques in the art, such as the type of endonuclease used or the microorganism derived from the endonuclease, etc. can be appropriately selected.

In addition, the guide RNA may be transcribed from a plasmid template or transcribed in vitro (eg, oligonucleotide double-stranded), but is not limited thereto.

In addition, in the production method according to an embodiment of the present invention, the introduction of the DNA encoding the guide RNA and the endonuclease protein in step (a) into tomato plant cells is a target nucleotide sequence of the tomato-derived eIF4E1 gene. a recombinant vector comprising a DNA encoding a guide RNA specific for and a nucleic acid sequence encoding an endonuclease protein; Alternatively, a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the eIF4E1 gene derived from tomato; may be used, but is not limited thereto.

In the preparation method according to an embodiment of the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9 (CRISPR associated protein 9), Cas12a (previously known as Cpf1), and functional analogs thereof, Preferably, it may be a Cas9 protein, but is not limited thereto.

Cas9 protein or gene information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). For example, the Cas9 protein is Streptococcus pyogenes -derived Cas9 protein, Campylobacter jejuni -derived Cas9 protein, Streptococcus thermophilus or Streptococcus aureus ( S. aureus )-derived Cas9 protein, Neisseria meningitidis -derived Cas9 protein, Pasteurella multocida -derived Cas9 protein, Francisella novicida ) derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto.

Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the base sequence of the target DNA and cut the DNA strand, a short sequence of three bases known as PAM (Protospacer Adjacent Motif) must exist next to the base sequence of the target DNA. Cut by inferring between the 3rd and 4th base pairs from the sequence (NGG).

In the production method of the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex and operate as RNA-Guided Engineered Nuclease (RGEN).

The CRISPR/Cas9 system used in the present invention introduces a double helix break at a specific position of a specific gene to be corrected, and NHEJ induces an insertion-deletion (InDel) mutation due to incomplete repair induced in the DNA repair process. (non-homologous end joining) It is a gene editing method based on the mechanism.

In the method for producing a genome-corrected tomato plant according to the present invention, introducing a recombinant vector comprising a DNA encoding the guide RNA and a nucleic acid sequence encoding an endonuclease protein into a plant cell means a transformation method . Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the recombinant vector according to the invention into suitable progenitor cells. The introduction method includes microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al. ., 1987, Nature 327: 70), infection with viruses (EP 0 301) in Agrobacterium tumefaciens mediated gene transfer (incomplete) by infiltration of plants or transformation of mature pollen or vesicles. 316) and the like). A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery.

In addition, in the method for producing a genome-corrected tomato plant according to the present invention, the method of transducing the complex of guide RNA and endonuclease protein into plant cells is a calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373) or electroporation of protoplasts (Shillito et al., 1985, Bio/Technol. 3: 1099-1102) ) and the like may be appropriately selected from among others.

The "plant cell" used for the transformation may be any plant cell. Plant cells are cultured cells, cultured tissues, cultured organs or whole plants. "Plant tissue" refers to differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie, single cells, protoplasts. (protoplast), shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture state.

In the method for producing a genome-corrected tomato plant of the present invention, any method known in the art may be used for the method of redifferentiating a genome-corrected plant from a genome-corrected plant cell. Plant cells whose genome has been corrected must be redifferentiated into whole plants. Techniques for the redifferentiation of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).

In the method for producing a genome editing tomato plant of the present invention, the fortivirus may preferably be a pepper mottle virus, but is not limited thereto.

The present invention also provides a genome-edited tomato plant with increased fortivirus resistance prepared by the above method and seeds thereof.

The genome-corrected tomato plant with increased fortivirus resistance according to the present invention uses the CRISPR/Cas9 system to convert the eIF4E1 gene, a recessive virus resistance gene of plants reported to interact with VPg (viral genome-linked protein) of the fortivirus, using the CRISPR/Cas9 system. As a result of the correction, the tomato-derived eIF4E1 gene is knocked out, and it is a genome-corrected tomato plant having a trait that increases resistance to photivirus compared to a tomato plant that has not edited the genome.

