KR102274496B1 - Method for gene editing of plant using RNA plant virus and uses thereof - Google Patents

Method for gene editing of plant using RNA plant virus and uses thereof Download PDF

Info

Publication number
KR102274496B1
KR102274496B1 KR1020190149519A KR20190149519A KR102274496B1 KR 102274496 B1 KR102274496 B1 KR 102274496B1 KR 1020190149519 A KR1020190149519 A KR 1020190149519A KR 20190149519 A KR20190149519 A KR 20190149519A KR 102274496 B1 KR102274496 B1 KR 102274496B1
Authority
KR
South Korea
Prior art keywords
cas9
lys
altmv
gene
plant
Prior art date
Application number
KR1020190149519A
Other languages
Korean (ko)
Other versions
KR20210061684A (en
Inventor
임현섭
Original Assignee
충남대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교 산학협력단 filed Critical 충남대학교 산학협력단
Priority to KR1020190149519A priority Critical patent/KR102274496B1/en
Publication of KR20210061684A publication Critical patent/KR20210061684A/en
Application granted granted Critical
Publication of KR102274496B1 publication Critical patent/KR102274496B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8203—Virus mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론과 Cas9 단백질의 N-말단 또는 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 유효성분으로 포함하는, 조직배양 없이 식물체의 유전자를 편집하기 위한 조성물 및 이의 용도에 관한 것으로, 본 발명은 배아 감염이 가능한 RNA 식물바이러스를 이용하여 식물체의 유전자 편집을 수행함으로써 별도의 조직배양 없이 수확되는 종자로부터 직접 유전자가 교정된 종자를 얻는 방법이므로, 매우 용이하게 작물의 유전자 편집이 가능한 기술이다.The present invention relates to an RNA plant virus-based infectious clone comprising a guide RNA coding sequence in a multi-cloning site and two RNA plant virus-based infectious clones each comprising an N-terminal or C-terminal fragment coding sequence of Cas9 protein in a multi-cloning site. The present invention relates to a composition for editing the gene of a plant without tissue culture, comprising as an active ingredient, and a use thereof, and the present invention relates to a gene editing of a plant using an RNA plant virus capable of embryonic infection without a separate tissue culture. Since it is a method of directly obtaining a gene-corrected seed from harvested seeds, it is a technology that allows for gene editing of crops very easily.

Description

RNA 식물바이러스를 이용한 식물체의 유전자 편집방법 및 이의 용도{Method for gene editing of plant using RNA plant virus and uses thereof}Method for gene editing of plant using RNA plant virus and uses thereof

본 발명은 RNA 식물바이러스를 이용한 식물체의 유전자 편집방법 및 이의 용도에 관한 것이다.The present invention relates to a method for editing a plant gene using an RNA plant virus and a use thereof.

Cas9(CRISPR associated protein 9)과 CRISPR(clustered regularly interspaced short palindromic repeat)에 대한 연구는 대장균에서 최초로 보고되었으며, clustered short repeat은 많은 미생물에서 공통적으로 존재한다는 것이 다양한 연구를 통해 보고되었다. CRISPR은 진핵생물의 면역시스템과 유사한 것으로 외부 유전자 특히 세균 파이지로부터 세균을 보호하기 위한 방어수단으로 이용해왔다. 이후 Cas9이 CRISPR과 함께 작동하여 세균의 획득면역(adaptive immunity) 기구를 구성한다는 것을 이해하게 되었다. 그 후, CRISPR/Cas9 시스템을 적용하여 원하는 염기서열의 DNA를 이중가닥 절단(double strand break, DSB)하고 염기서열의 편집을 보여줌으로 유전자 편집 기술이 시작되었다. 이밖에 최근 들어 유전자 편집 기술을 이용하여 Cas9 효소와 guide RNA의 작용으로 상보적인 염기서열의 DNA를 제거하는 기술이 동/식물의 유전자 제어에 매우 많이 이용되고 있다. 식물에 있어서 Cas9 형질전환 식물을 모체로 이용하여 DNA를 편집하고 있는 경우와, 조직배양 과정 동안 Cas9과 guide RNA를 물리적인 전달자를 이용하여 유전자를 편집하는 방법이 사용되고 있다. 동물의 유전자 편집은 아데노바이러스(Adenovirus) 또는 렌티바이러스(Lentivirus)를 이용한 유전자 편집 기술이 다수 보고되고 있으며, 식물의 경우는 상기의 설명과 같이 Cas9 단백질을 분리·발현시켜 농축한 단백질을 PEG(polyethylene glycol)에 코팅하여 합성된 guide RNA와 함께 식물세포에 직접 주입한 후 유전자가 편집된 식물세포를 선별하여 재분화(regeneration) 시키는 기술이 보고되었으나, 외부에서 주입된 Cas9의 안정적 유지가 어려워 유전자 편집 효율이 낮은 단점이 있다.A study on Cas9 (CRISPR associated protein 9) and CRISPR (clustered regularly interspaced short palindromic repeat) was first reported in E. coli, and it was reported through various studies that clustered short repeat exists in common in many microorganisms. CRISPR is similar to the immune system of eukaryotes and has been used as a defense measure to protect bacteria from foreign genes, especially bacterium phage. Since then, it has been understood that Cas9 works in conjunction with CRISPR to constitute the adaptive immunity mechanism of bacteria. After that, gene editing technology was started by applying the CRISPR/Cas9 system to double-strand break (DSB) DNA of the desired nucleotide sequence and showing the nucleotide sequence editing. In addition, recently, using gene editing technology, a technology that removes DNA of a complementary nucleotide sequence by the action of Cas9 enzyme and guide RNA has been widely used for gene control in animals/plants. In plants, a method of editing DNA using a Cas9 transgenic plant as a parent and a method of editing a gene using a physical messenger for Cas9 and guide RNA during tissue culture are used. For gene editing in animals, many gene editing technologies using adenovirus or lentivirus have been reported, and in the case of plants, as described above, Cas9 protein is isolated and expressed and concentrated protein is used for PEG (polyethylene). glycol) and direct injection into plant cells together with the synthesized guide RNA, and then selecting and re-differentiating the gene-edited plant cells have been reported, but it is difficult to stably maintain the externally injected Cas9, so gene editing efficiency is difficult. This has a low downside.

한편, 한국공개특허 제2019-0058358호에는 'CRISPR/Cpf1 시스템을 이용한 유전체 편집용 조성물 및 이의 용도'가 개시되어 있고, 한국공개특허 제2018-0117785호에는 'CRISPR 시스템을 이용한 식물 유전체 결실 및 교체 방법'이 개시되어 있으나, 본 발명의 RNA 식물바이러스를 이용한 식물체의 유전자 편집방법 및 이의 용도에 대해서는 기재된 바가 없다.On the other hand, Korea Patent Application Publication No. 2019-0058358 discloses 'a composition for genome editing using the CRISPR/Cpf1 system and its use', and in Korea Patent Publication No. 2018-0117785, 'Deletion and replacement of a plant genome using the CRISPR system' 'method' is disclosed, but there is no description of the method for editing a plant gene using the RNA plant virus of the present invention and its use.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 식물체의 배아에 감염이 가능한 AltMV(Alternanthera mosaic virus) 기반 감염성클론에 Cas9과 guide RNA를 클로닝하여 유전자 편집을 시도하였다. AltMV의 멀티클로닝 사이트의 크기 제한으로 Cas9 효소를 2개의 단편으로 나누어 각각 발현하도록 감염성클론을 구성하였으며, guide RNA 또한 AltMV의 멀티클로닝 사이트에 삽입하여 세 개의 AltMV 감염성클론이 배아에서 안정적으로 발현되도록 유도하였다. 그 후, 상기 세 개의 감염성클론을 접종시기 및 조합을 다양하게 구성하여 모델 식물체에 접종한 후 유전자 편집 효율을 확인한 결과, 유묘시기에 guide RNA를 포함하는 감염성클론을 먼저 접종한 후 개화 2주 전에 Cas9 단백질의 단편을 각각 포함하는 두 개의 감염성클론을 동시에 접종한 조건에서 가장 우수한 유전자 편집 효율을 확인하였다. 또한, AltMV 감염성클론 외에, CGMMV(Cucumber green mottle mosaic virus) 및 RaMV(Radish mosaic virus) 기반 감염성클론을 이용하여 동일한 방법으로 유전자 편집을 시도한 경우에도 최종 유전자 교정된 종자에 바이러스의 감염이 확인되지 않으면서 유전자 교정이 이루어진 것을 확인함으로써, 본 발명을 완성하였다.The present invention was derived by the above request, and the present inventors attempted gene editing by cloning Cas9 and guide RNA into an AltMV (Alternanthera mosaic virus)-based infectious clone capable of infecting embryos of plants. Infectious clones were constructed to express the Cas9 enzyme by dividing it into two fragments due to the size limitation of the AltMV multicloning site, and guide RNA was also inserted into the AltMV multicloning site to induce stable expression of three AltMV infectious clones in embryos. did. Thereafter, the three infectious clones were inoculated into model plants at various inoculation times and combinations, and the gene editing efficiency was checked. As a result, the infectious clones containing guide RNA were first inoculated at the seedling period and then 2 weeks before flowering. The best gene editing efficiency was confirmed under the condition in which two infectious clones each containing a fragment of the Cas9 protein were simultaneously inoculated. In addition, in addition to the AltMV infectious clone, even when gene editing is attempted in the same way using CGMMV (Cucumber green mottle mosaic virus) and RaMV (Radish mosaic virus)-based infectious clones, if the virus infection is not confirmed in the final gene-corrected seeds, By confirming that the gene correction was made, the present invention was completed.

상기 과제를 해결하기 위해, 본 발명은 편집하고자 하는 유전자의 염기서열에 특이적인 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론, 및 RNA-guided DNA 엔도뉴클레아제(endonuclease)의 N-말단 또는 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 유효성분으로 포함하는, 조직배양 없이 식물체의 유전자를 편집하기 위한 조성물을 제공한다.In order to solve the above problems, the present invention provides an RNA plant virus-based infectious clone comprising a guide RNA coding sequence specific for the nucleotide sequence of a gene to be edited in a multicloning site, and RNA-guided DNA endonuclease It provides a composition for editing the gene of a plant without tissue culture, comprising two RNA plant virus-based infectious clones each containing an N-terminal or C-terminal fragment coding sequence of a multicloning site as an active ingredient.

또한, 본 발명은 상기 조성물을 식물체에 처리하는 단계를 포함하는, 조직배양 없이 식물체의 유전자를 편집하기 위한 방법을 제공한다.In addition, the present invention provides a method for editing the gene of a plant without tissue culture, comprising the step of treating the plant with the composition.

