KR20230014337A - Method for producing tomato plant having controlled disease-resistance using gene editing and tomato plant produced by the same method - Google Patents

Abstract

The present invention relates to a method for producing a tomato plant with controlled disease resistance using gene editing, and the tomato plant prepared by the method. More specifically, the present invention relates to a tomato plant with controlled resistance to biotrophic and/or object-parasitic pathogens, by correcting tomato-derived plant immune regulator SRFR1 (suppressor of rps4-RLD1) gene using a CRISPR/Cas system.

Description

Method for producing tomato plants having controlled disease-resistance using gene editing and tomato plants produced by the method

The present invention relates to a method for preparing a tomato plant with controlled disease resistance using gene editing and a tomato plant produced by the method.

The Arabidopsis SRFR1 ( SUPPRESSOR OF rps4-RLD 1 ) gene was discovered through suppressor screening using wild-type RLD Arabidopsis thaliana, which has a missense mutation in the RPS4 ( Ribosomal protein S4 ) gene. The mutation of SRFR1 in Arabidopsis thaliana Pseudomonas syringae pv . For tomato ( Pto ) DC3000 ( Pseudomonas syringae pv. tomato ( Pto ) DC3000), resistance was increased when the corresponding R genes, RPS4 and RPS6 , were mutated, respectively. Since the recessive srfr1 mutant showed similar susceptibility to Pto DC3000 as wild-type RLD, SRFR1 was identified as a negative regulator in ETI. SRFR1 functions as an adapter protein that forms a complex with proteins such as the immune regulator EDS1 (Enhanced disease susceptibility 1) and the TNL-type resistance proteins RPS4, RPS6, and SNC1 (suppressor of npr1-1, constitutive 1). SRFR1 has a TPR (tetratricopeptide repeat) domain similar in nucleotide sequence to Saccharomyces cerevisiae Ssn6 protein, known as a transcriptional repressor regulator. In addition, it was confirmed that the expression of immune-related genes was increased in the Arabidopsis srfr1 mutant. In addition, SRFR1 protein interacts with immune chaperone SGT1b (Suppressor of G2 allele of SKP1 homolog B) and TCP family transcription factors. These results support the role of the SRFR1 protein as an adapter protein that negatively regulates the ETI-related transcriptional immune response.

In order to develop plants with excellent traits, traditional breeding methods, such as inducing natural mutations using EMS (ethyl methane sulfonate) or gamma ray treatment, or crossing superior parents, have been mainly used, but in this case, it is difficult to change only the desired target traits. In recent years, new breeding methods using TALENs, ZFNs, CRISPR/Cas9, etc. have been applied to substitute only target traits. However, in the case of TALENs or ZFNs, it takes a lot of time and money to design and manufacture artificial nucleases, and it is difficult to edit multiple genes. However, the CRISPR/Cas9 system has a very high target specificity and can recognize methylated DNA as a target, so it can be applied to a wide variety of genes, and it is passed on to offspring according to Mendel's genetic law, enabling generational fixation of traits. there is In addition, since it requires only Cas9 protein and sgRNA (single guide RNA), it has the advantage of being able to introduce target traits at a lower cost than the above two methods, and is a new breeding technology that has recently been widely applied in animals and plants.

On the other hand, Korean Patent Registration No. 2264215 discloses 'a method for producing tomato plants with increased ascorbic acid content using gene editing and tomato plants produced by the method', and Korean Patent Publication No. 2019-0043841 discloses 'Method for reducing ethylene production by LeMADS-RIN gene editing using CRISPR/Cas9 system in plants' is disclosed, but method for producing tomato plants with controlled disease resistance using gene editing of the present invention and the above method There is nothing described about tomato plants prepared by.

The present invention was derived from the above needs, and the present inventors prepared a tomato SRFR1 mutant ( slsrfr1 ) using sgRNA and CRISPR / Cas9 targeting two regions of tomato SRFR1 genomic DNA, and the mutant It was confirmed that the expression of a pathogen-related (PR) gene involved in salicylic acid signaling was increased, and it was confirmed that the mutant had increased resistance to Pto DC3000 compared to unmodified tomato plants. However, the necrotrophic fungus Fusarium oxysporum f. sp. It was confirmed that resistance to Lycopersici ( Fusarium oxysporum f. sp. lycopersici ) was reduced compared to unmodified tomato plants. Through this, by confirming that SRFR1 is involved in regulating resistance to parasitic trophic (biotrophic) pathogens and parasitic pathogens in tomato plants, the present invention was completed.

In order to solve the above problems, the present invention is tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) DNA encoding a guide RNA specific to the target sequence of the gene and an endonuclease recombinant vectors containing nucleic acid sequences encoding proteins; Or a complex of guide RNA and endonuclease protein specific for the target sequence of the SlSRFR1 gene (ribonucleoprotein); to provide a genome editing composition for regulating disease resistance of tomato plants, containing as an active ingredient.

In addition, the present invention (a) tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) Guide RNA and endonuclease protein specific to the target sequence of the gene are introduced into tomato plant cells to correct the genome ; and (b) regenerating tomato plants from the genome-corrected tomato plant cells.

In addition, the present invention provides a genome-corrected tomato plant with controlled disease resistance prepared by the above method and a genome-corrected seed thereof.

Mutation induction through SlSRFR1 gene editing presented in the present invention can be usefully used to develop tomato plants with controlled disease resistance. In addition, since the method according to the present invention induces mutations that are indistinguishable from natural mutations, cost and time are saved, unlike GMO (Genetically Modified Organism) crops, which require enormous costs and time to evaluate safety and environmental hazards. Expect to be able to do it.

Figure 1a shows the genomic structure and gRNA target location (Target 1, 2) of tomato SRFR1 , Figure 1b is the target sequence of gRNA, Figure 1c is a T-DNA schematic diagram of the pSlSRFR-GE construct, Figure 1d is As a result of CAPS analysis of SlSRFR1 sgRNA1- and sgRNA2 -induced G1 mutants, white arrows indicate homozygous mutants.
Figure 2 is the result of analyzing the target site in the tomato G0 plant. Vertical dotted lines indicate the cleavage site by SpCas9 for each sgRNA.
3 is a result of analyzing the genome editing pattern of the target site in tomato G1 plants.
4 is a growth pattern of a tomato SRFR1 mutant ( slsrfr1 ) (a), and a result of confirming the expression level of genes involved in plant defense mechanisms in the mutant through qRT-PCR (b). *; P<0.01 .
Figure 5 is a parasitic trophic (biotrophic) pathogen of the G1 generation slsrfr1 plants Pseudomonas syringae pv. To show the response to tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000), (a) is a photograph showing the disease on the leaves 5 days after inoculation, and (b) is the result of measuring the number of bacteria. *; P<0.01 .
6 is a parasitic pathogen of the G1 generation slsrfr1 plant, Fusarium oxysporum f. sp. It shows the reaction to Lycopersici ( Fusarium oxysporum f. sp. lycopersici ), (a) is a leaf picture 3 days after inoculation, (b) is a trypan blue staining image, (c) is the diameter of the lesion area is the result of measuring *; P<0.01 .

In order to achieve the object of the present invention, the present invention is tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) DNA encoding a guide RNA specific to the target sequence of the gene and an endonuclease ( endonuclease) recombinant vectors containing nucleic acid sequences encoding proteins; Or a complex of guide RNA and endonuclease protein specific for the target sequence of the SlSRFR1 gene (ribonucleoprotein); to provide a genome editing composition for regulating disease resistance of tomato plants, containing as an active ingredient.

In the genome editing composition according to the present invention, the plant disease may be a plant disease caused by a biotrophic pathogen or a plant disease caused by a necrotrophic pathogen, and the biotrophic pathogen is preferably The Pseudomonas cold dog pv. Tomato ( Pto ) DC3000 ( Pseudomonas syringae pv. tomato ( Pto ) DC3000), and the necrotrophic pathogen is preferably Fusarium oxysporum f. sp. It may be Lycopersici ( Fusarium oxysporum f. sp. lycopersici ), but is not limited thereto.

As used herein, the term "genome/gene editing" refers to a technology capable of introducing target-directed mutations into genomic sequences of animal and plant cells, including human cells, and includes one or more nucleic acid molecules by cutting DNA. Knock-out or knock-in of a specific gene by deletion, insertion, substitution, etc., or non-coding that does not produce a protein Coding refers to a technology that can introduce mutations into DNA sequences. For the purposes of the present invention, the genome editing may be to introduce mutations into plants using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and guide RNA. In addition, 'gene editing' may be used interchangeably with 'gene editing'.

In addition, the term "target gene" refers to some DNA in the genome of a plant to be corrected through the present invention, and is not limited to the type of gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be produced, depending on the purpose.

In the composition according to one embodiment of the present invention, the tomato-derived SlSRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1 ) gene encodes the SlSRFR1 protein consisting of the amino acid sequence of SEQ ID NO: 3, preferably the genomic DNA of SlSRFR1 is It may be the nucleotide sequence represented by SEQ ID NO: 1, and the cDNA of SlSRFR1 may be the nucleotide sequence represented by SEQ ID NO: 2.

In addition, the term "guide RNA" refers to a short single-stranded RNA, which is specific for a target DNA among base sequences encoding a target gene, and binds to the target DNA base sequence in whole or in part complementarily. It means ribonucleic acid that serves to guide the endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain comprising a first region comprising a sequence complementary in whole or in part to a base sequence in a target gene and a second region comprising a sequence interacting with an endonuclease (particularly, an RNA-guided nuclease). Guide RNA (single guide RNA, sgRNA) form, but if the endonuclease can be active in the target sequence, it can be included in the scope of the present invention without limitation, and the type of endonuclease used together or endo It can be prepared and used according to known techniques in the art in consideration of the microorganism derived from the nuclease.

In addition, the guide RNA may be a guide RNA transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide duplex), or synthesized guide RNA, but is not limited thereto.