In the genome editing tomato plant and seeds thereof of the present invention, the fortivirus may preferably be a pepper mottle virus, but is not limited thereto.

The present invention also provides a recombinant vector comprising a DNA encoding a guide RNA specific for the target nucleotide sequence of the tomato-derived eIF4E1 gene and a nucleic acid sequence encoding an endonuclease protein; Or a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the eIF4E1 gene derived from tomato; It provides a composition for genome editing for increasing the fortivirus resistance of tomato plants, containing as an active ingredient.

The composition for genome editing of the present invention is a recombinant vector comprising a DNA sequence encoding a guide RNA specific for a target nucleotide sequence of the tomato eIF4E1 gene and a nucleic acid sequence encoding an endonuclease protein, or a target nucleotide sequence specific for the eIF4E1 gene Since it contains a complex of a specific guide RNA and an endonuclease protein, when the composition is treated in tomato plant cells, the complex of the guide RNA and the endonuclease protein works as an RNA gene scissors to cut the target gene eIF4E1 can be corrected

The composition for genome editing of the present invention preferably contains a guide RNA specific for the target nucleotide sequence of the tomato eIF4E1 gene consisting of the nucleotide sequence of SEQ ID NO: 2, so that the eIF4E1 gene can be knocked out, and the eIF4E1 gene It is possible to increase the photivirus resistance of tomato plants through knock-out.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plant material

Tomato ( Solanum lycopersicum ) The seeds of 'Micro-Tom' were disinfected with 70% ethanol for 1 minute and 2% NaOCl containing Tween 20 for 15 minutes. Then, it was washed 4-5 times with sterile distilled water. The sterilized seeds contained 20 g/L sucrose and 8 g/L plant agar, adjusted to pH 5.8±1, and autoclaved at 121°C for 20 minutes and placed on 1/2 MS medium prepared. The media were wrapped in aluminum foil and given dark conditions for 3 days, after which the foil was removed to induce uniform germination in light conditions. All tissue cultures were maintained under a fluorescent light at 24° C. under a photoperiod of 16 hours light/8 hours dark conditions. Cotyledons from seedlings aged 6-7 days before true leaf development were used as tissue culture sections. Plants that took root through the subsequent process were transferred to a pot containing the top soil, acclimatized, and maintained in a growth phase at 24°C.

2. Gudie RNA production and vector production

The target sequence of gRNA was prepared using CCTop, a CRISPR/Cas9 online prediction program (https://crispr.cos.uni-heidelberg.de/index.html). In the present invention, a pHSE401 vector containing a corn codon-optimized Cas9 gene was used. 23bp of eIF4E1gRNA_F and eIF4E1gRNA_R were amplified and then cloned into the Bsa I restriction enzyme-treated pHSE401 vector through the previously reported Golden gate cloning method (Xing et al., (2014) BMC Plant Biol. 14:327).

Primers for sgRNA cloning primer base sequence (5'→3') Tm (℃) GC content (%) eIF4E1gRNA_F ATTGAGTTGAAGGCCGCCGATGG (SEQ ID NO: 3) 62 56.52 eIF4E1gRNA_R AAACCCATCGGCGGCCTTCAACT (SEQ ID NO: 4) 62 56.52

3. Agrobacterium culture for transformation

The constructed CRISPR/Cas9 vector was inserted into the Agrobacterium GV3101 strain using electroporation for plant transformation. Single colonies generated in the antibiotic medium were identified through sequence analysis, and the identified single colonies were inoculated into 15 ml of liquid LB medium containing 50 μg/ml kanamycin and 50 μg/ml rifampicin in a shaker incubator at 28°C. Incubated for 12-16 hours. The Agrobacterium suspension was centrifuged for 10 minutes at 20 °C and 8,000 rpm to collect pellets, and the collected pellets were used as 1/2 liquid MS medium containing 3% (w/v) sucrose and 200 μM acetosyringone. The OD ₆₀₀ was adjusted to 0.6 by dilution again.