또한, 본 발명은 편집하고자 하는 유전자의 염기서열에 특이적인 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론을 식물체의 유묘기에 접종하는 단계; 및 상기 RNA 식물바이러스 기반 감염성클론에 접종된 식물체에 RNA-guided DNA 엔도뉴클레아제(endonuclease)의 N-말단 또는 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 개화 1~3주 전에 동시에 접종하는 단계;를 포함하는 유전자 교정 식물체의 제조방법을 제공한다.In addition, the present invention comprises the steps of inoculating a plant seedling stage with an RNA plant virus-based infectious clone comprising a guide RNA coding sequence specific for the nucleotide sequence of a gene to be edited in a multi-cloning site; And two RNA plant virus-based infectivity comprising the N-terminal or C-terminal fragment coding sequence of RNA-guided DNA endonuclease in the plant inoculated into the RNA plant virus-based infectious clone, respectively, in the multicloning site It provides a method for producing a gene-corrected plant comprising; inoculating the clones at the same time 1 to 3 weeks before flowering.

또한, 본 발명은 상기 제조방법으로 제조된 유전자 교정 식물체 및 이의 유전자가 교정된 종자를 제공한다.In addition, the present invention provides a gene-corrected plant prepared by the above production method and a seed in which the gene is corrected.

본 발명은 RNA 식물바이러스를 이용하여 식물체의 유전자 편집을 수행함으로써 별도의 조직배양 없이 수확되는 종자로부터 직접 유전자가 교정된 종자를 얻는 방법이므로, 매우 용이하게 작물의 유전자 편집이 가능한 기술이다. 또한, 기존 육종법은 방사능 또는 화학물질을 사용하여 식물 종자에 무작위적인 유전자 변이를 일으킨 후 우연히 만들어진 우수 종자를 골라내는 방식인 반면, 크리스퍼 유전자 가위는 유전자를 정해놓고 변이를 도입하는 방식이므로, 농작물 육종 기술의 생산성을 크게 높일 수 있을 것으로 기대된다.The present invention is a method for directly obtaining a gene-corrected seed from a harvested seed without a separate tissue culture by performing gene editing of a plant using an RNA plant virus, and thus it is a technology capable of very easily editing the gene of a crop. In addition, while the existing breeding method uses radioactivity or chemicals to cause random genetic mutations in plant seeds and then selects excellent seeds created by chance, CRISPR gene scissors is a method of introducing mutations after setting genes. It is expected to greatly increase the productivity of breeding technology.

도 1은 AltMV(Alternanthera mosaic virus), CGMMV(Cucumber green mottle mosaic virus) 또는 RaMV(Radish mosaic virus)를 삽입한 감염성클론의 모식도를 나타낸 것이다.
도 2는 AltMV 감염성클론에 inverse PCR 방법으로 TGB3(triple gene block protein3) 유전자와 외피 단백질(coat protein) 유전자 사이에 Nco I, BamH I, Mlu I 및 Bgl Ⅱ를 포함하는 멀티클로닝 사이트를 삽입하여 최종적으로 완성된 모식도와, CGMMV 감염성클론에 inverse PCR 방법으로 CP 유전자와 HDVagrz 코딩 서열 사이에 EcoR I, Mlu I 및 Bgl Ⅱ를 포함하는 멀티클로닝 사이트를 삽입하여 최종적으로 완성된 모식도와, RaMV 감염성클론에 inverse PCR 방법으로 CR/MP 유전자와 LCP 유전자 사이에 Mlu I, Sal I 및 Nco I을 포함하는 멀티클로닝 사이트를 삽입하여 완성된 모식도 및 SCP 유전자 3' 말단에 Apa I, Mlu I 및 Sal I을 포함하는 멀티클로닝 사이트를 삽입하여 최종적으로 완성된 모식도를 보여준다.
도 3은 캄필로박터 제주니(Campylobacter jejuni) 유래 Cas9 단백질을 1.6Kb와 1.3Kb 크기의 두 조각으로 나눈 모식도를 나타낸 것이다.
도 4는 Cas9의 1.6Kb와 1.3Kb 단편 코딩 서열을 각각 AltMV, CGMMV 또는 RaMV 감염성클론 내의 멀티클로닝 사이트에 제한효소를 이용하여 삽입한 모식도를 나타낸 것이다.
도 5는 C16 담배(Nicotiana benthamiana)의 GFP 전체 염기서열 중 PAM 사이트(ACAC)와 유전자 편집 효율 평가를 위해 선발된 특정 타겟 염기서열과 Cas9 단백질이 인식하는 트레이서 부분을 합쳐 완성된 GFP guide RNA의 전체 모식도를 나타낸 것이다.
도 6은 GFP guide RNA를 AltMV, CGMMV 또는 RaMV 감염성클론 내의 멀티클로닝 사이트에 제한효소를 이용하여 삽입하여 완성한 모식도를 나타낸 것이다.
도 7은 채종한 종자를 발아시킨 후 형광현미경(Fluorescent Microscope)과 50W(와트) 자외선 전등을 이용하여 GFP 유전자 편집의 유·무를 확인하는 모식도를 나타낸 것이다.1 shows a schematic diagram of an infectious clone into which AltMV (Alternanthera mosaic virus), CGMMV (Cucumber green mottle mosaic virus) or RaMV (Radish mosaic virus) is inserted.
Figure 2 shows the final result by inserting a multicloning site containing Nco I, BamHI , Mlu I and Bgl II between the TGB3 ( triple gene block protein3 ) gene and the coat protein gene by inverse PCR in the AltMV infectious clone. A schematic diagram completed by inserting a multi-cloning site containing EcoRI , Mlu I and Bgl II between the CP gene and HDVagrz coding sequence by inverse PCR in the CGMMV-infectious clone, and the finally completed schematic diagram and the RaMV-infectious clone A schematic diagram completed by inserting a multicloning site including Mlu I, Sal I and Nco I between the CR/MP gene and the LCP gene by inverse PCR method and Apa I, Mlu I and Sal I are included at the 3' end of the SCP gene It shows a schematic diagram finally completed by inserting a multi-cloning site.
Figure 3 shows a schematic diagram of the Cas9 protein derived from Campylobacter jejuni divided into two pieces of 1.6Kb and 1.3Kb sizes.
4 is a schematic diagram showing the insertion of the 1.6Kb and 1.3Kb fragment coding sequences of Cas9 into multicloning sites in AltMV, CGMMV or RaMV infectious clones, respectively, using restriction enzymes.
5 is a complete GFP guide RNA by combining the PAM site (ACAC) among the entire GFP sequence of C16 tobacco ( Nicotiana benthamiana ) and a specific target sequence selected for evaluation of gene editing efficiency and a tracer part recognized by the Cas9 protein. A schematic diagram is shown.
6 is a schematic diagram showing the completed insertion of GFP guide RNA into the multicloning site in AltMV, CGMMV or RaMV infectious clones using restriction enzymes.
7 is a schematic diagram showing the presence or absence of GFP gene editing using a fluorescent microscope and a 50W (watt) ultraviolet light after germination of the harvested seeds.

본 발명의 목적을 달성하기 위하여, 본 발명은 편집하고자 하는 유전자의 염기서열에 특이적인 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론, 및 RNA-guided DNA 엔도뉴클레아제(endonuclease)의 N-말단 또는 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 유효성분으로 포함하는, 조직배양 없이 식물체의 유전자를 편집하기 위한 조성물을 제공한다.In order to achieve the object of the present invention, the present invention provides an RNA plant virus-based infectious clone comprising a guide RNA coding sequence specific for the nucleotide sequence of a gene to be edited in a multi-cloning site, and an RNA-guided DNA endonuclease ( Endonuclease) comprising two RNA plant virus-based infectious clones each containing the coding sequence of the N-terminal or C-terminal fragment in the multicloning site as an active ingredient, It provides a composition for editing the gene of a plant without tissue culture. .

본 발명에 따른 조직배양 없이 식물체의 유전자를 편집하기 위한 조성물은 총 3개의 RNA 식물바이러스 기반 감염성클론을 유효성분으로 포함하며, 각각 가이드 RNA, Cas9 단백질의 첫번째 단편, 및 Cas9 단백질의 두번째 단편을 포함한다. 첫번째 단편은 Cas9 단백질의 N-말단일 수 있으며, 두번째 단편은 Cas9 단백질의 C-말단일 수 있다. 첫번째 단편과 두번째 단편 코딩 서열은 각각이 2kb 이내의 크기이면 그 서열에 특별히 제한되지 않는다.The composition for editing a plant gene without tissue culture according to the present invention includes a total of three RNA plant virus-based infectious clones as active ingredients, each comprising a guide RNA, a first fragment of Cas9 protein, and a second fragment of Cas9 protein do. The first fragment may be the N-terminus of the Cas9 protein, and the second fragment may be the C-terminus of the Cas9 protein. The first fragment and the second fragment coding sequence are not particularly limited as long as they are each within 2 kb in size.

본 발명의 일 구현 예에 따른 조성물에 있어서, 상기 Cas9 단백질은 이에 한정되지 않으나, 캄필로박터 제주니(Campylobacter jejuni) 유래의 것일 수 있고, RNA 식물바이러스 기반 감염성클론의 멀티클로닝 사이트 내 크기 제한으로 인해, 두 개의 단편으로 나누어 각각 클로닝될 수 있다.In the composition according to an embodiment of the present invention, the Cas9 protein is not limited thereto, but may be derived from Campylobacter jejuni , and is limited to the size within the multicloning site of the RNA plant virus-based infectious clone. Therefore, it can be divided into two fragments and cloned respectively.

본 발명의 조성물에 있어서, 상기 RNA 식물바이러스는 포텍스바이러스(Potexvirus) 속의 AltMV(Alternanthera mosaic virus), 토바모바이러스(Tobamovirus) 속의 CGMMV(Cucumber green mottle mosaic virus) 또는 코모바이러스(Comovirus) 속의 RaMV(Radish mosaic virus)일 수 있으나, 이에 제한되지 않는다.In the composition of the present invention, the RNA plant virus is Potexvirus genus AltMV (Alternanthera mosaic virus), Tobamovirus genus CGMMV (Cucumber green mottle mosaic virus) or Comovirus genus RaMV (Comovirus) genus Radish mosaic virus), but is not limited thereto.