In the composition according to an embodiment of the present invention, the target nucleotide sequence of the SlSRFR1 gene may be the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, more preferably the nucleotide sequence of SEQ ID NO: 4 However, it is not limited thereto.

In addition, in the genome editing composition according to the present invention, the endonuclease protein is Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analogue thereof It may be one or more selected from the group consisting of, preferably an RNA-guided nuclease such as Cas9 or Cpf1, more preferably a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni , a Cas9 protein derived from Streptococcus thermophilus ( S. thermophilus ) or Streptococcus aureus ( S. aureus ) derived Cas9 protein, Neisseria meningitidis ( Neisseria meningitidis ) derived Cas9 protein, Pasteurella multocida ( Pasteurella multocida ) derived Cas9 protein, Francisella novicida ( Francisella novicida ) derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from known databases such as GenBank of National Center for Biotechnology Information (NCBI). For the Cas9 gene information, a known sequence may be used as it is or a sequence optimized for the codon of a target (organism) to be transduced may be used, but is not limited thereto.

The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must be present next to the target sequence, and the Cas9 protein has a PAM sequence (NGG) It is cut by estimating between the 3rd and 4th base pairs from .

In the composition for genome editing according to the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).

In the composition for genome editing according to the present invention, the CRISPR/Cas9 system used introduces a double helix break at a specific position of a specific gene to be corrected to insert-deletion (insertion-deletion) caused by incomplete repair induced in the DNA repair process. , InDel) It is a gene editing method by NHEJ (non-homologous end joining) mechanism that induces mutations.

The present invention also

(a) Tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) Guide RNA specific to the target sequence of the gene and endonuclease protein are introduced into tomato plant cells to correct the genome doing; and

(b) regenerating tomato plants from the genome-corrected tomato plant cells; providing a method for producing a genome-corrected tomato plant with controlled disease resistance.

In the production method according to the present invention, introducing the guide RNA and endonuclease protein of step (a) into tomato plant cells is DNA encoding the guide RNA specific to the target sequence of the SlSRFR1 gene and endonuclease protein. a recombinant vector comprising a nucleic acid sequence encoding a nuclease protein; Or a complex of a guide RNA specific to the target sequence of the SlSRFR1 gene and an endonuclease protein (ribonucleoprotein); may be used, but is not limited thereto.

In the production method according to an embodiment of the present invention, the target nucleotide sequence of the SlSRFR1 gene may be composed of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, more preferably the nucleotide sequence of SEQ ID NO: 4 It may, but is not limited thereto.

Introduction of a recombinant vector containing DNA encoding a guide RNA specific to the target sequence and a nucleic acid sequence encoding an endonuclease protein into plant cells refers to a transformation method. Transformation of plant species is now common for plant species including both dicotyledonous as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vectors according to the invention into suitable progenitor cells.

In the production method according to one embodiment of the present invention, when the recombinant vector is transformed into a plant cell, it binds to an endonuclease protein having DNA binding and cutting activity and the endonuclease protein, and converts the endoplasmic recombinant vector into a target sequence. The sgRNA leading to the nuclease protein is also expressed.

In addition, in the production method according to the present invention, the method of transducing the complex of the guide RNA and the endonuclease protein into plant cells is the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; microinjection method of (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment method (DNA or RNA-coated) of various plant elements (Klein et al., 1987, Nature 327: 70), infection by bacteria in Agrobacterium tumefaciens mediated gene transfer (incompleteness), and the like.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide or a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell in its natural state, but the gene has been reintroduced into the cell by artificial means as a modified one.

Also, the term "vector" is used to refer to DNA fragment(s) or nucleic acid molecules that are delivered into cells. Vectors replicate DNA and can reproduce independently in host cells. The term “delivery vehicle” is often used interchangeably with “vector”. The term "expression vector" refers to a recombinant DNA molecule comprising a coding sequence of interest and appropriate nucleic acid sequences necessary to express the operably linked coding sequence in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

In the manufacturing method according to the present invention, the "plant cell" into which the target sequence-specific guide RNA and endonuclease protein are introduced can be any plant cell. A plant cell is a cultured cell, cultured tissue, cultured organ or whole plant. "Plant tissue" refers to differentiated or undifferentiated plant tissue, including, but not limited to, roots, stems, leaves, pollen, microspores, ovules, seeds, and various types of cells used in culture, i.e., single cells, Includes protoplast, shoot and callus tissues. Plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.

In the production method of the present invention, any method known in the art may be used as a method for regenerating genome-corrected plants from genome-corrected plant cells. The genome-corrected plant cell must regenerate into a whole plant. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vols. 1-5, 1983-1989 Momillan, N.Y.).

The present invention also provides a genome-corrected tomato plant with controlled disease resistance prepared by the above method and a genome-corrected seed thereof.

The genome-corrected tomato plant with disease resistance control according to the present invention is one in which the SlSRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1 ) gene is corrected using the CRISPR/Cas9 system, and the tomato-derived SlSRFR1 gene is knocked out and the genome is corrected It is a genome-edited tomato plant with disease resistance regulated compared to untreated tomato plants. The genome corrected tomato plant is characterized by increased resistance to plant diseases caused by biotrophic pathogens and reduced resistance to plant diseases caused by necrotrophic pathogens compared to the wild type.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Vector construction for tomato transformation

The target site of the SpCas9-gRNA complex was investigated at the N-terminal region of SlSRFR1 using the CRIPSR -P v2.0 program (http://crispr.hzau.edu.cn/CRISPR2/). In addition, two gRNAs were selected considering the on-score, which is a numerical value that can cause genome editing, the secondary structure of gRNA, the GC nucleotide content of the target site, and the off-target sequence. The two gRNAs were linked with the Arabidopsis U6 promoter (originated from Addgene #46968), scafford RNA and poly T through primer dimerization, and the entire gRNA was Level 1 plasmid through the Golden Gate cloning system. cloned into pICH47751 and pICH47761, respectively. Each gRNA module created was cloned into pAGM4723 using the Golden Gate cloning system along with a plant selectable marker (Addgene #51144), SpCas9 (Addgene #49771), and a linker (Addgene #48019) to prepare a construct. The site was named pSlSRFR1-GE.

2. Plant transformation using Agrobacterium and genome editing using CRISPR/Cas9

Tomato transformation and plant selection were performed with reference to previous studies (Plant Cell Rep. 2021 Jun; 40(6):999-1011). Tomato cultivar M82 ( Solanum lycopersicum cv. M82) was mixed with 1/2 MSO medium (2.2 g MS salts + B5, 20 g sucrose, 0.5 g MES (pH=5.7), 7.5 g) at 25°C for 16 hours light/8 hours dark. agar for 1L) for 7 days, then use a knife to make cotyledon explants and prepare PREMC medium (2.2g MS salts + B5, 30g maltose, 0.1g Ascorbic acid, 1.952g MES, 0.2mg IAA (pH = 5.5), 7.5g agar for 1L; After sterilizing the above mixture, add 1.0mg Zeatin trans-isomer, 1㎖ Putrescine (1mM), and acetosyringone (AS) 100μM) and store for one day at 25℃ under dark conditions. The pSlSRFR1-GE plasmid was transformed into Agrobacterium tumefaciens GV3101 (MP90) by electroporation. 3 ml of Agrobacterium having pSlSRF1-GE cultured at 28 ° C for 18 hours was transferred to 30 ml of LB medium (including 50 mg L ^-1 kanamycin and 10 mg L ^-1 gentamicin), and the OD ₆₀₀ value was about 0.8 to 1 cultured until The Agrobacterium was centrifuged at 3,000 rpm for 15 minutes and the pellet was washed in 30 ml of ABM-MS [1.106 g K ₂ HPO ₄ , 0.565 g KH ₂ ] containing 200 μM acetosyringone (#D134406, Sigma, USA). PO ₄ , 0.748 g NH ₄ NO ₃ , 0.0745 g KCl, 0.154 g MgSO ₄ , 0.0075 g CaCl ₂ , 0.0015 g FeSO ₄ , 20 g glucose, 1.952 g MES, 1.1 g MS salts + B5, 2.5 g sucrose (pH 5.5) for 1L]. Tomatoes were transformed by incubating the suspension for one hour at 28° C. and co-incubating tomato cotyledon explants with Agrobacterium for 20 minutes. Tomato cotyledon explants were transferred to ABM-MS containing 200 μM acetosyringone and cultured for 2 days at 25° C. in the dark. Agrobacterium attached to the explants was washed by stirring in 500 mg·L ^-1 titentin solution for 2 minutes. The water remaining on the explants was completely removed using Whatman paper, and the selective medium [SEL4-70; 4.4g MS salts + B5, 30g maltose, 0.05mg IAA, 0.976g MES, 0.5mg zeatin ribose trans-isomer, 70mg kanamycin, 300mg timentin, 1mM putrescine (pH 5.7), 8g agar for 1L] to induce callus Callus was transferred to a new selection medium (SEL4-70) every 2 weeks until complete stems appeared. The explants from which the stems emerged are rooted induction medium [RIM; 2.2g MS salts + B5, 20g sucrose, 0.1mg NAA, 0.3mg IBA, 300mg Timentin (pH 5.7), 8g agar for 1L] and cultured until roots were induced. Healthy plants are grown at 25℃, 16 hours light/8 hours dark conditions.

3. Isolation of Genomic DNA from Tomatoes

Genomic DNA isolation was performed with reference to Pater et al. (Plant Biotechnol. J. (2009) 7:821-835). Using a cork borer No. 5, two leaf pieces from G0 and G1 generation tomato plants were put into a tube, frozen in liquid nitrogen, and ground using beads in a mixer mill (#MM301, Retsch, Germany) for 1 minute. . 300 μl of 2X CTAB extraction buffer (0.1M Tris, 2% CTAB, 1.4M NaCl, and 20mM EDTA) was added to the powder and reacted at 65° C. for 20 minutes. 300 μl of chloroform was additionally added to the tube, mixed vigorously, and centrifuged at 14,000 rpm for 5 minutes. 200 μl of the supernatant was transferred to a new tube, and 200 μl of isopropanol was added to the supernatant, mixed, and allowed to react at room temperature for 2 minutes. After centrifugation at 14,000 rpm for 5 minutes, the pellet was washed with 1 ml of 70% ethanol. DNA pellets were collected by centrifugation at 14,000 rpm for 1 minute, dried at room temperature for 10 minutes, and dissolved in 50 μl of distilled water. Of these, 2 μl of genomic DNA was used in a 25 μl PCR reaction.