4. Agrobacterium-mediated tomato transformation

Cotyledon sections were prepared under sterile conditions, and after cutting the distal end of the cotyledon, one cotyledon was divided into two pieces. Sections were cultured for 2 days in MS pre-culture medium containing 30 g/L sucrose, 8 g/L plant agar, 1 mg/L NAA (1-Naphthaleneacetic acid) and 1 mg/L BAP (benzylaminopurine). . The sections were inoculated in the Agrobacterium suspension for 20 minutes, then lightly dried the remaining Agrobacterium suspension on sterile filter paper, and then placed on MS medium having the same composition. After 2 days, the sections were subjected to MS in 30 g/L sucrose, 8 g/L plant agar, 2 mg/L trans zeatin-riboside, 0.1 mg/L IAA (Indole-3-acetic acid), 10 mg/L high Gromycin, 250 mg/L Carbenicillin was added to the shoot-induction medium containing dentition. After about 4-6 weeks, the sections were subjected to MS at 30 g/L sucrose, 8 g/L plant agar, 1 mg/L trans zeatin-riboside, 0.1 mg/L IAA, 10 mg/L hygromycin, 250 mg/L. L-carbenicillin-containing shoot-elongation medium was dented. Cut stems that have grown to about 1-2 cm, and MS contains 30 g/L sucrose, 8 g/L plant agar, 1 mg/L IAA, 10 mg/L hygromycin, and 250 mg/L carbenicillin. The rooting medium was dented.

5. Nucleic Acid Extraction and PCR Analysis

Put two 3 mm beads in a 1.5 ml tube and use a Tissuelyser to extract the purified plant leaf tissue from the cetyltrimethylammonium bromid (CTAB) method (Porebski et al., (1997) Plant Mol. Biol. Rep. 15, 8-15). ) through genomic DNA (gDNA) was extracted, and the extracted gDNA concentration was measured using a Nanodrop spectrophotometer (Nanodrop Technology, Inc., USA), and was diluted to a final concentration of 100 ng/μl. Using the extracted gDNA, the presence or absence of the inserted gene was confirmed by PCR using the Cas9 coding sequence of the inserted gene and Hpt -specific primers.

Primers for Identification of Inserted Genes primer base sequence (5'→3') Amplification product size (bp) HygR_F GCGAAGAATCTCGTGCTTTC (SEQ ID NO: 5) 209 HygR_R CAACGTGACACCCTGTGAAC (SEQ ID NO: 6) Cas9_pHSE_F ATCCAATCTTCGGCAACAT (SEQ ID NO: 7) 484 Cas9_pHSE_R TTATCCAGGTCATCGTCGTAT (SEQ ID NO: 8)

6. Mutation Identification

Whether or not the transformant was mutated was confirmed by using a primer including a target gene editing site.

Primers for mutation verification of target gene editing sites primer base sequence (5'→3') Amplification product size (bp) Sl4E_F_2 ACACTATGGTCCAAACAGTTCTTAT (SEQ ID NO: 9) 275 Sl4E_R_2 AACTGCTTGGGGAAGCTCAC (SEQ ID NO: 10)

The PCR product was purified through LaboPass PCR clean-up kit (Cosmo Genetech, Korea), and the purified product was cloned according to the protocol provided in the TA cloning vector pMD20-T vector (Mighty TA-cloning kit, TAKARA). White colonies selected in the blue/white colony selection method were inoculated in liquid LB medium containing ampicillin and cultured. Plasmids were extracted from the culture medium through the Accuprep plasmid mini extraction kit (Bioneer, Korea), and sequence analysis was performed on at least 5 clones per PCR product (Bionics, Korea). The analysis was performed by sequence alignment using Lasergene's SeqMan program (DNASTAR, USA), and mutation sequence analysis in E1 generation plants was also performed as described above.