AltMV는 배아 감염이 가능한 포텍스바이러스(Potexvirus) 속의 바이러스로, 약 6.5kb의 게놈을 갖는 단일가닥 RNA 바이러스로서 게놈의 크기가 크지 않고, 하나의 바이러스 입자에 단일 RNA만 가지므로 유전적으로 조작하기에 편리한 이점이 있다. 본 발명에 따른 상기 AltMV 감염성클론은 5'에서 3' 방향으로 CaMV 35S 프로모터, AltMV 유래 RdRp(RNA dependent RNA polymerase), TGB1(triple gene block protein 1), TGB2, TGB3, 멀티클로닝 사이트 및 CP(coat protein) 유전자를 포함하는 것을 특징으로 하며, 상기 RdRp, TGB1, TGB2, TGB3 및 CP 유전자의 정보는 한국등록특허공보 제1679296호에 상세하게 기술되어 있다.AltMV is a virus of the genus Potexvirus that can infect embryos. It is a single-stranded RNA virus with a genome of about 6.5 kb. The genome size is not large, and it has only a single RNA in one virus particle, so it is difficult to genetically manipulate. There is a convenient advantage. In the AltMV infectious clone according to the present invention, in the 5' to 3' direction, CaMV 35S promoter, AltMV-derived RdRp (RNA dependent RNA polymerase), TGB1 (triple gene block protein 1), TGB2 , TGB3 , multicloning site and CP (coat) protein) gene, and information on the RdRp , TGB1 , TGB2 , TGB3 and CP genes is described in detail in Korean Patent Application Publication No. 1679296.

CGMMV는 토바모바이러스속(Tobamovirus)의 단일가닥 RNA 바이러스로, 하나의 바이러스 입자에 단일 RNA만 가지므로 유전적으로 조작하기에 편리한 이점이 있다. 본 발명에 따른 상기 CGMMV 감염성클론은 5'에서 3' 방향으로 CaMV 35S 프로모터, T7 프로모터, CGMMV 유래 128 kDa 단백질 코딩 유전자, 186 kDa 단백질 코딩 유전자, MP(movement protein) 유전자, CP(coat protein) 유전자, 멀티클로닝 사이트, HDV(hepatitis delta virus) 리보자임 부위(HDVagrz) 코딩 서열 및 Nos(nopaline synthase) 터미네이터를 포함하는 것을 특징으로 한다(도 2). CGMMV 유래 128 kDa 단백질 코딩 유전자, 186 kDa 단백질 코딩 유전자, MP 유전자, CP 유전자, HDVagrz 코딩 서열의 정보는 한국등록특허공보 제1973545호에 상세하게 기술되어 있다.CGMMV is a single-stranded RNA virus of the genus Tobamovirus, and has the advantage of being convenient for genetic manipulation because it has only a single RNA in one virus particle. The CGMMV infectious clone according to the present invention has a CaMV 35S promoter, a T7 promoter, a CGMMV-derived 128 kDa protein-coding gene, a 186 kDa protein-coding gene, a movement protein (MP) gene, and a coat protein ( CP) gene in the 5' to 3' direction. , a multicloning site, a hepatitis delta virus (HDV) ribozyme region (HDVagrz) coding sequence, and a Nos (nopaline synthase) terminator (FIG. 2). Information on the CGMMV-derived 128 kDa protein-coding gene, 186 kDa protein-coding gene, MP gene, CP gene, and HDVagrz coding sequence is described in detail in Korean Patent Publication No. 1973545.

RaMV는 코모바이러스(Comovirus) 속으로 6.4 kb(RNA1), 3.8 kb(RNA2) 두 개의 RNA 로 구성되어 있는 bipartite positive sense RNA 바이러스이다. RNA1은 바이러스의 복제, 단백질 관리에 관여하는 단백질을, RNA2는 외피단백질(CP), 세포 내 이동에 관여하는 단백질(CR/MP)을 암호화한다. 본 발명에 따른 상기 RaMV 감염성클론은 3.8 kb의 RaMV RNA2에 기반한 것으로, 두 가지 형태로 제조될 수 있다. 첫 번째는 5'에서 3' 방향으로 CaMV 35S 프로모터, T7 프로모터, RaMV 유래 CR/MP 유전자, 멀티클로닝 사이트, RaMV 유래 LCP(large coat protein) 및 SCP(small coat protein) 유전자를 포함하는 것일 수 있고, 두 번째는 5'에서 3' 방향으로 CaMV 35S 프로모터, T7 프로모터, RaMV 유래 CR/MP 유전자, LCP 유전자, SCP 유전자 및 멀티클로닝 사이트를 포함하는 것을 특징으로 한다(도 2). 본 발명의 RaMV 기반 감염성클론 제조에 사용된 RaMV RNA2의 염기서열 정보는 서열번호 14와 같다. 상기 서열번호 14는 RAMV 유래 CR/MP 유전자, LCP 유전자 및 SCP 유전자가 순차적으로 연결된 염기서열이다.RaMV is a bipartite positive sense RNA virus composed of two RNAs of 6.4 kb (RNA1) and 3.8 kb (RNA2) in the genus Comovirus. RNA1 encodes a protein involved in virus replication and protein management, and RNA2 encodes an envelope protein (CP) and a protein involved in intracellular movement (CR/MP). The RaMV infectious clone according to the present invention is based on 3.8 kb RaMV RNA2, and can be prepared in two forms. The first may include CaMV 35S promoter, T7 promoter, RaMV-derived CR/MP gene, multicloning site, RaMV-derived large coat protein ( LCP ) and SCP (small coat protein) genes in the 5' to 3' direction. , the second is characterized by including the CaMV 35S promoter, the T7 promoter, the RaMV-derived CR/MP gene, the LCP gene, the SCP gene, and the multicloning site in the 5' to 3' direction (FIG. 2). Base sequence information of RaMV RNA2 used for preparing the RaMV-based infectious clone of the present invention is as shown in SEQ ID NO: 14. SEQ ID NO: 14 is a nucleotide sequence in which the CR/MP gene, LCP gene, and SCP gene derived from RAMV are sequentially linked.

용어 '유전자 편집(gene editing)'은, 인간 세포를 비롯한 동·식물 세포의 유전자 염기서열에 표적지향형 변이를 도입할 수 있는 기술로서, DNA 절단에 의한 하나 이상의 핵산 분자의 결실, 삽입, 치환 등에 의하여 특정 유전자를 녹-아웃(knock-out) 또는 녹-인(knock-in)하거나, 단백질을 생성하지 않는 비-코딩 DNA 서열에도 변이를 도입할 수 있는 기술을 말한다. 또한, '유전자 편집'은 '유전자 교정'과 혼용되어 사용될 수 있다.The term 'gene editing' is a technology that can introduce target-directed mutations into the gene sequence of animal and plant cells, including human cells. Deletion, insertion, substitution, etc. of one or more nucleic acid molecules by DNA cleavage. It refers to a technology that can knock-out or knock-in a specific gene by means of a mutation or introduce a mutation into a non-coding DNA sequence that does not produce a protein. Also, 'gene editing' may be used interchangeably with 'gene editing'.

용어 "편집하고자 하는 유전자"는 표적 유전자로서, 본 발명을 통해 편집하고자 하는 식물체의 유전체 내에 있는 일부 DNA를 의미한다. 즉, 원칙적으로 그 유전자의 종류에 제한되지 않으며, 코딩 영역 및 비-코딩(non-coding) 영역을 모두 포함할 수 있다. 당업자는 그 목적에 따라, 제조하고자 하는 유전자 편집 식물체에 대하여 원하는 변이에 따라 상기 표적 유전자를 선별할 수 있다.The term “gene to be edited” refers to a part of DNA in the genome of a plant to be edited through the present invention as a target gene. That is, in principle, it is not limited to the type of the gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the gene-edited plant to be prepared, depending on the purpose.

용어 '가이드 RNA(guide RNA)'는 편집하고자 하는 표적 유전자를 암호화하는 DNA에 특이적인 RNA를 의미하며, 표적 DNA 서열과 전부 또는 일부 상보적으로 결합하여 해당 표적 DNA 서열로 엔도뉴클레아제(endonuclease) 단백질(예컨대, Cas9)을 이끄는 역할을 하는 리보핵산을 의미한다. 상기 가이드 RNA는 두 개의 RNA, 즉, crRNA(CRISPR RNA) 및 tracrRNA(trans-activating crRNA)를 구성 요소로 포함하는 이중 RNA(dual RNA); 또는 표적 DNA 내 서열과 전부 또는 일부 상보적인 서열을 포함하는 제1 부위 및 RNA-가이드 뉴클레아제와 상호작용하는 서열을 포함하는 제2 부위를 포함하는 단일 사슬 가이드 RNA(sgRNA) 형태를 말하나, RNA-가이드 뉴클레아제가 표적 서열에서 활성을 가질 수 있는 형태라면 제한 없이 본 발명의 범위에 포함될 수 있다. 본 발명에 따른 가이드 RNA는 바람직하게는, 단일 가닥 가이드 RNA 형태일 수 있으나, 이에 제한되지 않으며, 사용된 엔도뉴클레아제의 종류 또는 그 유래 미생물 등에 따라서 적절히 선택할 수 있다.The term 'guide RNA' refers to an RNA specific for a DNA encoding a target gene to be edited, and all or part of the target DNA sequence is complementarily bound to the target DNA sequence by endonuclease (endonuclease). ) refers to a ribonucleic acid that serves to guide proteins (eg, Cas9). The guide RNA may include two RNAs, that is, a dual RNA including crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain guide RNA (sgRNA) form comprising a first site comprising a sequence that is fully or partially complementary to a sequence in the target DNA and a second site comprising a sequence that interacts with an RNA-guided nuclease, The RNA-guided nuclease may be included in the scope of the present invention without limitation as long as it is a form capable of having activity in the target sequence. The guide RNA according to the present invention may preferably be in the form of a single-stranded guide RNA, but is not limited thereto, and may be appropriately selected according to the type of endonuclease used or a microorganism derived therefrom.

본 발명의 일 구현 예에 따른 가이드 RNA는 서열번호 3의 염기서열로 이루어진 것일 수 있고, 상기 서열번호 3의 염기서열로 이루어진 가이드 RNA는 표적 유전자(GFP)에 특이적인 서열(서열번호 3의 1 내지 22번째 염기)과 tracrRNA로 이루어진 것일 수 있다(도 5).The guide RNA according to an embodiment of the present invention may consist of the nucleotide sequence of SEQ ID NO: 3, and the guide RNA consisting of the nucleotide sequence of SEQ ID NO: 3 is a target gene ( GFP ) specific sequence (1 of SEQ ID NO: 3) to 22nd base) and tracrRNA (FIG. 5).

또한, 상기 가이드 RNA는 플라스미드 주형으로부터 전사된 것 또는 생체 외(in vitro)에서 전사된(transcribed) 것(예컨대, 올리고뉴클레오티드 이중가닥)일 수 있으나, 이에 제한되지 않는다.In addition, the guide RNA may be transcribed from a plasmid template or transcribed in vitro (eg, oligonucleotide double-stranded), but is not limited thereto.