4. Analysis of genome editing through sequencing

The SlSRFR1 target region was amplified by PCR in G0 or G1 generation tomatoes and sequencing was performed. The above results were confirmed by ICE (Inference of CRISPR Edits, https://ice.synthego.com/#/) analysis to see how many Indel mutations occurred in G0 or G1 generation tomatoes. To confirm more clear results in the G1 generation tomatoes, Miseq sequencing was performed and analyzed with the Cas-Analyzer program (http://www.rgenome.net/). A 945 bp PCR fragment was amplified using the SlSRFR1-F1/SlSRFR1-R2 primer set, and primers (MiSeq-1-F2/MiSeq-1-R2 and MiSeq-1-R2 and MiSeq-2-F2/MiSeq-2-R2) were used to amplify DNA fragments of 155bp and 150bp in size through secondary PCR. The tertiary PCR fragment was amplified using dual index adapter (a combination of D501-D508 and D701-D712) primers provided by the MiSeq sequencing service (MiniSeqTM System, Illumina, USA), and the degree of indel mutation was analyzed by Miseq sequencing.

5. Cleaved Amplified Polymorphic Sequence (CAPS) Research

In order to find homozygous plants in G1 generation transgenic tomatoes, CAPS analysis using polymorphism of genes was performed. In order to discriminate between the mutation patterns in SlSRFR1-sgRNA1 and SlSRFR1-sgRNA2, DNA fragments were amplified using SlSRFR1-F1/SlSRFR1-Bcc-R2 and SlSRFR1-F1/SlSRFR1-R2. The DNA was treated with Bcc I and Bcg I, respectively, and reacted at 37°C for 3-4 hours. Thereafter, the mixture was loaded on an agarose gel, electrophoresis was performed, and the genotype of the G1 generation was selected.

6. Analysis of outbreaks caused by bacterial and fungal pathogens

Pseudomonas cold dog pv. Pathogenesis analysis by tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000, hereinafter Pto DC3000) was performed according to a previous study (Scalschi, L. et al ., PLoS One 2014, 9:e106429). Pto DC3000 containing the pVSP61 empty vector grown in Pseudomonas medium was diluted to 2x10 ⁸ CFU/ml, and the third or fourth leaf of a 6-week-old tomato plant was treated with the diluted solution for 30 seconds and maintained at high humidity. To do this, it was wrapped in a plastic bag and maintained for 5 days. In Pseudomonas-treated plants, two leaf pieces were put into 10 mM magnesium chloride solution using cork border No. 5 and pulverized, diluted in stages, spread on Pseudomonas medium, and then cultured at 30 ° C. The number of bacteria grown was observed. .

Fusarium oxysporum f. sp. Pathogenesis analysis by Fusarium oxysporum f. sp. lycopersici (hereinafter referred to as FOL) was performed according to a previous study (Kostov, K. et al ., Biotechnol. Biotechnol. Equip. 2009, 23: 1121-1125.) did After culturing FOL in potato dextrose (#254920, BD Difco, USA) in the dark at 30 ° C, it was grown for 5 days at 25 ° C for 16 hours light / 8 hours in the dark and used for the experiment. Using Corkborder No. 1, a fungus grown in the medium was made into a plug and placed on 6-week-old tomato leaves, and left at 25 ° C. for 3-8 days under 16-hour light / 8-hour dark conditions.

7. Trypan Blue Staining

Tomato leaf slices infected with fungi were treated with trypan blue solution (1:1:1=85% (w/v) lactic acid:phenol (pH 8.0):glycerol (≥ 99%), 10mg/ml trypan blue ) for 1 hour. The dyed leaves were soaked in 99% ethanol for one day to remove the pigment. The degree of development of fungal hyphae was visualized using a fluorescence microscope.

8. RNA Isolation and cDNA Synthesis

In the G1 generation slsrfr1 mutant, three leaf pieces were pierced using a cork border No. 5, placed in a 2 ml tube, frozen in liquid nitrogen, and ground using a mixer mill. 50 μl total RNA was isolated according to the RiboEx (#301-001, GeneAll, Korea) protocol, and mixed genomic DNA was removed from the total RNA using the TURBO DNA-free kit (#AM1907, Invitrogen, USA). cDNA was synthesized using the SuperiorScrippt Ⅲ cDNA synthesis kit (#EZ405S, Enzynomics, South Korea), and 1 μl of it was used for the qRT-PCR reaction.

9. Analysis of gene expression through qRT-PCR

95℃ 2 minutes, 40 cycles (95℃ 5 seconds, 60° C. for 15 seconds) to amplify DNA. The relative gene expression levels were analyzed using SlACT and SlGAPH .

10. Protein immunoblot analysis

Two tomato leaf pieces were put into a tube using a cork border No. 5, and 50 μl of 8M urea was put into the tube and crushed using a pestle. After centrifugation twice for 10 minutes at 12,000 rpm, the supernatant was loaded onto a 12% polyacrylamide gel. Protein immunoblot analysis was performed using α-PR1 antibody (1:10,000 dilution, #AS10 687, Agrisera, SWEDEN) or α-Actin antibody (1:10,000 dilution, #AS13 2640, Agrisera), and Clarity Western ECL Substrate (#1705061, Bio-Rad, USA) and SuperSignal™ West Femto Maximum Sensitivity Substrate (#34094, Thermo Scientific, USA).

Example 1. Target selection and SlSRFR1 Vector construction for calibration

SRFR1 is a single-copy gene in Arabidopsis thaliana, and Arabidopsis SRFR1 is mainly composed of 11 TPR (tetratricopeptide repeat) domains involved in protein-protein interactions. The Blast algorithm was used to annotate the tomato proteome, and Solyc02g09280 (SlSRFR1) with 65% similarity to Arabidopsis SRFR1 was identified. Through sequence alignment with Arabidopsis SRFR1, it was found that SlSRFR1 encodes a protein consisting of 1,055 amino acids, with two TPR domains located at the N-terminus and nine TPR domains located at the center.

To analyze the function of SlSRFR1 , the present inventors prepared mutants using the CRISPR/Cas system. sgRNA was designed based on standard conditions, and the 5' end of the open reading frame (ORF) of SlSRFR1 was selected as a site for correction (Table 2).

gRNA target site for SlSRFR1 correction Name gRNAs Target position
on genome Number of off-targets
(<4MMs) sgRNA1
(Target 1) GTAACTTTCGACGCCATCGC
(SEQ ID NO: 4) 5'UTR and CDS One sgRNA2
(Target 2) ATTGACTATAGCAAAACGCT
(SEQ ID NO: 5) CDS 3

Example 2. Generated by CRISPR/Cas9 SlSRFR1 Allele analysis

In the G0 generation, 37 plants regenerated from the transformed cotyledons. Potential genome editing events were demonstrated through genomic DNA isolated from the resulting plants. As a result of amplification of the target DNA region using gene-specific primers and loading on an agarose gel, the size of the amplification product was similar to that of the uncorrected plant M82, indicating that no large deletion occurred in the target region. In addition, as a result of analyzing the amplified region using the Inference of CRISPR Edits (ICE) program, InDel mutations were identified in 14 G0 plants, indicating that the CRISPR/Cas9-mediated editing efficiency was 37.84% (FIG. 2). In particular, it was found that the target site of sgRNA (Target 1) of SEQ ID NO: 4 had a higher number of InDel mutations than the target site of sgRNA (Target 2) of SEQ ID NO: 5.

All InDel mutations occurred at the cleavage site. At the SRFR1-sgRNA1 target site, 1 bp insertions (G0-5, G0-6, G0-7, G0-8, and G0-9) and 3 bp deletions (G0-10 and G0-11) were mainly observed. Two independent events (G0-5 to 9) showed similar correction patterns. Mixed peaks in the ICE-based decomposition analysis confirmed the presence of a heterozygous slsrfr1 mutant in the G0 generation. Therefore, three G0 lines (G0-1, G0-2, and G0-3) were analyzed by advancing to the next generation (G1) to obtain homozygous plants. A PCR reaction was performed using the DNA isolated from the G1 generation plants, and CAPS analysis was performed to confirm homozygous G1 plants (FIG. 1d).

In addition, deep sequencing or Sanger sequencing analysis was performed on all G1 plants identified as homozygous through CAPS analysis. As a result, two types of monoallelic homozygotes (11 bp deletion in TPR domain, slsrfr1-1 ; and 1 bp insertion in TPR domain, slsrfr1-3 ), one type of multiallelic homozygous type (1, 4, and 4 bp deletion, slsrfr1-2 ) and one type of biallelic homozygous (22 bp deletion and 4 bp deletion, removing the start codon, slsrfr1-4 ) were found to produce G1 plants with 4 types of alleles (Fig. 3). . A 1 bp or 11 bp deletion of the TPR domain resulted in a premature stop codon. In addition, mutations in slsrfr1-2 and slsrfr1-4 were identified in the initiation codon. In addition, Sanger sequencing analysis of the purified PCR amplicons revealed that off-target sites were not identified in all subjects.

Example 3. slsrfr1 Analysis of morphology and defense marker gene expression of mutant plants

In the slsrfr1 G1 generation plants, a slight decrease in growth was confirmed compared to the wild-type M82 plants, but no severe dwarfing was observed (FIG. 4a). In addition, the expression levels of SlPR1 (Solyc09g007010.1), SlPR2 (Solyc01g008620.2), SlPR5 (Solyc08g080640), and TomloxD (Solyc03g122340.2) genes involved in plant defense mechanisms were increased compared to wild-type M82 plants. was confirmed (FIG. 4b), and this result meant that CRISPR/ Cas9 -mediated mutation of SlSRFR1 upregulated the expression level of salicylic acid-dependent defense genes and also induced the expression of jasmonic acid signaling marker gene ( TomloxD ).