7. Virus Inoculation

For the preparation of the virus inoculum, the inoculum of TEV and PepMov stored frozen at -80 ° C was inoculated into tobacco ( Nicotiana benthamiana ) 10 days before bottle screening. The frozen inoculum was mixed with 0.1M potassium phosphate buffer of pH 7.0 and 400-grit carborundum and rubbed on the third leaf of tobacco. After 10-20 minutes, the leaves were washed with purified water (Hull., (2009) Curr. Protoc. Microbiol. 13(1), 16B.6.1-16B.6.4). In order to inoculate tomato leaves, a pair of cotyledons and true leaves were inoculated, and after inoculation, the plant was maintained in a growth phase maintained under 16 hours light/8 hours dark conditions. In order to ensure virus infection, the plants were re-inoculated with the virus 7 days after the first inoculation.

8. Assessment of resistance to viruses

After virus inoculation, the development of symptoms was regularly observed. In order to confirm the virus infection, an experiment was carried out in the leaf tissue. The accumulation level of the TEV or PepMoW coat protein was measured using a double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) according to the manufacturer's (Agdia, Inc. USA) instructions. Analysis was carried out according to Experiments were conducted 7 and 20 days after inoculation to check the amount of virus accumulation. The leaves inoculated with the virus and uninoculated leaves were used for analysis in each of the three E1 specimens. Absorbance was measured at 405 nm using a microplate reader (Anthon zenith 340 micro plate reader, UK), and significance was analyzed by Student's t-test.

Example 1. CRISPR/Cas9 system construction

To develop a gene-corrected tomato by applying the CRISPR/Cas9 system, the Eukaryotic translation initiation factor 4E-1 ( eIF4E1 GenBank: AY723733) gene was selected as a target. eIF4E is known to be an essential eukaryotic translation initiator for Photivirus infection. In addition, mutations in the gene may result in resistance to Photivirus. In tomato, two genes ( eIF4E1 and eIF4E2 ) are known to encode the eIF4E protein. To design the gRNA, the CCTop - CRISPR/Cas9 online prediction program (https://crispr.cos.uni-heidelberg.de/index.html) was used to select the target gene target gRNA sequence with high predictive efficiency, and the eIF4E1 gene coding A gRNA targeting the first exon of the region was constructed (Fig. 1B). Mutations generated at the target site were determined to target the 5' region of the ORF, in anticipation of causing frameshifts or premature stop codons to increase the likelihood of generating non-functional proteins. An sgRNA targeting +50 to +68 from the translation start site of the eIF4E1 gene was designed.

Example 2. eIF4E1 Transgenic tomato development

To develop the eIF4E1 gene-corrected tomato, the pHSE401-eIF4E1 construct into which the eIF4E1 target sgRNA was inserted was introduced into the tomato 'Micro-Tom' through Agrobacterium. The eIF4E1 target transgenic fragments were redifferentiated through the callus, and the stem generated from the callus was transferred to the stem kidney medium. The elongated stem was cut to an appropriate size and transferred to a root-forming medium, and individuals with roots were transferred to the soil and acclimatized (FIG. 2). Finally, 22 redifferentiated plants were obtained, and the presence or absence of the gene was confirmed through PCR using an inserted gene-specific primer (FIG. 3). Insertion of the Cas9 and Hpt genes was confirmed in 17 of 22 individuals, and the transformation efficiency was 77% (Table 4).

Summary of eIF4E1 Target Gene Correction number of redifferentiated plants Number of transformant plants Number of eIF4E1 gene mutants 22 17 (77%) 16 (94%)

Example 3. Mutation detection

In order to confirm the CRISPR/Cas9-mediated mutation, PCR was performed through primers containing the gRNA target position in the gDNA of 17 individuals whose transformation was confirmed, and the PCR product was sequenced. As a result, 16 of the 17 gene-corrected presumed transformants showed a mixed nucleotide sequence peak (FIG. 4B). Through these results, mutations caused by Cas9 and gRNA may have been formed in the target gene editing site, and the target gene editing efficiency of 94.1% was confirmed (Table 4).