또한, 본 발명의 조성물에 있어서, 상기 RNA-guided DNA 엔도뉴클레아제(endonuclease)는 Cas9(CRISPR associated protein 9), Cpf1(CRISPR from Prevotella and Francisella 1) 또는 이의 기능적 유사체일 수 있으나, 이에 제한되지 않는다. Cas9 단백질은 RNA-guided DNA 엔도뉴클레아제 효소로, 이중 가닥 DNA 절단(double stranded DNA break)을 유도한다. Cas9 단백질이 정확하게 표적 DNA의 염기서열에 결합하여 DNA 가닥을 잘라내기 위해서는 PAM(Protospacer Adjacent Motif)이라 알려진 짧은 염기서열이 표적 DNA의 염기서열 옆에 존재해야 한다.In addition, in the composition of the present invention, the RNA-guided DNA endonuclease may be Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1) or a functional analog thereof, but is not limited thereto. does not Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the nucleotide sequence of the target DNA and cut the DNA strand, a short nucleotide sequence known as the Protospacer Adjacent Motif (PAM) must exist next to the nucleotide sequence of the target DNA.

본 발명은 또한, 본 발명의 조성물을 식물체에 처리하는 단계를 포함하는, 조직배양 없이 식물체의 유전자를 편집하기 위한 방법을 제공한다.The present invention also provides a method for editing the gene of a plant without tissue culture, comprising the step of treating the plant with the composition of the present invention.

본 발명의 일 구현 예에 따른 유전자 편집 방법에 있어서, 상기 조성물은 바람직하게는 개화기(flowering) 전의 식물체에 처리하는 것일 수 있으나, 이에 제한되지 않는다. 본 발명에 따른 조직배양 없이 식물체의 유전자를 편집하기 위한 방법에서, 상기 조성물은 배아 감염의 특성이 있는 RNA 식물바이러스인 AltMV(Alternanthera mosaic virus) CGMMV(Cucumber green mottle mosaic virus) 또는 RaMV(Radish mosaic virus) 감염성클론에 유전자 편집을 위한 구성요소들이 클로닝되어 있어, 본 발명의 조성물을 처리하고 배양시킨 식물체로부터 수확되는 종자에서 유전자 편집된 종자를 직접 획득할 수 있는 것이 특징이다.In the gene editing method according to an embodiment of the present invention, the composition may be preferably treated with a plant before flowering, but is not limited thereto. In the method for editing the gene of a plant without tissue culture according to the present invention, the composition is an RNA plant virus with characteristics of embryonic infection AltMV (Alternanthera mosaic virus) CGMMV (Cucumber green mottle mosaic virus) or RaMV (Radish mosaic virus) ) The components for gene editing are cloned into the infectious clone, so it is characterized in that the gene-edited seed can be directly obtained from the seed harvested from the plant treated and cultured with the composition of the present invention.

본 발명에 따른 조직배양 없이 식물체의 유전자를 편집하기 위한 방법에 있어서, 상기 조성물의 처리는 RNA 식물바이러스 기반 감염성클론을 식물세포에 도입하는, 형질전환 방법을 의미한다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 감염성클론을 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), 원형질체의 전기천공법(Shillito et al., 1985, Bio/Technol. 3: 1099-1102), 식물 요소로의 현미주사법(Crossway et al.,1986, Mol. Gen. Genet. 202: 179-185), 각종 식물 요소의(DNA 또는 RNA-코팅된) 입자 충격법(Klein et al.,1987, Nature 327: 70), 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 튜메파시엔스(Agrobacterium tumefaciens) 매개된 유전자 전이에서(비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 바이러스 감염성클론을 식물체에 직접 감염시키는 것을 포함한다.In the method for editing the gene of a plant without tissue culture according to the present invention, the treatment of the composition refers to a transformation method in which an RNA plant virus-based infectious clone is introduced into a plant cell. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the infectious clone according to the present invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts ( Shillito et al., 1985, Bio/Technol. 3: 1099-1102), microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), of various plant elements ( Agrobacterium tumefaciens mediated gene by DNA or RNA-coated) particle bombardment (Klein et al., 1987, Nature 327: 70), infiltration of plants or transformation of mature pollen or vesicles In metastasis (incomplete) infection with a virus (EP 0 301 316) and the like can be appropriately selected. A preferred method according to the present invention comprises directly infecting a plant with a virus-infectious clone.

식물의 형질전환에 이용되는 "식물 세포"는 어떤 식물 세포도 된다. 식물 세포는 배양 세포, 배양 조직, 배양기관 또는 전체 식물이다. "식물 조직"은 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되진 않으나, 뿌리, 줄기, 잎, 꽃가루, 종자, 암 조직 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일 세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. 식물 조직은 인 플란타(in planta)이거나 기관 배양, 조직배양 또는 세포 배양 상태일 수 있다.A "plant cell" used for transformation of a plant may be any plant cell. Plant cells are cultured cells, cultured tissues, cultured organs or whole plants. "Plant tissue" refers to a tissue of a differentiated or undifferentiated plant, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie, single cells, protoplasts. (protoplast), shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture state.

본 발명의 일 구현 예에 따른 식물체의 유전자를 편집하기 위한 방법은, 구체적으로는 식물체의 유묘기에 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론으로 식물체를 먼저 감염시킨 뒤, 개화 1~3주 전, 바람직하게는 개화 2주 전 Cas9 단백질의 N-말단 또는 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 식물체에 접종하는 것일 수 있다. 상기와 같은 접종 시기 및 구성일 때 표적 유전자의 편집 효율이 가장 우수하였다.In the method for editing the gene of a plant according to an embodiment of the present invention, specifically, the plant is first infected with an RNA plant virus-based infectious clone containing a guide RNA coding sequence in a multicloning site at the seedling stage of the plant, and then , One to three weeks before flowering, preferably two weeks before flowering, two RNA plant virus-based infectious clones each containing the N-terminal or C-terminal fragment coding sequence of the Cas9 protein in the multicloning site are inoculated into a plant. can The editing efficiency of the target gene was the best when the inoculation time and configuration were as described above.

또한, 본 발명은Also, the present invention

편집하고자 하는 유전자의 염기서열에 특이적인 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론을 식물체의 유묘기에 접종하는 단계; 및Inoculating an RNA plant virus-based infectious clone containing a guide RNA coding sequence specific for the nucleotide sequence of the gene to be edited in the multi-cloning site in the seedling stage of the plant; and

상기 RNA 식물바이러스 기반 감염성클론에 접종된 식물체에 RNA-guided DNA 엔도뉴클레아제(endonuclease)의 N-말단 또는 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 개화 1~3주 전에 동시에 접종하는 단계;를 포함하는 유전자 교정 식물체의 제조방법을 제공한다.Two RNA plant virus-based infectious clones each comprising the coding sequence of an N-terminal or C-terminal fragment of RNA-guided DNA endonuclease in a plant inoculated into the RNA plant virus-based infectious clone in a multi-cloning site It provides a method for producing a gene-modified plant comprising; simultaneously inoculating 1-3 weeks before flowering.

본 발명의 제조방법에 있어서, 상기 RNA-guided DNA 엔도뉴클레아제(endonuclease)는 Cas9(CRISPR associated protein 9), Cpf1(CRISPR from Prevotella and Francisella 1) 또는 이의 기능적 유사체일 수 있고, 바람직하게는 Cas9 단백질일 수 있으나, 이에 제한되지 않는다.In the preparation method of the present invention, the RNA-guided DNA endonuclease may be Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1) or a functional analog thereof, preferably Cas9 It may be a protein, but is not limited thereto.

또한, 본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 RNA-guided DNA 엔도뉴클레아제의 단편은 각각 서열번호 1 및 2의 아미노산 서열로 이루어질 수 있으나, 이에 제한되지 않는다. 상기 서열번호 1의 아미노산 서열로 이루어진 RNA-guided DNA 엔도뉴클레아제의 단편은 캄필로박터 제주니 유래 Cas9 단백질의 N-말단 단편이며, 서열번호 2의 아미노산 서열로 이루어진 RNA-guided DNA 엔도뉴클레아제의 단편은 캄필로박터 제주니 유래 Cas9 단백질의 C-말단 단편이다.In addition, in the preparation method according to an embodiment of the present invention, the RNA-guided DNA endonuclease fragment may consist of the amino acid sequences of SEQ ID NOs: 1 and 2, respectively, but is not limited thereto. The RNA-guided DNA endonuclease fragment consisting of the amino acid sequence of SEQ ID NO: 1 is an N-terminal fragment of Cas9 protein derived from Campylobacter jejuni, and RNA-guided DNA endonuclease consisting of the amino acid sequence of SEQ ID NO: 2 The second fragment is a C-terminal fragment of the Cas9 protein from Campylobacter jejuni.

또한, 본 발명의 제조방법에 있어서, 상기 RNA 식물바이러스는 포텍스바이러스(Potexvirus) 속의 AltMV(Alternanthera mosaic virus), 토바모바이러스(Tobamovirus) 속의 CGMMV(Cucumber green mottle mosaic virus) 또는 코모바이러스(Comovirus) 속의 RaMV(Radish mosaic virus)일 수 있으나, 이에 제한되지 않는다.In addition, in the manufacturing method of the present invention, the RNA plant virus is Potexvirus (Potexvirus) genus AltMV (Alternanthera mosaic virus), Tobamovirus (Tobamovirus) genus CGMMV (Cucumber green mottle mosaic virus) or Comovirus (Comovirus) It may be RaMV (Radish mosaic virus) of the genus, but is not limited thereto.