Example 4. slsrfr1 Disease resistance analysis of mutant plants

Although Arabidopsis srfr1 mutant genes involved in plant defense mechanisms were constitutively up-regulated, it was reported that there was no enhanced resistance to the virulence Pto DC3000 (Kim, SH et al., Plant Signal Behav. 2009, 4; 149-150) and 6-week-old slsrfr1 G1 generation plants showed enhanced resistance to Pto DC3000 compared to wild-type M82 plants (FIG. 5). On the other hand, the parasitic pathogen Fusarium oxysporum f. sp. Lycopersi Seed ( Fusarium oxysporum f. sp. lycopersici ) As in Arabidopsis, it was confirmed that the slsrfr1 G1 generation plants were more susceptible than wild-type M82 plants (FIG. 6).

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Method for producing tomato plant having controlled disease-resistance using gene editing and tomato plant produced by the same method <130> PN21203 <160> 29 <170> KoPatentIn 3.0 <210 > 1 <211> 16345 <212> DNA <213> Unknown <220> <223> Solanum lycopersicum <400> 1 atggcgtcga aagttactga taggattgaa ctagctaagc tttgtagctc taaggagtgg 60 tcgaaagcaa ttcgaattct cgattctctt cttgctcaaa cttgcgtcat tcaagatatc 120 tggtccgtta cgtttttcac tgttccatct ttttccctgt ttgtatatag gtttttggac 180 atttatgaat gaactgatta atttttctga atttaaaatg tgttcaattc tttttcagca 240 accgagcgtt ttgctatagt caattggagc ttcacaagca tgttattaag gattgtgata 300 aggcacttca gctcgatcct aagcttcttc aagcttatat attcaaaggt tcttttcatt 360 ttctccttgc atttccagct aactgttttt accgtgtata agaaatgcga aagagaattt 420 agaagttttc aattgcattt ggaatgtcaa ttttgaatgt ggatgtgttg tggtcaggca 480 tcctaatccc tataggcctg tgaagtcatc tgggatactc taaatttaca attttagggt 540 tcttgttcaa atttaggtga t tggctataa ttgagtaaat ttttctggtt ttggacaaac 600 atgaaccatt ggtaatttcg aggagtagga tgaagctctt gtaaagctag tgaactgttg 660 cacctctcgg ttgatgtcct acaatttacg actattgtca agtatgcgcc aaaataaggg 720 ttagctttaa atgaattgtg tatgtgagaa gccattttaa gcttgataaa ggtcatattg 780 gacttgcttt ctgtatccta tagtggtctt atattatatt tttgaaatga cttttaactt 840 taaaataaac tatgtttggt tggggtataa agggaaggga tggaaaataa aggagggcat 900 aagatggttg aattctatgc tcgcggggta cagtagaggg tttgaccata ttgtgtctat 960 tgttaagtac cttttctcta aaaggctatt tccacggcat gaacgtgtga cctccttgta 1020 tcattgcaac aactccgatc agataaaaag atcaaataca tttttgtctc ttgtgtgtaa 1080 catagccctt gaaataatga tataagaatt tgaattaaca atattcttgt gtggatactg 1140 tggattttcc ctagatgtgg ttatagttta tgctgcagaa atttcaatat tcttaaagct 1200 ttacaaactg gatttttgag tttgaagcat tatgtaacaa agttacttga tacttgttgc 1260 ttaggacgtg cattatctgc tcttggtaag aaagaggaag ctcttctagt ttgggagcaa 1320 gggtatgaac atgcagttca tcagtccgca gacttaaagc aactgttaga gcttgaagag 1380 ctgctcaaaa ttgcaaagca gaacaccgca gtt ggcagca acaatcattc ggtgcagtca 1440 tctggccctg agtccaacac tggacctcct ctttctacca aatctggtga aacttgtgat 1500 attagtaagg cctcagatag ggaacttaaa acatgcagca gtgggatgtt ggaaagctct 1560 gagaaatcaa agaatagctc tgttttacaa aattcctcaa gtaataattc caaaaagcat 1620 aagaagattg agtctgaatc aaaggaattg catgagagac aagcaaataa aaccaacaac 1680 aattgcaaaa aattgggtta tccatctctg gtttgcagtg agttaagtga tatatctgaa 1740 gacagtagga aatcatctgc agtaactagt gaatcaagtg aacagtcaga accaaatgag 1800 ttgcaggaaa ttctcagtca gttgaataat aaatgtgatg ttcgcgttga attgagtgat 1860 gaaggcaaga gaaacaaaaa attttgtgtt accagggtca acaaaaccaa gtccattaac 1920 gttgatttcc gattatcaag gggaatagca caggtacact gcctatcctg tgatattaca 1980 atgaagacag gaagaattag tccatctatt gatatttcct gttagtgcgg ttgatcatta 2040 atatgctatt cttctttatt gaaatacaaa taacaataca tttgtaactt caaatatatg 2100 ccaaagatca acttcatgtc tcaatttgtg agattatttt ctctcaaatt aagtagagaa 2160 atgaattttt tcttgatata tctgctaggt actgggatac catgctcatg catagcagga 2220 aaggccttct actgcagtct tcatgtcttt tctgttcac t ttgcttattt cagttgtaat 2280 ttggtgatta cactccactt ttaattttgt gaacttaact ggaagattct gcatatgttc 2340 aaagcttggg tcaactaagc tctattatta gaattcattt tcttcagtta ctagatttgt 2400 atctctaact cttatgtgtt aaatttatgg agttagtatc atttttgcag tgtgcttgac 2460 tgcatgtttt gctttgttta aacttaagat gtcaaaatag gtttgtgatt gccagtcatt 2520 ctttctctct ctagtctcac atatccgcac tatagtgaca ttaaaacaaa aaagaagaag 2580 agaatttagc ttgattattt cttcaatcta gtagggtgta ttttctttcc tacgccccct 2640 aagctgcggt ggacagaggt attcggtatt tgcaccgata ggaggattta gatacccact 2700 agactacttg agatgcctgt aggttggtcc tgacaccatt gttattcaaa agaatgatgg 2760 taaattgaca atctagctct gtgtgcatat tttttcgtca aacacaagat gtgaaacaat 2820 aagtagtgct gcttgatgtg gttgagatca tggatattct gcttgcaatt gatctgacta 2880 tcacgtctcg ttgcttactt cttcaagaga ttagattatc atgatttaaa atgttgtgtt 2940 tctaaattgg atcatttatc tggggaactt cttgcccatt ttacattaga atatccaaaa 3000 cttgtatgtg tatgctgtcg taatgcagta gtagttgtct ccaaaatccc ttgatgtagg 3060 taggatgcag attatgacat ttcacaagga gcctggagag actg gttaat cactctaaca 3120 accaattaga tgatgtgtca tgcaattgtg aaatacttga gtttgccagc aattcttcta 3180 tattgatcca gaccttctag agatatccat ccaaaactag tcttgacact tggatccata 3240 gaggtatcaa taagtttgca atctagtata ccttgtttct tccaatatat caggtggata 3300 cttcccttag gccttatgat attggacgtg caaacttgat ggttaggatg tattttatgt 3360 ttctacaagt gcctagtctt aaaatgactg gtgttgtata ataccttgaa gcctataagg 3420 ttgtaaggaa acagagtaaa acagatcaaa ctatgcttaa tgagactgct taagaccata 3480 aattatcggc cttgtcgaaa cgctacttta aactcttctt agttgatgtc taactgatga 3540 ctgatgaagg aactagtgga gcgtggtcgc catagaaatg gaaagaccag cacatgcaat 3600 tttagttgct aagagagagt atcaaccatt gccatatatc tgaatgtatt tgttgacaat 3660 tgattgagct ttgagacaat tataaccatc ttgattataa atactcaatg aaatccaact 3720 gtagttttat tcctgtggag gatctatctc tgaagtgcca ctgttttttg ttgtcaggca 3780 tctccttaga tatgcatgca attggtttta ccagtctaag atattgaatt tgtgcataat 3840 ttgtaatgca agcatgatat aaatgtgaaa aacaatgtga aacacctact ggattagttg 3900 gtagacgatt tgctcaaagc tgtcttcagt agaaccaaag aagagaagaa aattgttgga 3960 gaactgtcat aggggaagta agtttgtatc acaaaaaaac aaggatgaga atcgtgaaaa 4020 atgtttagtt tgctattccc tcaaggtaat gaagtttaaa tagtgtttac atatgatata 4080 atataggaag attgaatttc ccggattaat atttgttggt agcggaaagg gggatgcgag 4140 tctgagatgg ttcggatatg taaagaggag atgcacatat gttccagtga agaggtgtga 4200 gcgagtttgt ctatggtgga tctgaggaga ggtaggtgta ggttgaagaa gtattgtgta 4260 gaaatgatta gttgaacatt gtctcgctgt catttaggag gggcatgatg atagtttgga 4320 acaaattact tgttggctgt cctttctttt ccatattagt attattgtta ttactcttct 4380 attatattat tctccgattt ttattagtac atattttttc ctttgcttta attatcgtag 4440 tattgtttgt tgttgttact gttcttttct ccattatttc cgacatgaat tcttcacaac 4500 tgtatctcct tttcaaacct gctttgaatg ctttacttga gccgagggtc tatcggaaac 4560 aaccactcta ccctcacaag gcaggcacca cccttcccaa acctacttgt gggattacac 4620 cggatatgtt attgttatgt gatattccct gatctcctat acatatttcc ttatctaagt 4680 ccttaattac aaaatattct taacaagatc aatcatctct gagataataa atacaattcg 4740 aaatattaag gttaatccaa atatttttat cttgcaacaa tagtttcctt ttttt tcttt 4800 tttcttaaac aagaaatatt tttaactttg taagttgagc agcaacgcca tttttagtga 4860 aaattgtgct taagtatgtt ggatggaaac tagcaaagcg aacacatgac ttacccgaaa 4920 gccaagttgc tcggactcta tactttcagt gtcgcacccg tgttgacacg ccatgggtgt 4980 gggattcgta cccggtatgg tcaaccagtt ttggatactc tgaacaaatt cgagggagaa 5040 attctggaca ggttcaatga tttttgtaat caaaacaaaa ctaatgtgat ttgaagaaaa 5100 tggaatgcct tgtatatata aatttcattt gtcaccccct ttccttttat ctccttccaa 5160 gattctcctc ttgatcaaat attttctcct caacttttcc gcataatatc tcataatttt 5220 aggttttata actctattag tagatatttt gaattatctt tcggcgaatc cccacatccg 5280 tttccataca tggatcttta tctctgaatc ttaaaattta tatcatagag gatccgacct 5340 ctagatccgc acctgcattg ggcacctgta cccgagtctg agcaacttaa cccgaaagaa 5400 gtttcaaaag agattgcacc cattcggtga tttagtggat gtaattaacc aggacttgag 5460 ttaaactatt tctttctatt cccatgtctt gactagcgat attcagttcc ttttcgtaag 5520 tatatatttg taggtaatta tattttttcc tcgatcttcc agttacgaca ctatttaatc 5580 atgtattcat cgtatttaat tgagaaatat ggtcaacgag gaatcatcta gccggctctg 5640 acttgcttgg ttttgaggcg tagtaatagt tgttattact cgtcatcctg tacaaacata 5700 gaagcgtaaa acaatatttt tggtgatttc aggttaatga aggaaaatat agtaatgctg 5760 tatccatctt tgaccaggtt agcattagcc ttaccactct tcgatatttt actagttttg 5820 tttgctagat gtgccttgtg ctttattttg ccctttttca tgtttgaatg gattaaacgg 5880 aggacttgtg tgtggcatgc tgaacttact tacggagctt cttctcttct atctataata 5940 acacagatac