Among the eIF4E1 mutants, E0-3 and E0-8 lines were randomly selected for E1 transformant construction. Additional sequencing to confirm the mutant sequence was performed at E0-3 and E0-8, and PCR products containing the target gene site were cloned, and each clone was sequenced. Four different alleles were found in the sequencing results indicated by the PCR product of E0-3, and five different alleles were identified in the PCR product of E0-8 (FIG. 5).

Example 4. E1 generation genotyping

To construct the E1 generation, E0-3 and E0-8 lines were self-pollinated, and gDNA was extracted from leaf samples of the E1 generation. The presence or absence of the inserted gene was determined through PCR using insert gene-specific primers (Table 2). Inserted genes were identified in 13 (#1, 2, 3, 4, 9, 10, 12, 13, 15, 16, 17, 18, 19) out of 19 individuals derived from the E0-3 line. In addition, the inserted gene was confirmed in 5 (#3, 4, 5, 6, 7) among 7 individuals derived from the E0-8 line (FIG. 6). In order to confirm the sequence variation of the E1 plant, the amplified product of the target gene region in the E1 plant derived from the E0-3 and E0-8 lines was sequenced. As a result, gene sequences of homozygous mutations, biallelic mutations and chimeric mutations were confirmed ( FIG. 7 ).

To confirm the sequence in the E1 plant derived from the E0-3 and E0-8 lines, TA cloning was performed to confirm the sequence. As a result, two lines derived from E0-3 (E1 3-8 and E1 3-17) were homozygous for the 43 bp deletion. In addition, it was confirmed that the E1 3-11 line had deletions of 43 bp and 11 bp, and E1 3-9 and 3-15 had a 29 bp deletion and 38 bp repeat insertion, respectively. And in the E-19 line, deletion mutations with sizes of 12 bp, 13 bp and 15 bp were confirmed (FIG. 8). Three lines (E1 8-3, 8-5, 8-7) derived from E0-8 plants were homozygous for 11 bp, 43 bp and 29 bp deletions and 38 bp repeat sequence insertions ( FIG. 8 ). The E1 8-1 line was a biallelic with 43 bp and 29 bp deletions, and 38 bp repeat sequence insertion, whereas the E1 8-4 line showed a mixed form with the wild-type allele (Fig. 8). The presence of a novel mutation pattern in the E1 lineage different from that in the E0 plants suggested that active somatic mutations were occurring in the E0 plants. In particular, E1 3-8 had a homozygously corrected eIF4E1 gene but no T-DNA insertion. Overall, several homozygous and biallelic mutant lines were identified in the E1 generation, with a smaller proportion of chimeric mutants carrying different allelic variants (Table 5).

eIF4E1 mutation in E1 line induced by CRISPR/Cas9 line Generation number of mutants analyzed mutant form number of plants ratio E1 3 E1 19 homozygous 7 36.8% biallelic 8 42.1% chimeric 4 21.0% E1 8 E1 7 homozygous 4 57.1% biallelic 2 28.5% chimeric One 14.2%

Example 5. eIF4E1 Fortivirus resistance screening in this corrected plant

In the present invention, in order to confirm that the mutant tomato plant in which the eIF4E1 gene has been corrected through CRISPR/Cas9 has resistance to Photivirus, TEV (Tobacco etch virus) and PepMoV (Pepper mottle virus) were used to verify resistance.

First, E1 3-8 (homozygous line) and E1 3-11 (biallelic line) plants were inoculated with TEV-HAT. To confirm viral infection, DAS-ELISA analysis was performed using upper leaves not inoculated with virus. As a result, in E1 3-8 and E1 3-11 individuals, an amount of envelope protein similar to that of the wild type was accumulated, and it was confirmed that the eIF4E1 mutants were virulent to TEV-HAT ( FIG. 10A ). Next, PepMoV virus was inoculated, and DAS-ELISA was performed using the upper leaves not inoculated with the virus. As a result, in the wild type, it was confirmed that the coat protein was accumulated at a high rate in both the inoculated leaf and the uninoculated upper leaf. On the other hand, in all three gene editing lines, the PepMoV envelope protein did not accumulate, so it was confirmed that the eIF4E1 gene corrected plants had resistance to PepMoV ( FIG. 10B ). A result of a similar trend was also confirmed in the result using the E2 generation (FIG. 11).