본 발명은 또한, 상기 제조방법으로 제조된 유전자 교정 식물체 및 이의 유전자가 교정된 종자를 제공한다.The present invention also provides a gene-corrected plant prepared by the above production method and a seed in which the gene is corrected.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

재료 및 방법Materials and Methods

1. 감염성클론의 제작 및 형질전환1. Preparation and transformation of infectious clones

35S 프로모터를 포함한 감염성클론인 AltMV(Alternanthera mosaic virus)에 인버스(inverse) PCR 방법으로 Nco I, BamH I, Mlu I 및 Bgl Ⅱ 제한효소 자리를 포함하는 멀티클로닝 사이트를 TGB3(triple gene block protein3) 유전자와 외피 단백질 코딩 유전자사이에 삽입·제작하였고(도 2), 멀티클로닝 사이트의 BamH I 및 Mlu I 제한효소를 사용하여 guide RNA로 사용될 GFP 유전자 발현 식물인 C16 담배의 GFP 유전자 (PAM 염기 포함; ACAC) 일부를 tracrRNA(trans-activating crRNA)와 함께 삽입하였다. 삽입 시 추후 진행될 유전자 편집 효과 및 분자생물학적 진단을 위한 스크린 작업을 고려하여 AlwN I 제한효소 자리(CAGNNN^CTG)가 있는 특정 부위의 GFP 단편을 이용하였으며, 캄필로박터 제주니(Campylobacter jejuni)에서 분리한 Cas9 단백질 또한 N-말단 1.3kb 및 C-말단 1.6kb 크기로 나누어(도 3) 각각 Nco I 및 BamH I 제한효소를 이용하여 각각 감염성클론에 삽입하였다(도 4). 이렇게 만들어진 35S 프로모터를 포함한 감염성클론인 AltMV Guide RNA, AltMV Cas9 1.6Kb, AltMV Cas9 1.3Kb 각각을 유묘시기(발아 후 7~8주령), 개화 4주전, 개화 2주전 등의 시기에 다양한 조합으로 모델 식물인 C16 담배(실험실 보유)에 접종하여 GFP 유전자의 편집효과를 확인하였다. A multi-cloning site containing Nco I, BamHI , Mlu I, and Bgl II restriction enzyme sites was added to AltMV (Alternanthera mosaic virus), an infectious clone containing a 35S promoter, by inverse PCR method TGB3 ( triple gene block protein3 ) gene and the envelope protein coding gene (FIG. 2), and using BamHI and Mlu I restriction enzymes of the multicloning site, the GFP gene of C16 tobacco, a plant expressing GFP gene (including PAM base; ACAC) ) was inserted together with tracrRNA (trans-activating crRNA). In consideration of the effect of gene editing that will be carried out later during insertion and the screen work for molecular biological diagnosis, a GFP fragment of a specific site with an AlwN I restriction enzyme site (CAGNNN^CTG) was used, and isolated from Campylobacter jejuni One Cas9 protein was also divided into N-terminal 1.3kb and C-terminal 1.6kb sizes (FIG. 3) and inserted into infectious clones using Nco I and BamHI restriction enzymes, respectively (FIG. 4). Each of AltMV Guide RNA, AltMV Cas9 1.6Kb, and AltMV Cas9 1.3Kb, an infectious clone containing the 35S promoter made in this way, was modeled in various combinations at the seedling period (7-8 weeks after germination), 4 weeks before flowering, and 2 weeks before flowering. The editing effect of the GFP gene was confirmed by inoculating plants, C16 tobacco (owned by the laboratory).

또한, 35S 프로모터 및 T7 프로모터를 포함한 감염성클론인 CGMMV(Cucumber green mottle mosaic virus) 또는 RaMV(Radish mosaic virus)도 인버스(inverse) PCR 방법으로 제한효소 자리를 포함하는 멀티클로닝 사이트를 삽입하고(도 2), 상기 멀티클로닝 사이트에 가이드 RNA(GFP 유전자 일부+tracrRNA)와 Cas9 단백질의 단편을 각각 삽입하여 감염성클론인 CGMMV Guide RNA, CGMMV Cas9 1.6Kb, CGMMV Cas9 1.3Kb와 RaMV Guide RNA, RaMV Cas9 1.6Kb, RaMV Cas9 1.3Kb를 제조하였다(도 4 및 도 6).In addition, CGMMV (Cucumber green mottle mosaic virus) or RaMV (Radish mosaic virus), an infectious clone containing a 35S promoter and a T7 promoter, also inserts a multi-cloning site containing a restriction enzyme site by an inverse PCR method (FIG. 2). ), by inserting a guide RNA ( part of GFP gene + tracrRNA) and a fragment of the Cas9 protein into the multicloning site, respectively, infective clones CGMMV Guide RNA, CGMMV Cas9 1.6Kb, CGMMV Cas9 1.3Kb and RaMV Guide RNA, RaMV Cas9 1.6Kb , RaMV Cas9 1.3Kb was prepared ( FIGS. 4 and 6 ).

C16 담배에 접종하기 위한 감염성클론의 준비는 상기 각각의 감염성클론을 아그로박테리움 튜메파시엔스(Agrobacterium tumefaciens) GV2260 균주에 형질전환시켜 형질전환된 아그로박테리움 튜메파시엔스를 OD600 =0.6이 될 때까지 배양한 후, 상기 배양액을 식물체에 접종하였다.Preparation of an infectious clone for inoculation into C16 tobacco is when each of the infectious clones is transformed into Agrobacterium tumefaciens GV2260 strain and the transformed Agrobacterium tumefaciens becomes OD 600 = 0.6 After culturing up to, the culture solution was inoculated into plants.

2. 종자 수확 및 발아 유도2. Seed harvest and germination induction

감염성클론 접종 후 16C 담배로부터 종자를 수확하고, 수확된 종자는 0.2% 차염소산나트륨에 2시간 동안 침지하여 소독한 후 MS 액체배지(1L 기준 2g MS salts, 0.5g MES, 1㎖ Vitamin, 10g Sucrose)에서 암조건 16시간, 명조건 8시간 주기로 C16 담배 종자의 발아를 유도하였다.After inoculation with infectious clones, seeds were harvested from 16C tobacco, and the harvested seeds were sterilized by immersion in 0.2% sodium hypochlorite for 2 hours, followed by MS liquid medium (1L standard 2g MS salts, 0.5g MES, 1ml Vitamin, 10g Sucrose). ), the germination of C16 tobacco seeds was induced in dark conditions for 16 hours and light conditions for 8 hours.

3. 종자 감염 확인을 위한 RT-PCR3. RT-PCR for Confirmation of Seed Infection

수확된 종자를 이용하여 종자내 AltMV의 유·무를 확인하기 위하여 무작위적으로 종자 100립과 발아된 종자 100립을 선발하여 총 RNA는 트리졸 시약(TRIzol®Reagent; Life Technologies, USA)을 사용하여 추출하였으며, 추출된 총 RNA는 -70℃에서 보관하였으며, 다운스트림 프라이머(oligo-dT)로 cDNA 합성을 위한 주형으로 사용하였다. cDNA는 제1 가닥 cDNA 합성 시스템(LeGene Biosciences, USA)으로 제조하였다. 채종한 새로운 종자에서 AltMV의 존재 유무를 확인하기 위하여 합성한 cDNA를 주형으로 AltMV의 외피 단백질을 표적으로 하는 프라이머 세트(하기 표 1 참고)를 이용하여 PCR을 수행하였다. PCR은 KOD FX 네오 DNA 폴리머라아제를 이용하여 30초 동안 94℃; 30초 동안 58℃; 30초 동안 68℃로 35 사이클로 진행하였고, 최종 PCR 산물은 0.8% 아가로스 겔로 전기영동하여 밴드를 확인하였다.To check the presence or absence of AltMV in seeds using harvested seeds, 100 seeds and 100 germinated seeds were randomly selected and total RNA was obtained using TRIzol ® Reagent (Life Technologies, USA). After extraction, the extracted total RNA was stored at -70°C and used as a template for cDNA synthesis as a downstream primer (oligo-dT). cDNA was prepared with a first strand cDNA synthesis system (LeGene Biosciences, USA). In order to check the presence or absence of AltMV in the new seeds harvested, PCR was performed using the synthesized cDNA as a template and a primer set (refer to Table 1 below) targeting the coat protein of AltMV. PCR was performed at 94°C for 30 seconds using KOD FX Neo DNA Polymerase; 58° C. for 30 seconds; 35 cycles were carried out at 68°C for 30 seconds, and the final PCR product was electrophoresed on 0.8% agarose gel to confirm the band.

본 발명에 사용된 프라이머Primer used in the present invention 프라이머primer 염기서열 (5'→3')base sequence (5'→3') 산물(bp)product (bp) Cas9-1.3-F-NcoICas9-1.3-F-NcoI AAACCATGGATGGCCAGAATCCTGGCCT (서열번호 4)AAACCATGGATGGCCAGAATCCTGGCCT (SEQ ID NO: 4) 1,3291,329 Cas9-1.3-R-BamHICas9-1.3-R-BamHI AAAGGATCCTTAGTAGTAGGTTTCGTTGAAG (서열번호 5)AAAGGATCCTTAGTAGTAGGTTTCGTTGAAG (SEQ ID NO: 5) Cas9-1.6-F-NcoICas9-1.6-F-NcoI AAACCATGGATGGACGAAGTGACCAACCC (서열번호 6)AAACCATGGATGGACGAAGTGACCAACCC (SEQ ID NO: 6) 1,6201,620 Cas9-1.6-R-BamHICas9-1.6-R-BamHI AAAGGATCCTTACTTTTTGAAGTCCTCTCTC (서열번호 7)AAAGGATCCTTACTTTTTGAAGTCCTCTCTC (SEQ ID NO: 7) GFP-sgRNA-BamHI-FGFP-sgRNA-BamHI-F AAAGGATCCTTGAGTTTGTAACAGCTGCTGGGTTTTAGTCCCTGAAAAG (서열번호 8)AAAGGATCCTTGAGTTTGTAACAGCTGCTGGGTTTTAGTCCCTGAAAAG (SEQ ID NO: 8) 100100 GFP-sgRNA-MluI-RGFP-sgRNA-MluI-R AAAACGCGTGCGGTTTTAGGGGATTGTAAC (서열번호 9)AAAACGCGTGCGGTTTTAGGGGATTGTAAC (SEQ ID NO: 9) C16-GFP-FC16-GFP-F ATGAAGACTAATCTTTTTC (서열번호 10)ATGAAGACTAATCTTTTTC (SEQ ID NO: 10) 792792 C16-GFP-RC16-GFP-R TTAAAGCTCATCATGTTTG (서열번호 11)TTAAAGCTCATCATGTTTG (SEQ ID NO: 11) AltMV-CP-FAltMV-CP-F ATGTCTACACCATTT (서열번호 12)ATGTCTACACCATTT (SEQ ID NO: 12) 250250 AltMV-CP-RAltMV-CP-R GGGCCCACCACCGCTGT (서열번호 13)GGGCCCACCACCGCTGT (SEQ ID NO: 13)

4. 유전자 편집 효율 확인4. Check gene editing efficiency

감염성클론인 AltMV Guide RNA, AltMV Cas9 1.6Kb, AltMV Cas9 1.3Kb 각각을 유묘시기, 개화 4주전, 개화 2주전 등의 시기에 다양한 조합으로 접종하여 얻어진 종자를 1,000립씩 발아시켰으며, 다양한 조합에서 채종한 종자에서 발아한 모든 개체의 식물에서 유전자 편집에 의해 식물체내 GFP 유전자가 발현되고 있지 않는 식물을 선발하기 위하여 형광현미경(Fluorescent Microscope)과 50W(와트) 자외선 전등을 이용하여 식물체 내의 GFP 발현을 식물세포와 식물체 표면에서 직접적으로 관찰하였다.Each of the infectious clones AltMV Guide RNA, AltMV Cas9 1.6Kb, and AltMV Cas9 1.3Kb were inoculated in various combinations at seedling times, 4 weeks before flowering, and 2 weeks before flowering, and 1,000 seeds were germinated. for starters in plants of all the objects that germinated from seeds of plants that do not have a body, the GFP gene plants is expressed by a gene editing fluorescence microscopy (fluorescent microscope) and 50W (watts) using an ultraviolet light plants GFP expression in plant cells to and directly observed on the plant surface.