tagaacaaga tccaacgtac ccggaggcac ttatcggccg gggaacagcg 6000 ttggcatttc aaagagaact tgatgcagct atttctgatt ttacaaaggt ttgcattgat 6060 ttggccattt aagtaccaat tgaggtaata cttcaacccc tgttgtaaat atttaccacc 6120 tgcctttcag gccatacaat caaatccatc tgctggagag gcctggaaac gcagagggca 6180 agcccgtgct gctttaggtg aatctgttga ggtataaaat tcgtatttgt ctatttattg 6240 agctatcttt tggcttttgt cttcagggta ttcttttctg ctatatttat tttttttcaa 6300 agtcaacttt caatgatctc ttctgtggat gtgatgtgca gtgtaaatga tgtggaatta 6360 ctgaatttta tcacttgtgc tatcagattt tgaaaccaaa tttttcgtta atagcaatca 6420 gactccagtt agaccactag ggatattatc aagaggcact tggttatttt ccttcagatt 6480 g tggtagctt acagagttaa tgatggaaga tgaaatgtct ttggatgttc taactaaggc 6540 ttgagctata tcacaactta tgagcatctt cccgtgaaag ttaaattcta aaatggaatc 6600 aggagcataa cattattcag ctgcatcctt ttgatcatgg gagtttcttg gtagtctaag 6660 tctaaaacat aattttaaca ttctgatgag ttagttttag ttttgttttg ctccgattat 6720 cccatggaga gtgatattag ttacatttaa acgcttttta cttcctaaaa atgttggttt 6780 cacagtaaaa gtagtatgat tgatatttgt gacttggtat atctaaacaa aatgatttta 6840 caccaggcaa ttacagactt gaccaaagcg ttggaatttg agccagactc tgccgatata 6900 ttacatgaaa gaggtgacga gactgaactc ttccatttac tatgaacaat tggatttatg 6960 ctgttaaagt agatagacat aaatagcaaa acatacattt tatgacagat agcttttgtg 7020 catgtaattt gaaactaagg ttcactttca tctttacaac actgagatta tttattgagg 7080 cccataggtg gtttcatctt gtaactattt tgcaataaat gacctctagc ggaatattcc 7140 ataatttctt gagatttcag aaaagatcat ttgattggac aaagtttgtt caatctaacc 7200 tgggagtcac taactctcct taattagtgc aggaattgtc aattttaagt ttaaagattt 7260 caaaggtgct gttgaagacc tctctacatg tgtaaagtcc gataaggata ataaatctgc 7320 gtataca tat ttggtgagtc tatgaccttg agtctaccaa ttgttgtaga atgagctaag 7380 aatgtttatc cgcaaaagtt tgagaaattt tttgttggaa aaatactgat ataatgctgg 7440 tcgaaaaaaa tttggaaaat tatcagggtt tggcgttata ctctctagga gaatatagga 7500 aggctgagga ggcacataag aaagcaatcc aaattgaaag gaatttcctc gaggcttggg 7560 ctcatctagc acaggtatct ctgaatatat ggtgaatact cttaatgcta tttttcctgc 7620 caagtgggat cccaatactt ctattggtag tgctgatgat atagagtttc ttgatgatga 7680 agttgccttt tgacttcgag aattttctta taccaagttc ttgtttttgt ttgtctcttt 7740 tttcaccggt atctggaact caaggttgag gtaaatatat acttctgcat gcaagttaag 7800 aaattcaaga ataaggattt aaatggcaag tagacattct attgcttaac cagtgatgaa 7860 gagcctaact ctctgttatc agatattgtg tgagcgttca tcttctgggg tgcaatgcac 7920 atgtattgta atagcttttg ccttgttgca ttttcagata aggtctcctg attagctggt 7980 agatgttatt aatttacatc atcaaattgg atgtttatgg aatatctatt gccataagtt 8040 taaaattcct aagactcagg agctgctcta acctagttct tgattggttg agtttcttca 8100 cttatattaa atgtggcaaa acaatgagat ctctttgaag atattttttt aatgatgtat 8160 ttgattattg aa gaatcttt atctttggtg cagttttatc aagacctagc aaactcagag 8220 aaggccttgg aatgccttca tcagattttg caaatagatg ggaggtgatt actgaggatc 8280 tcaatattta catctttttc accgataaat atctaatctc gagtatttga atggtgaagt 8340 ataaaaccta tcctcaaata ggaatataac tgataatcca tcctctatct accctttttc 8400 gttggaaggt acgcgaaagc atatcacctg cgcgggctgc tacttcatgg aatgggagag 8460 cataggtaca tatttctgaa aaattttgct gtcctgagtc tcccctttct ctcttttttg 8520 tcaaattttc tatgtataat cctcttttaa cgaaaaatgt agcaggcctt aactgcctat 8580 atatgctgtt acaggaatgc tataaaagat ttatcaatgg ggttggctat tgatagcgca 8640 aacattgaat gcttgtatct acgagcttct tgctatcatg ctattggatt atataaagaa 8700 gcagtatggg cattttcaaa ctcgtctctt gtgacttttg agtattctta aatattttaa 8760 ggtggttgtc tccaatttca gattattgat tctgaattta tgctgtaggt gaaggactat 8820 gatgctgctt tagatcttga attagattct atggaaaagt ttgtgcttca atgcttggcg 8880 ttctatcagg taaataagta tatgccagat ttccgtccat cgagctggtt caatgttatg 8940 cctctactaa gtattgtttt cttttgtgtt gcactatttt ctttttgctt tctaagtttt 9000 ggcattttct aactgtta gc ttttaccttg ctggaatggt tctcgattct caagtggaca 9060 actcatactt caaattttag atttgtcatt tcgggttgtt agccatttta gtagttgcaa 9120 ttttacattt acttaagtta gtagtcaaaa atttagcaat tttacatttt cccacaaatt 9180 gtccaaacat tggctaaatt tctgaccatc tttttgttcc gttaagccac tgttggacag 9240 tttgggtcga agtggccgat ggttaacaaa gccaagcttg gcttggttta agcttgatta 9300 tgattgcgtt taggtgtccc gcatattcaa acctagcaca aatgtcccta ccaaaagctc 9360 gagttgacag atgctagctt gtgagcccag ttaagttggc agtgttcttt tcacttaacc 9420 attacacatc cggtaaaata agattttgct acccggatca tttaatagtc ctatggaaac 9480 tcttttcatt ctagttgtgt gctcctcctc cttcctcatt cttgtgaaca gccttctgct 9540 tcctgcctgt gacaatacag gtgcagccat tatcatgaga caccaattga tctctctatc 9600 tctgttattt tttgtccaat ttctatttca gtttgaatag cttatgtttt gcttttcaat 9660 atttttccct tgcagaaaga aattgcatta tacactgcat caaagatgaa cagcgaattt 9720 tcttggtttg atattgatgg agatatcgat ccccttttca aggtaatgtc taaaaagaga 9780 atatattgct tggttatttt ttgatacact cattaaaaac aacacggaat attctggtag 9840 cctctgtacc gcctctttct gag agaattg ggaaaaggaa tgaagtttga agttatagca 9900 aaaagtacta tctggtggga attacgcaga actttgaagg ttagcagaga atttggagaa 9960 tgaatgaagt ttaaagaaat aaggcctcac tgattcaatt tgaattcgat tataagctta 10020 cctgaagaat ttgaccgtga aatcactaca actctgtcaa agtaattgga cattttacca 10080 tatcttttaa catgctcata ctctattatg tagagttatc ccttttaggc ttcaaaacct 10140 tctttagagc ccccatcatt tccttaaccc ccactaaatg gttggaaagt gatctcttct 10200 caaccaatag tctcataaga ttgctacaac agtttcattg ctcaattact ttatcatgag 10260 tagagtggca atggatacaa ggactatcta gaaacgtaaa ggttgctttc actgagttgc 10320 tgctgcagac attgcttgca ctttaagtat gtgctttatt tggtgcatat gttccttcat 10380 agttagttgt caatgttctt ttgctgatcc atgtcgaatg ggtgtgcgga gtctggaaaa 10440 tactaaacgt tctgaaaaag tcacaggtac ccatatggat aggacaaagt tactggttcc 10500 agttaggtag ataatcaatg aaggtacaac atgcatatac cagtgatagt tttctggaat 10560 gatgtgtagt ctccagttca taaacctaac agtgctttaa tcacttttat gcacctggag 10620 ggtccagggt gataccttta caaagtgaac tgtcatggga aaacctttga tttcaaatga 10680 tggtttcttg acagatat gt gggatcattt cattaatttt aggggctaat aatcagtttt 10740 tgtaaatctc ggatctaaag tggtagatac ctctatgaag tgaactgtca tctgaaaagt 10800 gcttttgttg gcagtgaatt tcttatctca aagttattat ttccattgac ttcgtgttct 10860 tatacttcgt tctcaattcc tacttttttt tcccttctgt tctcaggagt attggtgcaa 10920 aaggctgcac ccaaaaaatg tttgcgaaaa ggtctacagg caacctcctt taaaagaatc 10980 tttgaaaaag gggaagcaaa gaaagcaaga atttactttc accaagcaaa aaactgccct 11040 tctacaggct gcagattcta tcggtagaaa tatccagtat cattgtccag gtttcttgca 11100 taataggcgc caggtaattc taaaaagagt taaatattaa gttaactttg ttctttctaa 11160 aaaaacccag agctccacat tttccttgag aaacctgata gtgatttcct gttgctttat 11220 tagatgcctt tttatgcttt gctttcacat ttcctctaat atagacaatg agaatattga 11280 aggaaaagaa tatgaaaatg ttaccagaac cttttgtttg cattagttgc cttgtaattg 11340 agggatttga actgatatgc cgattataag agaaagttct tgtacaagaa tgttaccttt 11400 attttcacac tcaacgtttc ctctccagct ttcgctgtac acactccttg ttttccatca 11460 atagttagtt actttccatg aaatataaaa attaaggaat tcatctcaaa ttaggttatc 11520 ggaaaaaaaa gaagagaatc catctgtcaa cagaagattt tcactatttg tggactagtg 11580 ttctatcttc tcttagcaca gaaagtgaga tttggatctt aaagacaata acaacaaacc 11640 cagcgaaatc tcactacatg ggctctgggg atcttaagga ctgtttagca ttttatattc 11700 cacaattatg aatgataact ttctacacac actgttaaat aagattgagg tgactgccaa 11760 gtgccaaggc tacatttcta gtgaaaatgt ctaaaatgaa tagcatgcaa ctaataataa 11820 tacttataga tgtgaataat gatgttagac taagaatgcc aagttttgat ggtcatctag 11880 tgcaaaaagg gttggcgtct ttagttttgt ggagacactt ataggaagca gttgtctttc 11940 gcccttcagc ctctaattct gtaatatgta tgttgtggag caatttccga tgttaactgt 12000 gatgctcttt gtagttattt cgttgagtta gtttgtgcaa tggttgtaaa cagtagtatt 12060 agatttgtgc ctttctaact tgtgttgctt tttcatgatc aaaatttctc ttttcttatc 12120 tagtgaagag gatctattgt tcgtagtgta tctcttagac cttatcatga cattcttttc 12180 tttttgcaat ttaaagatga tataatatct ttattacaga tagtggattc ataaattatt 12240 gttatgtact aatatgctgc tctttagcta caaacatgct tgccacaatg tttttattct 12300 ttcacccaaa tctgagaatt attttgcaat tatcagcacc gcatggcagg attagctgct 12360 att gagatag cacaaaaagt ctcaaaagct tggcgtgcct tacaagctga atggagaaac 12420 tcaactaaag gcacagggaa gtctgggaag agactcagga gaagggaaaa actaaattct 12480 attagtttaa acagaggtgg agctggttgt agcactagca gttcctccga cacatctact 12540 tcatacagtt tgattgatga taggtcaact ggacgttcca tgatgtcatg gaaccacttg 12600 tattcattgg ctgtcaaatg gagacaaata tctgaaccat gtgatccagt ggtgtggatt 12660 aacaagctaa ggtactccac ctgctattaa tttactgaag