<110> Seoul National University R&DB Foundation REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Method for producing genome-edited tomato plant with increased Potyvirus resistance by eIF4E1 gene editing and genome-edited tomato plant with increased Potyvirus resistance produced by the same method <130> PN20235 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 696 <212> DNA <213> Lycopersicon esculentum <400> 1 atggcagcag ctgaaatgga gagaacgatg tcgtttgatg cagctgagaa gttgaaggcc 60 gccgatggag gaggaggaga ggtagacgat gaacttgaag aaggtgaaat tgttgaagaa 120 tcaaatgata cggcatcgta tttagggaaa gaaatcacag tgaagcatcc attggagcat 180 tcatggactt tttggtttga taaccctacc actaaatctc gacaaactgc ttggggaagc 240 tcacttcgaa atgtctacac tttctccact gttgaagatt tttggggtgc ttacaataat 300 atccatcacc caagcaagtt aattatggga gcagactttc attgttttaa gcacaaaatt 360 gagccaaagt gggaagatcc tgtatgtgcc aatggaggga cgtggaaaat gagtttttcg 420 aagggtaaat ctgataccag ctggctgtat acgctgctgg caatgattgg acatcaattc 480 gatcatggag atgaaatttg tggagcagtt gttagtgtcc gggctaaggg agaaaaaata 540 gctttgtgga ccaagaatgc tgcaaatgaa acagctcagg ttagcattgg taagcaatgg 600 aagcagtttc tagattacag tgattcggtt ggcttcatat ttcacgacga tgcaaagagg 660 ctcgacagaa atgccaagaa tcgttacacc gtatag 696 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> gRNA target site <400> 2 agttgaaggc cgccgatgga gg 22 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 attgagttga aggccgccga tgg 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aaacccatcg gcggccttca act 23 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gcgaagaatc tcgtgctttc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 caacgtgaca ccctgtgaac 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atccaatctt cggcaacat 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ttatccaggt catcgtcgta t 21 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 acactatggt ccaaacagtt cttat 25 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 aactgcttgg ggaagctcac 20

Claims (8)

(a) Tomato-derived eIF4E1 (Eukaryotic translation initiation factor 4E-1) gene by introducing DNA and endonuclease protein encoding a guide RNA specific to the target nucleotide sequence into tomato plant cells. correcting; and
(B) re-differentiating the tomato plant from the tomato plant cells in which the genome has been corrected; Containing, a method for producing a genome-edited tomato plant with increased fortivirus resistance. The method according to claim 1, wherein the target nucleotide sequence of the tomato-derived eIF4E1 gene consists of the nucleotide sequence of SEQ ID NO: 2. According to claim 1, wherein the introduction of the DNA encoding the guide RNA and the endonuclease protein in step (a) into tomato plant cells, DNA encoding a guide RNA specific to the target nucleotide sequence of the tomato-derived eIF4E1 gene and a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein; or a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the tomato-derived eIF4E1 gene; The method according to claim 1, wherein the fortivirus is a pepper mottle virus. [Claim 5] A genome-edited tomato plant with increased fortivirus resistance produced by the method of any one of claims 1 to 4. A seed in which the genome of the plant according to claim 5 is corrected. Tomato-derived eIF4E1 (Eukaryotic translation initiation factor 4E-1) a recombinant vector comprising a DNA sequence encoding an endonuclease protein and DNA encoding a guide RNA specific to the target nucleotide sequence of the gene; Or a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the eIF4E1 gene derived from tomato; containing as an active ingredient, a composition for genome editing for increasing fortivirus resistance of tomato plants. The composition according to claim 7, wherein the target nucleotide sequence of the tomato-derived eIF4E1 gene consists of the nucleotide sequence of SEQ ID NO: 2.

Images