실시예 1. AltMV Cas9 1.6과 Cas9 1.3, guide RNA를 각각 접종한 담배에서 안정적 발현 확인Example 1. Confirmation of stable expression in tobacco inoculated with AltMV Cas9 1.6, Cas9 1.3, and guide RNA, respectively

AltMV 감염성클론 내에 Cas9 1.6Kb, Cas9 1.3Kb 및 GFP guide RNA를 각각 클로닝한 3종류의 감염성클론들을 모델 식물인 유묘시기의 C16 담배에 접종하였고, 식물체 내에서 안정적인 발현이 되는지를 접종 10일 후부터 7일 간격으로 개화 후 21일 지난 시점까지 식물체를 샘플링하여 RT-PCR 방법으로 발현 유무 확인을 통한 유전자들의 안정성을 확인한 결과, 개화 전 21일부터 개화 21일 후 까지 Cas9 1.6Kb, Cas9 1.3Kb 및 GFP guide RNA 모두가 안정적으로 발현되고 있다는 것을 확인하였다.Three types of infectious clones, each cloned with Cas9 1.6Kb, Cas9 1.3Kb, and GFP guide RNA in the AltMV infectious clone, were inoculated into C16 tobacco of the seedling period, a model plant, and the stable expression in the plant was checked 7 days after inoculation. As a result of checking the stability of genes by checking for expression by RT-PCR by sampling plants up to 21 days after flowering at daily intervals, Cas9 1.6Kb, Cas9 1.3Kb, and GFP from 21 days before flowering to 21 days after flowering It was confirmed that all guide RNAs were stably expressed.

Cas9 1.6Kb, Cas9 1.3Kb과 GFP guide RNA의 발현 확인 결과Expression confirmation result of Cas9 1.6Kb, Cas9 1.3Kb and GFP guide RNA 개화
21일전flowering
21 days ago 개화
14일전flowering
14 days ago 개화
7일전flowering
7 days ago 개화flowering 개화
7일 후flowering
after 7 days 개화
14일 후flowering
after 14 days 개화
21일 후flowering
21 days later Cas9 1.6KbCas9 1.6Kb ○○ ○○ ○○ ○○ ○○ ○○ ○○ Cas9 1.3KbCas9 1.3Kb ○○ ○○ ○○ ○○ ○○ ○○ ○○ GFP guide RNAGFP guide RNA ○○ ○○ ○○ ○○ ○○ ○○ ○○

실시예 2. AltMV Cas9 1.6 과 1.3, guide RNA 각각 접종 후 얻어진 담배종자의 바이러스 감염여부Example 2. Virus infection of tobacco seeds obtained after inoculation with AltMV Cas9 1.6 and 1.3, guide RNA, respectively

AltMV 감염성클론 내에 Cas9 1.6Kb, Cas9 1.3Kb 및 GFP guide RNA를 각각 클로닝한 3종류의 감염성클론들을 모델 식물인 유묘시기의 C16 담배에 접종하였고, 유전자 편집된 종자를 최종적으로 수확한 후 100개씩의 종자를 무작위로 각각 선발하여 종자상태와 발아를 시킨 상태에서 접종한 AltMV의 존재 여부를 RT-PCR로 확인한 결과, 발아 전·후 각각 100개씩 모두 200개 종자 샘플에서 AltMV 감염이 확인되지 않음을 알 수 있었다.Three types of infectious clones, each cloned with Cas9 1.6Kb, Cas9 1.3Kb, and GFP guide RNA in the AltMV infectious clone, were inoculated into C16 tobacco in the seedling period, a model plant. RT-PCR confirmed the presence of AltMV inoculated in seed state and germination state by randomly selecting seeds, and found that AltMV infection was not confirmed in 200 seed samples, 100 each before and after germination. could

AltMV 감염 여부 확인 결과 AltMV infection check result 발아 전 종자seeds before germination 발아 후 종자seeds after germination 0/1000/100 0/1000/100

실시예 3. 동시접종을 통한 유전자편집 효율 산출 Example 3. Calculation of gene editing efficiency through simultaneous inoculation

AltMV 감염성클론 내에 Cas9 1.6Kb, Cas9 1.3Kb 및 GFP guide RNA를 각각 클로닝한 3종류의 감염성클론들을 다양한 조합과 시기별로 접종한 후 접종된 C16 담배에서 종자를 채종하였다. 채종한 종자는 발아 유도 후 형광현미경 및 자외선 램프를 통한 GFP 유전자의 발현 유무를 확인하였으며, GFP 유전자가 편집되어 최종적으로 GFP가 발현되고 있지 않는 식물체를 선발하여 유전자 편집효율을 확인하였다. Three types of infectious clones each cloned with Cas9 1.6Kb, Cas9 1.3Kb and GFP guide RNA in AltMV infectious clone were inoculated at various combinations and times, and then seeds were harvested from the inoculated C16 tobacco. After induction of germination, the presence or absence of expression of the GFP gene was checked through a fluorescence microscope and an ultraviolet lamp after the germination of the harvested seeds, and the gene editing efficiency was confirmed by selecting a plant in which the GFP gene was edited and finally not expressing the GFP.

그 결과, 유묘시기에 AltMV Cas9 1.6Kb, AltMV Cas9 1.3Kb 및 AltMV GFP guide RNA 감염성클론을 동시에 접종한 식물에서 채종한 종자는 1,000립 중 1개에서 GFP 유전자가 편집된 효율을 보였고, 유묘시기에 AltMV GFP guide RNA를 먼저 접종한 후 개화 4주전에 AltMV Cas9 1.6Kb와 AltMV Cas9 1.3Kb을 접종한 식물에서 채종한 종자는 1,000립 중 2개에서 GFP 유전자가 편집된 효율을 보였으며, 유묘시기에 AltMV GFP guide RNA 먼저 접종한 후 개화 2주전에 AltMV Cas9 1.6Kb와 AltMV Cas9 1.3Kb을 접종한 식물에서 채종한 종자는 1,000립 중 3개에서 GFP 유전자가 편집된 효율을 보였다(표 4).As a result, seeds harvested from plants inoculated with AltMV Cas9 1.6Kb, AltMV Cas9 1.3Kb, and AltMV GFP guide RNA infectious clones at the seedling period showed the efficiency of editing the GFP gene in one out of 1,000 grains, and AltMV at the seedling period. Seeds harvested from plants inoculated with GFP guide RNA first and then inoculated with AltMV Cas9 1.6Kb and AltMV Cas9 1.3Kb 4 weeks before flowering showed GFP gene editing efficiency in 2 out of 1,000 seeds, and AltMV GFP gene editing efficiency at seedling period Seeds harvested from plants inoculated with guide RNA first and then inoculated with AltMV Cas9 1.6Kb and AltMV Cas9 1.3Kb 2 weeks before flowering showed GFP gene editing efficiency in 3 out of 1,000 seeds (Table 4).

접종 방법에 따른 GFP 유전자 편집 효율-1 GFP gene editing efficiency by inoculation method-1 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency AltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb
AltMV GFP guide RNAAltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb
AltMV GFP guide RNA -- -- 1/1,0001/1,000 AltMV GFP guide RNAAltMV GFP guide RNA AltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb AltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb 2/1.0002/1.000 AltMV GFP guide RNAAltMV GFP guide RNA AltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb AltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb 3/1,0003/1,000

또한, 유묘시기에 AltMV GFP guide RNA 먼저 접종한 후 개화 4주전에 AltMV Cas9 1.3Kb를 접종하고, 개화 2주전에 AltMV Cas9 1.6Kb를 접종한 식물에서 채종한 종자는 1,000립 중 1개에서 GFP 유전자가 편집된 효율을 보였으며, 유묘시기에 AltMV GFP guide RNA 먼저 접종한 후 개화 4주전에 AltMV Cas9 1.6Kb를 접종하고, 개화 2주전에 AltMV Cas9 1.3Kb를 접종한 식물에서 채종한 종자는 1,000립 중 1개에서 GFP 유전자가 편집된 효율을 보였다(표 5). In addition, the GFP gene was found in 1 out of 1,000 seeds in plants that were inoculated with AltMV GFP guide RNA first during the seedling period, then inoculated with AltMV Cas9 1.3Kb 4 weeks before flowering, and inoculated with AltMV Cas9 1.6Kb 2 weeks before flowering. The edited efficiency was shown, and 1 out of 1,000 seeds were inoculated from plants inoculated with AltMV GFP guide RNA first at seedling period, then with AltMV Cas9 1.6Kb 4 weeks before flowering, and with AltMV Cas9 1.3Kb 2 weeks before flowering. The editing efficiency of the GFP gene in dogs was shown (Table 5).

접종 방법에 따른 GFP 유전자 편집 효율-2 GFP gene editing efficiency by inoculation method-2 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency AltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb
AltMV GFP guide RNAAltMV Cas9 1.6Kb
AltMV Cas9 1.3Kb
AltMV GFP guide RNA -- -- 1/1,0001/1,000 AltMV GFP guide RNAAltMV GFP guide RNA AltMV Cas9 1.3Kb AltMV Cas9 1.3Kb AltMV Cas9 1.6KbAltMV Cas9 1.6Kb 1/1.0001/1.000 AltMV GFP guide RNAAltMV GFP guide RNA AltMV Cas9 1.6KbAltMV Cas9 1.6Kb AltMV Cas9 1.3Kb AltMV Cas9 1.3Kb 1/1,0001/1,000

또한, 유묘시기에 AltMV Cas9 1.3Kb 및 AltMV GFP guide RNA 감염성클론만을 접종한 식물, 유묘시기에 AltMV GFP guide RNA를 먼저 접종한 후 개화 4주전에 AltMV Cas9 1.3Kb만을 접종한 식물 및 유묘시기에 AltMV GFP guide RNA를 먼저 접종한 후 개화 2주전에 AltMV Cas9 1.3Kb만을 접종한 식물 모두 유전자 편집이 전혀 일어나지 않았음을 알 수 있었다(표 6).In addition, plants inoculated with AltMV Cas9 1.3Kb and AltMV GFP guide RNA only infectious clones at seedling period, plants inoculated with AltMV GFP guide RNA first at seedling period and then inoculated with AltMV Cas9 1.3Kb only 4 weeks before flowering, and AltMV at seedling period It was found that gene editing did not occur at all in all plants inoculated with GFP guide RNA first and then inoculated with AltMV Cas9 1.3Kb only 2 weeks before flowering (Table 6).