tttagttagt tattaaagtt 12720 cattgaaatc atacttggtc tcagcattct aacaaatatc tactacattt tgctaaagtc 12780 attccgattt gaattgagta cacaatgata tttttttctt ttatttttga taaagagctc 12840 ttatttctta atatcaacaa tgatattctc ttagtacata aagataataa gaatcactat 12900 cttcaccaca agcatgaaaa aaaccctcct tcaatttgct taacttgctc cgtttgatcc 12960 tttagttcta tggagttatt tcccagcttc tgtgttggtg tacttcactc tcatttggag 13020 cactcacgaa aagaaggatt ctagcatgta tgacttttga agtttgggtg aagatcttgg 13080 aggactaaag acctatttca ctttggctcg tctaagaaac taagactaaa atcattaatt 13140 cgtatttacg ccgggataac tagatatacc acactactta ccacgtcgac gagattctag 1 3200 tgtatgaagt gagcccccta aaaagtcgta gagaaattca agaaaaaaca cctgtcatgc 13260 gaatcaaata tccatacact tacccaatta tctaagcagt gagagcatta tgcgcaagtc 13320 taaacacatt agtaataatt tgataaaagg agaacaataa atccaactaa atccataatc 13380 gtatcattaa ttccacgatc accaaatacc ctctgcccaa aatacgaccg tgaagcatct 13440 aatagagtta atgagttcag ctatcaggca tggaaatccc aagaaagaag atatatgcta 13500 taaaatagat agagctgaaa caacggcctc cactaaaggt ctttagcttt actataatga 13560 agataatgat tctaatgtgc cgctttggct ttactttttg atgagaattc ttgttttttt 13620 gcatagtgag gaatttaata ctggttttgg gtctcacacc cctcttgttc tcggtcaagc 13680 caaagttgtt cgctaccatc ccaattttca gaggtaagag ctttaccttt ctgataagcg 13740 caaatgtatt tttttactat tatttttttg tgtaacatgg atactgcaaa tgatactgat 13800 gctatgattg accttttgag ctcattacag gatgtgtaaa ttgatgctac ccttgtaaat 13860 aactttacaa cagcttgctg ctggccatga ataaaaattc ctttttaaca gtcaaaaggc 13920 ataacctttc ttatttgtat tagctctttc tcaaggctct tattgtctgt caatgttcag 13980 aaccttgact gttgccaagg ctgttatcaa ggagaataaa tcagtgtgca acaaggaaga 14040 caagataatt gatctttctg aacaacagaa gttgcaagaa gtgagtttgt ttgcttatga 14100 cctaaattca tcttttgcac tgttttgcct ttttcacagt gtatagtttt tggttgttga 14160 taattatttt tctggttcat gtcaaaatac ctactttata gcatttccca tgacaataaa 14220 agcgtcaaat tgagaaatct ttattaggct gattttatat tggtcacatt tcttcctta g 14280 atgttaactg atggctctct gaaatcaaac taggtgtcca cttgctagga ttaatacttc 14340 agtgccatac cttttttttt ctggtggtaa tcaacacctg aactgtactt tgcagataat 14400 ggctgcagaa tccagctcag atctttacag agttgttggt caagactttt ggttggccac 14460 ctggtgtaac agtacggcac ttgaagggta attttttata tttagtcctc tttatactgt 14520 ataacagtat gttactcttg aatattatct ctcatcgggg tcttttttct aattttccct 14580 cctttcttat tgcctgatca ggaagcgtct tgaaggaaca aggatcactg ttgtgaaaat 14640 gtagaacacc atttaacctt attggaattc aaccttttgt gtgtgtggaa aggagggtga 14700 cttgagtaaa atatcactta aactagatct gatttttctt attcctgtca acttttgttg 14760 ttccttccag gggtgagatt ggttacgact ttgcaattag aacaccttgc acacctgcta 14820 gatgggatga ctttgatgtg gagatgacat cagcctggga ggtatcctct tgatttatta 14880 ctagaaagcc attttctact ccatgacata gtttttggat atttgaaagc aatattacat 14940 caatgtaaaa cagtaacaca aaaattcttt agtggtcgtt ttgtaggctg tattaggtag 15000 aataatgcta gtactaaatt ttagtacaat gtttggtttt aaatctcacc tatgtactac 15060 taataccagt attacttata caccctattt aatacgattc ttatgcatag t aaaccatgg 15120 cattaactat atcagtacca ttcctatact cataatcata caccctattc agtagtactc 15180 ttgataattc aatgcatgtc agattgctag ttttagtaca acaaaccaaa caatcaataa 15240 gaaatgatgt cagcataaaa attccctgta ctagtcttca aaccaaacag ccccttatag 15300 tacagttttt catggtttat tcatcttgtg cctgctcgga gatgatcagt taagtcttat 15360 aataagccta tattagtcag cttgggagtc tgttcatcag actattctct cacttttaaa 15420 aagagatttt gctaagcact gaaacaagca gaagtaatga accttttcct gtctgaacat 15480 agaagtaagc attatgcctg agatgatctg ggtttttgtt cggtatgatc tttctgaaat 15540 gatttggcat atatttctta cttgaacctg tttgtagacc tactattttg tttctaactg 15600 aagctttatc tatacccatt aatttcctat tgttgcttgc ttctgtttgt gtagctccct 15660 ttttttccct cctttcttct ttttatttgt tcttgagaca cacatatatt ttctgtttgg 15720 tacttaaata atagtgttct aattaagtta actaactagt gcccgaaagt tggcccggac 15780 accacggtca tcacacacac aaaaaaaaga gttaactaag ttgagactta aatgatagtg 15840 ttctagttag accaagttga acacaaaact gttatgcagg ctctttgtgc tgcgtactgt 15900 ggtgataatt atgggtcaac agattttgat gtgcttgaaa atgt gagaga tgcaatctta 15960 aggatgacat attactggta agatatatta acttctattt ggttgatcac aagggaagcg 16020 tatggttctc tttaatttgt ctgataattt ttgcaggtat aatttcatgc cgctttccag 16080 aggaactgct gttgttgggt tcatagtttt gcttggatta ctgctcgctg ctaatatgga 16140 gttcacagga agcattccaa aaggtctgca ggtggattgg gaagccatcc tggagtttga 16200 ctcgagttcc tttgtagatt ctgtaaagaa atggttgtac ccatctctca aagtcagcac 16260 atcgtggaaa agctacccag atgtcacgtc aacatttgag acgactggat cagttgttgc 16320 tgctctgagc acctattcag actaa 16345 < 210> 2 <211> 3168 <212> DNA <213> Unknown <220> <223> Solanum lycopersicum <400> 2 atggcgtcga aagttactga taggattgaa ctagctaagc tttgtagctc taaggagtgg 60 tcgaaagcaa ttcgaattct cgattctctt cttgctcaaa cttgcgtcat tcaagatatc 120 tgcaaccgag cgttttgcta tagtcaattg gagcttcaca agcatgttat taaggattgt 180 gataaggcac ttcagctcga tcctaagctt cttcaagctt atatattcaa aggacgtgca 240 ttatctgctc ttggtaagaa agaggaagct cttctagttt gggagcaagg gtatgaacat 300 gcagttcatc agtccgcaga cttaaagcaa ctgttagagc ttgaagagct gctcaaaatt 360 gcaaagc aga acaccgcagt tggcagcaac aatcattcgg tgcagtcatc tggccctgag 420 tccaacactg gacctcctct ttctaccaaa tctggtgaaa cttgtgatat tagtaaggcc 480 tcagataggg aacttaaaac atgcagcagt gggatgttgg aaagctctga gaaatcaaag 540 aatagctctg ttttacaaaa ttcctcaagt aataattcca aaaagcataa gaagattgag 600 tctgaatcaa aggaattgca tgagagacaa gcaaataaaa ccaacaacaa ttgcaaaaaa 660 ttgggttatc catctctggt ttgcagtgag ttaagtgata tatctgaaga cagtaggaaa 720 tcatctgcag taactagtga atcaagtgaa cagtcagaac caaatgagtt gcaggaaatt 780 ctcagtcagt tgaataataa atgtgatgtt cgcgttgaat tgagtgatga aggcaagaga 840 aacaaaaaat tttgtgttac cagggtcaac aaaaccaagt ccattaacgt tgatttccga 900 ttatcaaggg gaatagcaca ggttaatgaa ggaaaatata gtaatgctgt atccatcttt 960 gaccagatac tagaacaaga tccaacgtac ccggaggcac ttatcggccg gggaacagcg 1020 ttggcatttc aaagagaact tgatgcagct atttctgatt ttacaaaggc catacaatca 1080 aatccatctg ctggagaggc ctggaaacgc agagggcaag cccgtgctgc tttaggtgaa 1140 tctgttgagg caattacaga cttgaccaaa gcgttggaat ttgagccaga ctctgccgat 1200 atattacatg aaagaggaat t gtcaatttt aagtttaaag atttcaaagg tgctgttgaa 1260 gacctctcta catgtgtaaa gtccgataag gataataaat ctgcgtatac atatttgggt 1320 ttggcgttat actctctagg agaatatagg aaggctgagg aggcacataa gaaagcaatc 1380 caaattgaaa ggaatttcct cgaggcttgg gctcatctag cacagtttta tcaagaccta 1440 gcaaactcag agaaggcctt ggaatgcctt catcagattt tgcaaataga tgggaggtac 1500 gcgaaagcat atcacctgcg cgggctgcta cttcatggaa tgggagagca taggaatgct 1560 ataaaagatt tatcaatggg gttggctatt gatagcgcaa acattgaatg cttgtatcta 1620 cgagcttctt gctatcatgc tattggatta tataaagaag cagtgaagga ctatgatgct 1680 gctttagatc ttgaattaga ttctatggaa aagtttgtgc ttcaatgctt ggcgttctat 1740 cagaaagaaa ttgcattata cactgcatca aagatgaaca gcgaattttc ttggtttgat 1800 attgatggag atatcgatcc ccttttcaag gagtattggt gcaaaaggct gcacccaaaa 1860 aatgtttgcg aaaaggtcta caggcaacct cctttaaaag aatctttgaa aaaggggaag 1920 caaagaaagc aagaatttac tttcaccaag caaaaaactg cccttctaca ggctgcagat 1980 tctatcggta gaaatatcca gtatcattgt ccaggtttct tgcataatag gcgccagcac 2040 cgcatggcag gattagctgc tattgag ata gcacaaaaag tctcaaaagc ttggcgtgcc 2100 ttacaagctg aatggagaaa ctcaactaaa ggcacaggga agtctgggaa gagactcagg 2160 agaagggaaa aactaaattc tattagttta aacagaggtg gagctggttg tagcactagc 2220 agttcctccg acacatctac ttcatacagt ttgattgatg ataggtcaac tggacgttcc 2280 atgatgtcat ggaaccactt gtattcattg gctgtcaaat ggagacaaat atctgaacca 2340 tgtgatccag tggtgtggat taacaagcta agtgaggaat ttaatactgg ttttgggtct 2400 cacacccctc ttgttctcgg tcaagccaaa gttgttcgct accatcccaa ttttcagaga 2460 accttgactg ttgccaaggc tgttatcaag gagaataaat cagtgtgcaa caaggaagac 2520 aagataattg atctttctga acaacagaag ttgcaagaaa taatggctgc agaatccagc 2580 tcagatcttt acagagttgt tggtcaagac ttttggttgg ccacctggtg taacagtacg 2640 gcacttgaag ggaagcgtct tgaaggaaca aggatcactg ttgtgaaaat gggtgagatt 2700 ggttacgact ttgcaattag aacaccttgc acacctgcta gatgggatga ctttgatgtg 2760 gagatgacat cagcctggga ggctctttgt gctgcgtact gtggtgataa ttatgggtca 2820 acagattttg atgtgcttga aaatgtgaga gatgcaatct taaggatgac atattactgg 2880 tataatttca tgccgctttc cagaggaact gc tgttgttg ggttcatagt tttgcttgga 2940 ttactgctcg ctgctaatat ggagttcaca ggaagcattc caaaaggtct gcaggtggat 3000 tgggaagcca tcctggagtt tgactcgagt