접종 방법에 따른 GFP 유전자 편집 효율-3 GFP gene editing efficiency by inoculation method-3 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency AltMV Cas9 1.3Kb
AltMV GFP guide RNAAltMV Cas9 1.3Kb
AltMV GFP guide RNA -- -- 0/1,0000/1,000 AltMV GFP guide RNAAltMV GFP guide RNA AltMV Cas9 1.3Kb AltMV Cas9 1.3Kb -- 0/1.0000/1.000 AltMV GFP guide RNAAltMV GFP guide RNA -- AltMV Cas9 1.3Kb AltMV Cas9 1.3Kb 0/1,0000/1,000

또한, 유묘시기에 AltMV Cas9 1.6Kb 및 AltMV GFP guide RNA 감염성클론만을 접종한 식물, 유묘시기에 AltMV GFP guide RNA를 먼저 접종한 후 개화 4주전에 AltMV Cas9 1.6Kb만을 접종한 식물 및 유묘시기에 AltMV GFP guide RNA를 먼저 접종한 후 개화 2주전에 AltMV Cas9 1.6Kb만을 접종한 식물 모두 유전자 편집이 전혀 일어나지 않았음을 알 수 있었다(표 7). In addition, plants inoculated only with AltMV Cas9 1.6Kb and AltMV GFP guide RNA infectious clones during seedling period, plants inoculated with AltMV GFP guide RNA first at seedling period and then inoculated with AltMV Cas9 1.6Kb only 4 weeks before flowering, and plants inoculated with AltMV Cas9 1.6Kb only at seedling period It was found that gene editing did not occur at all in all plants inoculated with GFP guide RNA first and then inoculated with AltMV Cas9 1.6Kb only 2 weeks before flowering (Table 7).

접종 방법에 따른 GFP 유전자 편집 효율-4 GFP gene editing efficiency by inoculation method-4 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency AltMV Cas9 1.6Kb
AltMV GFP guide RNAAltMV Cas9 1.6Kb
AltMV GFP guide RNA -- -- 0/1,0000/1,000 AltMV GFP guide RNAAltMV GFP guide RNA AltMV Cas9 1.6Kb AltMV Cas9 1.6Kb -- 0/1.0000/1.000 AltMV GFP guide RNAAltMV GFP guide RNA -- AltMV Cas9 1.6Kb AltMV Cas9 1.6Kb 0/1,0000/1,000

또한, 유묘시기에 AltMV Cas9 1.3Kb와 AltMV GFP guide RNA 감염성클론만을 접종한 식물, 유묘시기에 AltMV Cas9 1.3Kb를 먼저 접종한 후 개화 4주전에 AltMV GFP guide RNA만을 접종한 식물, 및 유묘시기에 AltMV Cas9 1.3Kb를 먼저 접종한 후 개화 2주전에 AltMV GFP guide RNA만을 접종한 식물 모두 유전자 편집이 전혀 일어나지 않았음을 알 수 있었다(표 8).In addition, plants inoculated with AltMV Cas9 1.3Kb and AltMV GFP guide RNA infectious clones only at the seedling period, plants inoculated with AltMV Cas9 1.3Kb first at the seedling period and then inoculated with AltMV GFP guide RNA only 4 weeks before flowering, and at the seedling period It was found that gene editing did not occur at all in all plants inoculated with AltMV Cas9 1.3Kb first and then inoculated with AltMV GFP guide RNA only 2 weeks before flowering (Table 8).

접종 방법에 따른 GFP 유전자 편집 효율-5 GFP gene editing efficiency by inoculation method-5 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency AltMV Cas9 1.3Kb
AltMV GFP guide RNAAltMV Cas9 1.3Kb
AltMV GFP guide RNA -- -- 0/1,0000/1,000 AltMV Cas9 1.3KbAltMV Cas9 1.3Kb AltMV GFP guide RNAAltMV GFP guide RNA -- 0/1.0000/1.000 AltMV Cas9 1.3KbAltMV Cas9 1.3Kb -- AltMV GFP guide RNAAltMV GFP guide RNA 0/1,0000/1,000

또한, 유묘시기에 AltMV Cas9 1.6Kb와 AltMV GFP guide RNA 감염성클론만을 접종한 식물, 유묘시기에 AltMV Cas9 1.6Kb를 먼저 접종한 후 개화 4주전에 AltMV GFP guide RNA만을 접종한 식물, 및 유묘시기에 AltMV Cas9 1.6Kb를 먼저 접종한 후 개화 2주전에 AltMV GFP guide RNA만을 접종한 식물 모두 유전자 편집이 전혀 일어나지 않았음을 알 수 있었다(표 9).In addition, plants inoculated with AltMV Cas9 1.6Kb and AltMV GFP guide RNA infectious clone only at the seedling period, plants inoculated with AltMV Cas9 1.6Kb first at the seedling period and then inoculated with AltMV GFP guide RNA only 4 weeks before flowering, and at the seedling period It was found that gene editing did not occur at all in all plants inoculated with AltMV Cas9 1.6Kb first and then inoculated with AltMV GFP guide RNA only 2 weeks before flowering (Table 9).

접종 방법에 따른 GFP 유전자 편집 효율-6 GFP gene editing efficiency by inoculation method-6 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency AltMV Cas9 1.6Kb
AltMV GFP guide RNAAltMV Cas9 1.6Kb
AltMV GFP guide RNA -- -- 0/1,0000/1,000 AltMV Cas9 1.6KbAltMV Cas9 1.6Kb AltMV GFP guide RNAAltMV GFP guide RNA -- 0/1.0000/1.000 AltMV Cas9 1.6KbAltMV Cas9 1.6Kb -- AltMV GFP guide RNAAltMV GFP guide RNA 0/1,0000/1,000

상기 결과를 통해, 캄필로박터 제주니(Campylobacter jejuni)에서 분리한 Cas9 단백질은 1.3Kb와 1.6Kb로 분리한 단편 모두 유전자 편집 과정에 필요한 것을 알 수 있었으며, 표 4에 개시된 것과 같이 유묘시기에 AltMV GFP guide RNA를 먼저 접종한 후 개화 2주전에 AltMV Cas9 1.6Kb와 AltMV Cas9 1.3Kb을 접종하는 것이 유전자 편집 효율에 가장 좋은 것을 알 수 있었다.From the above results, it was found that the Cas9 protein isolated from Campylobacter jejuni was required for the gene editing process in both 1.3Kb and 1.6Kb fragments, and AltMV at the seedling period as shown in Table 4 It was found that, after inoculation of GFP guide RNA first, inoculation of AltMV Cas9 1.6Kb and AltMV Cas9 1.3Kb 2 weeks before flowering was the best for gene editing efficiency.

실시예 4. CGMMV 또는 RaMV 감염성클론을 이용한 유전자편집 효율 산출 Example 4. Calculation of gene editing efficiency using CGMMV or RaMV infectious clones

상기 AltMV 감염성클론 외에, 다른 RNA 식물바이러스 종류를 이용한 유전자편집 효율을 분석하였다. 본 발명자는 AltMV 감염성클론과 같이 가이드 RNA 및 Cas9 단백질의 2개의 단편을 각각 포함하는 CGMMV(Cucumber green mottle mosaic virus) 또는 RaMV(Radish mosaic virus) 기반의 감염성클론을 준비하고, 접종 시기 및 방법에 따른 C16 담배 식물체의 GFP 유전자 편집 효율을 분석하였다. 그 결과, 하기 표 10 및 11에서와 같이 CGMMV 또는 RaMV 감염성클론을 이용한 경우에도, 유묘기에 가이드 RNA를 포함하는 감염성클론을 먼저 감염시킨 후, 개화 2주전에 Cas9 단백질의 단편을 각각 포함하는 2개의 감염성클론을 동시에 감염시킨 경우에 유전자 편집 효율이 가장 우수한 것을 알 수 있었다.In addition to the AltMV infectious clone, gene editing efficiency using other RNA plant virus types was analyzed. The present inventors prepare an infectious clone based on CGMMV (Cucumber green mottle mosaic virus) or RaMV (Radish mosaic virus) containing two fragments of guide RNA and Cas9 protein, respectively, like the AltMV infectious clone, and according to the inoculation time and method The GFP gene editing efficiency of C16 tobacco plants was analyzed. As a result, even when CGMMV or RaMV infectious clones were used as shown in Tables 10 and 11 below, infective clones containing guide RNA were first infected at the seedling stage, and then 2 weeks prior to flowering, each containing a fragment of the Cas9 protein. It was found that the gene editing efficiency was the best when the infectious clones of dogs were simultaneously infected.

접종 방법에 따른 GFP 유전자 편집 효율 (CGMMV) GFP gene editing efficiency (CGMMV) by inoculation method 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency CGMMV Cas9 1.6Kb
CGMMV Cas9 1.3Kb
CGMMV GFP guide RNACGMMV Cas9 1.6Kb
CGMMV Cas9 1.3Kb
CGMMV GFP guide RNA -- -- 1/1,5001/1,500 CGMMV GFP guide RNACGMMV GFP guide RNA CGMMV Cas9 1.6Kb
CGMMV Cas9 1.3Kb CGMMV Cas9 1.6Kb
CGMMV Cas9 1.3Kb 2/1,5002/1,500 CGMMV GFP guide RNACGMMV GFP guide RNA CGMMV Cas9 1.6Kb
CGMMV Cas9 1.3Kb CGMMV Cas9 1.6Kb
CGMMV Cas9 1.3Kb 3/1,5003/1,500

접종 방법에 따른 GFP 유전자 편집 효율 (RaMV) GFP gene editing efficiency (RaMV) by inoculation method 유묘seedling 개화 4주전4 weeks before flowering 개화 2주전2 weeks before flowering 효율efficiency RaMV Cas9 1.6Kb
RaMV Cas9 1.3Kb
RaMV GFP guide RNARaMV Cas9 1.6Kb
RaMV Cas9 1.3Kb
RaMV GFP guide RNA -- -- 1/1,5001/1,500 RaMV GFP guide RNARaMV GFP guide RNA RaMV Cas9 1.6Kb
RaMV Cas9 1.3Kb RaMV Cas9 1.6Kb
RaMV Cas9 1.3Kb 1/1,5001/1,500 RaMV GFP guide RNARaMV GFP guide RNA RaMV Cas9 1.6Kb
RaMV Cas9 1.3Kb RaMV Cas9 1.6Kb
RaMV Cas9 1.3Kb 2/1,5002/1,500