tcctttgtag attctgtaaa gaaatggttg 3060 tacccatctc tcaaagtcag cacatcgtgg aaaagctacc cagatgtcac gtcaacattt 3120 gagacgactg gatcagttgt tgctgctctg agcacctatt cagactaa 3168 <210> 3 <211> 1055 <212> PRT <213> Unknown <220> <223> Solanum lycopersicum <400> 3 Met Ala Ser Lys Val Thr Asp Arg Ile Glu Leu Ala Lys Leu Cys Ser 1 5 10 15 Ser Lys Glu Trp Ser Lys Ala Ile Arg Ile Leu Asp Ser Leu Leu Ala 20 25 30 Gln Thr Cys Val Ile Gln Asp Ile Cys Asn Arg Ala Phe Cys Tyr Ser 35 40 45 Gln Leu Glu Leu His Lys His Val Ile Lys Asp Cys Asp Lys Ala Leu 50 55 60 Gln Leu Asp Pro Lys Leu Leu Gln Ala Tyr Ile Phe Lys Gly Arg Ala 65 70 75 80 Leu Ser Ala Leu Gly Lys Lys Glu Glu Ala Leu Leu Val Trp Glu Gln 85 90 95 Gly Tyr Glu His Ala Val His Gln Ser Ala Asp Leu Lys Gln Leu Leu 100 105 110 Glu Leu Glu Glu Leu Leu Lys Ile Ala Lys Gln A sn Thr Ala Val Gly 115 120 125 Ser Asn Asn His Ser Val Gln Ser Ser Gly Pro Glu Ser Asn Thr Gly 130 135 140 Pro Pro Leu Ser Thr Lys Ser Gly Glu Thr Cys Asp Ile Ser Lys Ala 145 150 155 160 Ser Asp Arg Glu Leu Lys Thr Cys Ser Ser Ser Gly Met Leu Glu Ser Ser 165 170 175 Glu Lys Ser Lys Asn Ser Ser Val Leu Gln Asn Ser Ser Ser Asn Asn 180 185 190 Ser Lys Lys His Lys Lys Ile Glu Ser Glu Ser Lys Glu Leu His Glu 195 200 205 Arg Gln Ala Asn Lys Thr Asn Asn Asn Cys Lys Lys Leu Gly Tyr Pro 210 215 220 Ser Leu Val Cys Ser Glu Leu Ser Asp Ile Ser Glu Asp Ser Arg Lys 225 230 235 240 Ser Ser Ala Val Thr Ser Glu Ser Ser Glu Gln Ser Glu Pro Asn Glu 245 250 255 Leu Gln Glu Ile Leu Ser Gln Leu A sn Asn Lys Cys Asp Val Arg Val 260 265 270 Glu Leu Ser Asp Glu Gly Lys Arg Asn Lys Lys Phe Cys Val Thr Arg 275 280 285 Val Asn Lys Thr Lys Ser Ile Asn Val Asp Phe Arg Leu Ser Arg Gly 290 295 300 Ile Ala Gln Val Asn Glu Gly Lys Tyr Ser Asn Ala Val Ser Ile Phe 305 310 315 320 Asp Gln Ile Leu Glu Gln Asp Pro Thr Tyr Pro Glu Ala Leu Ile Gly 325 330 335 Arg Gly Thr Ala Leu Ala Phe Gln Arg Glu Leu Asp Ala Ala Ile Ser 340 345 350 Asp Phe Thr Lys Ala Ile Gln Ser Asn Pro Ser Ala Gly Glu Ala Trp 355 360 365 Lys Arg Arg Gly Gln Ala Arg Ala Ala Leu Gly Glu Ser Val Glu Ala 370 375 380 Ile Thr Asp Leu Thr Lys Ala Leu Glu Phe Glu Pro Asp Ser Ala Asp 385 390 395 400 Ile Leu His Glu Arg G ly Ile Val Asn Phe Lys Phe Lys Asp Phe Lys 405 410 415 Gly Ala Val Glu Asp Leu Ser Thr Cys Val Lys Ser Asp Lys Asp Asn 420 425 430 Lys Ser Ala Tyr Thr Tyr Leu Gly Leu Ala Leu Tyr Ser Leu Gly Glu 435 440 445 Tyr Arg Lys Ala Glu Glu Ala His Lys Lys Ala Ile Gln Ile Glu Arg 450 455 460 Asn Phe Leu Glu Ala Trp Ala His Leu Ala Gln Phe Tyr Gln Asp Leu 465 470 475 480 Ala Asn Ser Glu Lys Ala Leu Glu Cys Leu His Gln Ile Leu Gln Ile 485 490 495 Asp Gly Arg Tyr Ala Lys Ala Tyr His Leu Arg Gly Leu Leu Leu His 500 505 510 Gly Met Gly Glu His Arg Asn Ala Ile Lys Asp Leu Ser Met Gly Leu 515 520 525 Ala Ile Asp Ser Ala Asn Ile Glu Cys Leu Tyr Leu Arg Ala Ser Cys 530 535 540 Tyr His Ala Ile Gly Leu Tyr L ys Glu Ala Val Lys Asp Tyr Asp Ala 545 550 555 560 Ala Leu Asp Leu Glu Leu Asp Ser Met Glu Lys Phe Val Leu Gln Cys 565 570 575 Leu Ala Phe Tyr Gln Lys Glu Ile Ala Leu Tyr Thr Ala Ser Lys Met 580 585 590 Asn Ser Glu Phe Ser Trp Phe Asp Ile Asp Gly Asp Ile Asp Pro Leu 595 600 605 Phe Lys Glu Tyr Trp Cys Lys Arg Leu His Pro Lys Asn Val Cys Glu 610 615 620 Lys Val Tyr Arg Gln Pro Pro Leu Lys Glu Ser Leu Lys Lys Gly Lys 625 630 635 640 Gln Arg Lys Gln Glu Phe Thr Phe Thr Lys Gln Lys Thr Ala Leu Leu 645 650 655 Gln Ala Ala Asp Ser Ile Gly Arg Asn Ile Gln Tyr His Cys Pro Gly 660 665 670 Phe Leu His Asn Arg Arg Gln His Arg Met Ala Gly Leu Ala Ala Ile 675 680 685 Glu Ile Ala Gln L ys Val Ser Lys Ala Trp Arg Ala Leu Gln Ala Glu 690 695 700 Trp Arg Asn Ser Thr Lys Gly Thr Gly Lys Ser Gly Lys Arg Leu Arg 705 710 715 720 Arg Arg Glu Lys Leu Asn Ser Ile Ser Leu Asn Arg Gly Gly Ala Gly 725 730 735 Cys Ser Thr Ser Ser Ser Ser Asp Thr Ser Thr Ser Tyr Ser Leu Ile 740 745 750 Asp Asp Arg Ser Thr Gly Arg Ser Met Met Ser Trp Asn His Leu Tyr 755 760 765 Ser Leu Ala Val Lys Trp Arg Gln Ile Ser Glu Pro Cys Asp Pro Val 770 775 780 Val Trp Ile Asn Lys Leu Ser Glu Glu Phe Asn Thr Gly Phe Gly Ser 785 790 795 800 His Thr Pro Leu Val Leu Gly Gln Ala Lys Val Val Arg Tyr His Pro 805 810 815 Asn Phe Gln Arg Thr Leu Thr Val Ala Lys Ala Val Ile Lys Glu Asn 820 825 830 Lys S er Val Cys Asn Lys Glu Asp Lys Ile Ile Asp Leu Ser Glu Gln 835 840 845 Gln Lys Leu Gln Glu Ile Met Ala Ala Glu Ser Ser Ser Asp Leu Tyr 850 855 860 Arg Val Val Gly Gln Asp Phe Trp Leu Ala Thr Trp Cys Asn Ser Thr 865 870 875 880 Ala Leu Glu Gly Lys Arg Leu Glu Gly Thr Arg Ile Thr Val Val Lys 885 890 895 Met Gly Glu Ile Gly Tyr Asp Phe Ala Ile Arg Thr Pro Cys Thr Pro 900 905 910 Ala Arg Trp Asp Asp Phe Asp Val Glu Met Thr Ser Ala Trp Glu Ala 915 920 925 Leu Cys Ala Ala Tyr Cys Gly Asp Asn Tyr Gly Ser Thr Asp Phe Asp 930 935 940 Val Leu Glu Asn Val Arg Asp Ala Ile Leu Arg Met Thr Tyr Tyr Trp 945 950 955 960 Tyr Asn Phe Met Pro Leu Ser Arg Gly Thr Ala Val Val Gly Phe Ile 965 970 975 Val Leu Leu Gly Leu Leu Leu Ala Ala Asn Met Glu Phe Thr Gly Ser 980 985 990 Ile Pro Lys Gly Leu Gln Val Asp Trp Glu Ala Ile Leu Glu Phe Asp 995 1000 1005 Ser Ser Ser Phe Val Asp Ser Val Lys Lys Trp Leu Tyr Pro Ser Leu 1010 1015 1020 Lys Val Ser Thr Ser Trp Lys Ser Tyr Pro Asp Val Thr Ser Thr Phe 1025 1030 1035 1040 Glu Thr Thr Gly Ser Val Val Ala Ala Leu Ser Thr Tyr Ser Asp 1045 1050 1055 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA1 <400> 4 gtaactttcg acgccatcgc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA2 <400> 5 attgactata gcaaaacgct 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cggtcaataa aacacgtgtc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gagcttcatc ctactcctcg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggaacagtga aaaacgtaac 20 <210> 9 <211> 53 <212> DNA <213> Artificial Se quence <220> <223> primer <400> 9 acactctttc cctacacgac gctcttccga tctaatcgca tcaattgagc tgc 53 <210> 10 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtgactggag ttcagacgtg tgctcttccg atctatgacg 1 61 caagttgag 1 61 caagttgag <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 acactctttc cctacacgac gctcttccga tctttggaca tttatgaatg aactgattaa 60 60 <210> 12 <211> 54 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 12 gtgactggag ttcagacgtg tgctcttccg atcttaggat cgagctgaag tgcc 54 <210> 13 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 cagtcggtct caggagtgat caaaagtccc acatcgatca ggtgatatat agcagcttag 60 ttta 64 <210> 14 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gagtcggtct cacaatcgct atgtcgactc tatcattata taaactaagc tgctatatat 60 cacc 64 <210> 15 <211> 86 <212> DNA < 213> Artificial Sequence <220> <223> primer <400> 15 cagtcggtct caattggtaa ctttcgacgc catcgcgttt tagagctaga aatagcaagt 60 taaaataagg ctagtccgtt atc aac 86 <210> 16 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 cagtcggtct caagcgaaaa aaagcaccga ctcggtgcca ctttttcaag ttgataacgg 60 actagcctta tttt 74 <210> 2 17 <210> 2 7 211> > DNA <213> Artificial Sequence <220> <223> primer <400> 17 cagtcggtct caattggatt gactatagca aaacgctgtt ttagagctag aaatagcaag 60 ttaaaataag gctagtccgt tatcaac 87 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gccatatt21 g act2cttgtc <2ct1ga0> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tagtctggcc tctcggaca 19 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 20 tccaggtaga gacagtggta aa 22 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ctggtttctt tggtgttcct gc 22 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gcaacaactg tccatacacc 20 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 agactccacc acaatcacc 19 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gacaagcaat agcaggagtg 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 taagtgtgcc aacatcagac 20 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gaaatagcat aagatggcag acg 23 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 atacccacca tcacaccagt at 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 ctgctctctc agtagccaac ac 22 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer<400> 29 cttcctccaa tagcagaggt tt 22

Claims (9)

Tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) Recombinant DNA encoding a guide RNA specific to the target sequence of the gene and a nucleic acid sequence encoding an endonuclease protein vector; Or a complex of guide RNA and endonuclease protein specific for the target sequence of the SlSRFR1 gene (ribonucleoprotein); containing as an active ingredient, a genome editing composition for regulating disease resistance of tomato plants. The composition according to claim 1, wherein the target nucleotide sequence of the SlSRFR1 gene consists of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5. (a) Tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) Guide RNA specific to the target sequence of the gene and endonuclease protein are introduced into tomato plant cells to correct the genome doing; and
(b) regenerating tomato plants from the genome-corrected tomato plant cells; a method for producing a genome-corrected tomato plant with controlled disease resistance. The method of claim 3, wherein the guide RNA and endonuclease protein of step (a) are introduced into tomato plant cells, DNA encoding the guide RNA specific to the target sequence of the SlSRFR1 gene and endonuclease protein A recombinant vector comprising a nucleic acid sequence encoding a; Or a complex (ribonucleoprotein) of guide RNA and endonuclease protein specific for the target sequence of the SlSRFR1 gene; manufacturing method characterized by using. The method according to claim 3, wherein the target nucleotide sequence of the SlSRFR1 gene consists of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5. The method of claim 3, wherein the disease resistance increases resistance to plant diseases caused by biotrophic pathogens or reduces resistance to plant diseases caused by necrotrophic pathogens compared to wild type. Manufacturing method to. Claims 3 to 6 of any one of the methods prepared by the disease resistance is controlled genome corrected tomato plants. The method of claim 7, wherein the genome corrected tomato plant has increased resistance to plant diseases caused by biotrophic pathogens or decreased resistance to plant diseases caused by necrotrophic pathogens compared to the wild type. Characterized genome-edited tomato plants. A seed whose genome is corrected in the tomato plant according to claim 7.

Images