<110> The Industry ＆ Academic Cooperation in Chungnam National University (IAC) <120> Method for gene editing of plant using RNA plant virus and uses thereof <130> PN19403 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 443 <212> PRT <213> Campylobacter jejuni <400> 1 Met Ala Arg Ile Leu Ala Phe Asp Ile Gly Ile Ser Ser Ile Gly Trp 1 5 10 15 Ala Phe Ser Glu Asn Asp Glu Leu Lys Asp Cys Gly Val Arg Ile Phe 20 25 30 Thr Lys Val Glu Asn Pro Lys Thr Gly Glu Ser Leu Ala Leu Pro Arg 35 40 45 Arg Leu Ala Arg Ser Ala Arg Lys Arg Leu Ala Arg Arg Lys Ala Arg 50 55 60 Leu Asn His Leu Lys His Leu Ile Ala Asn Glu Phe Lys Leu Asn Tyr 65 70 75 80 Glu Asp Tyr Gln Ser Phe Asp Glu Ser Leu Ala Lys Ala Tyr Lys Gly 85 90 95 Ser Leu Ile Ser Pro Tyr Glu Leu Arg Phe Arg Ala Leu Asn Glu Leu 100 105 110 Leu Ser Lys Gln Asp Phe Ala Arg Val Ile Leu His Ile Ala Lys Arg 115 120 125 Arg Gly Tyr Asp Asp Ile Lys Asn Ser Asp Asp Lys Glu Lys Gly Ala 130 135 140 Ile Leu Lys Ala Ile Lys Gln Asn Glu Glu Lys Leu Ala Asn Tyr Gln 145 150 155 160 Ser Val Gly Glu Tyr Leu Tyr Lys Glu Tyr Phe Gln Lys Phe Lys Glu 165 170 175 Asn Ser Lys Glu Phe Thr Asn Val Arg Asn Lys Lys Glu Ser Tyr Glu 180 185 190 Arg Cys Ile Ala Gln Ser Phe Leu Lys Asp Glu Leu Lys Leu Ile Phe 195 200 205 Lys Lys Gln Arg Glu Phe Gly Phe Ser Phe Ser Lys Lys Phe Glu Glu 210 215 220 Glu Val Leu Ser Val Ala Phe Tyr Lys Arg Ala Leu Lys Asp Phe Ser 225 230 235 240 His Leu Val Gly Asn Cys Ser Phe Phe Thr Asp Glu Lys Arg Ala Pro 245 250 255 Lys Asn Ser Pro Leu Ala Phe Met Phe Val Ala Leu Thr Arg Ile Ile 260 265 270 Asn Leu Leu Asn Asn Leu Lys Asn Thr Glu Gly Ile Leu Tyr Thr Lys 275 280 285 Asp Asp Leu Asn Ala Leu Leu Asn Glu Val Leu Lys Asn Gly Thr Leu 290 295 300 Thr Tyr Lys Gln Thr Lys Lys Leu Leu Gly Leu Ser Asp Asp Tyr Glu 305 310 315 320 Phe Lys Gly Glu Lys Gly Thr Tyr Phe Ile Glu Phe Lys Lys Tyr Lys 325 330 335 Glu Phe Ile Lys Ala Leu Gly Glu His Asn Leu Ser Gln Asp Asp Leu 340 345 350 Asn Glu Ile Ala Lys Asp Ile Thr Leu Ile Lys Asp Glu Ile Lys Leu 355 360 365 Lys Lys Ala Leu Ala Lys Tyr Asp Leu Asn Gln Asn Gln Ile Asp Ser 370 375 380 Leu Ser Lys Leu Glu Phe Lys Asp His Leu Asn Ile Ser Phe Lys Ala 385 390 395 400 Leu Lys Leu Val Thr Pro Leu Met Leu Glu Gly Lys Lys Tyr Asp Glu 405 410 415 Ala Cys Asn Glu Leu Asn Leu Lys Val Ala Ile Asn Glu Asp Lys Lys 420 425 430 Asp Phe Leu Pro Ala Phe Asn Glu Thr Tyr Tyr 435 440 <210> 2 <211> 541 <212> PRT <213> Campylobacter jejuni <400> 2 Met Asp Glu Val Thr Asn Pro Val Val Leu Arg Ala Ile Lys Glu Tyr 1 5 10 15 Arg Lys Val Leu Asn Ala Leu Leu Lys Lys Tyr Gly Lys Val His Lys 20 25 30 Ile Asn Ile Glu Leu Ala Arg Glu Val Gly Lys Asn His Ser Gln Arg 35 40 45 Ala Lys Ile Glu Lys Glu Gln Asn Glu Asn Tyr Lys Ala Lys Lys Asp 50 55 60 Ala Glu Leu Glu Cys Glu Lys Leu Gly Leu Lys Ile Asn Ser Lys Asn 65 70 75 80 Ile Leu Lys Leu Arg Leu Phe Lys Glu Gln Lys Glu Phe Cys Ala Tyr 85 90 95 Ser Gly Glu Lys Ile Lys Ile Ser Asp Leu Gln Asp Glu Lys Met Leu 100 105 110 Glu Ile Asp His Ile Tyr Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr 115 120 125 Met Asn Lys Val Leu Val Phe Thr Lys Gln Asn Gln Glu Lys Leu Asn 130 135 140 Gln Thr Pro Phe Glu Ala Phe Gly Asn Asp Ser Ala Lys Trp Gln Lys 145 150 155 160 Ile Glu Val Leu Ala Lys Asn Leu Pro Thr Lys Lys Gln Lys Arg Ile 165 170 175 Leu Asp Lys Asn Tyr Lys Asp Lys Glu Gln Lys Asn Phe Lys Asp Arg 180 185 190 Asn Leu Asn Asp Thr Arg Tyr Ile Ala Arg Leu Val Leu Asn Tyr Thr 195 200 205 Lys Asp Tyr Leu Asp Phe Leu Pro Leu Ser Asp Asp Glu Asn Thr Lys 210 215 220 Leu Asn Asp Thr Gln Lys Gly Ser Lys Val His Val Glu Ala Lys Ser 225 230 235 240 Gly Met Leu Thr Ser Ala Leu Arg His Thr Trp Gly Phe Ser Ala Lys 245 250 255 Asp Arg Asn Asn His Leu His His Ala Ile Asp Ala Val Ile Ile Ala 260 265 270 Tyr Ala Asn Asn Ser Ile Val Lys Ala Phe Ser Asp Phe Lys Lys Glu 275 280 285 Gln Glu Ser Asn Ser Ala Glu Leu Tyr Ala Lys Lys Ile Ser Glu Leu 290 295 300 Asp Tyr Lys Asn Lys Arg Lys Phe Phe Glu Pro Phe Ser Gly Phe Arg 305 310 315 320 Gln Lys Val Leu Asp Lys Ile Asp Glu Ile Phe Val Ser Lys Pro Glu 325 330 335 Arg Lys Lys Pro Ser Gly Ala Leu His Glu Glu Thr Phe Arg Lys Glu 340 345 350 Glu Glu Phe Tyr Gln Ser Tyr Gly Gly Lys Glu Gly Val Leu Lys Ala 355 360 365 Leu Glu Leu Gly Lys Ile Arg Lys Val Asn Gly Lys Ile Val Lys Asn 370 375 380 Gly Asp Met Phe Arg Val Asp Ile Phe Lys His Lys Lys Thr Asn Lys 385 390 395 400 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Lys Val Leu 405 410 415 Pro Asn Lys Ala Val Ala Arg Ser Lys Lys Gly Glu Ile Lys Asp Trp 420 425 430 Ile Leu Met Asp Glu Asn Tyr Glu Phe Cys Phe Ser Leu Tyr Lys Asp 435 440 445 Ser Leu Ile Leu Ile Gln Thr Lys Asp Met Gln Glu Pro Glu Phe Val 450 455 460 Tyr Tyr Asn Ala Phe Thr Ser Ser Thr Val Ser Leu Ile Val Ser Lys 465 470 475 480 His Asp Asn Lys Phe Glu Thr Leu Ser Lys Asn Gln Lys Ile Leu Phe 485 490 495 Lys Asn Ala Asn Glu Lys Glu Val Ile Ala Lys Ser Ile Gly Ile Gln 500 505 510 Asn Leu Lys Val Phe Glu Lys Tyr Ile Val Ser Ala Leu Gly Glu Val 515 520 525 Thr Lys Ala Glu Phe Arg Gln Arg Glu Asp Phe Lys Lys 530 535 540 <210> 3 <211> 96 <212> DNA <213> Artificial Sequence <220> <223> gRNA <400> 3 ttgagtttgt aacagctgct gcgttttagt ccctgaaaag ggactaaaat aaagagtttg 60 cgggactctg cggggttaca atcccctaaa accgct 96 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aaaccatgga tggccagaat cctggcct 28 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aaaggatcct tagtagtagg tttcgttgaa g 31 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 aaaccatgga tggacgaagt gaccaaccc 29 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aaaggatcct tactttttga agtcctctct c 31 <210> 8 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aaaggatcct tgagtttgta acagctgctg ggttttagtc cctgaaaag 49 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aaaacgcgtg cggttttagg ggattgtaac 30 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 atgaagacta atctttttc 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ttaaagctca tcatgtttg 19 <210> 12 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 atgtctacac cattt 15 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gggcccacca ccgctgt 17 <210> 14 <211> 3993 <212> DNA <213> Unknown <220> <223> Radish mosaic virus RNA2 <400> 14 tattaaaatt ttattgaaat tttgataaac cgcaatcagg accagtgtcc gaactgttac 60 ttttgaactc agttttcaac gaaggcaggt aattggctta caaaccgatc agactgtcat 120 tgagaacaaa agaatcaggt tacgctaaag taaggacact cgtattgttc cattggtgct 180 tctgcatctt tgggcactac agttaccttg ttgtttgcat tcctaaccag acgaaggtgg 240 gtaacgagct tttaaacttg tcagaccacc acaggaaacg atagtgcgat ttcacattgc 300 tgtgcctctc agagaatatc agatattgtg gaagcgtgcg ccggggtttg aagttacgcc 360 cgtctaaaat caattaaatc attggacgtg aatgacttac ttttcccctc aaaatcattt 420 tgtgaattac atattagcta ggcacggttg cgacgaggat tcaggggact tccgagtctc 480 tcctcaacag aaatacaacg aattactagt gcaatctcct ttaaagtttg ttttctttat 540 tttctttttc cattttgtag ttttcataga acgcttgttt ggatttcggt ttgccgcaga 600 cagttggtta tcgtaccgtt ttcaaggttt gtggagaagt ttgagaaagc ccatagagtt 660 caccaaagct cgaaaggctg ccctagcaga attcgcacca caaccatttg tttttttaga 720 tcccattatc acatattcag cagatagtgt tatagatatg gaacaggtta tggaacgtgg 780 agttgcagca aaagccttga tggtgcaaga caaagtatca atcaacaaga aacataagta 840 cgaaggcatc aaggattgca ttccatcagg aaaggacatg tacgtttttc gtcagaagat 900 gtttgacatg ttgatgcgcc gaagaaagag caaggaagtt gacatcactc gcattgaagg 960 gagtgagata atagaaatga aacacatgga cgttgggact ttaactcctg gtgaaaatgt 1020 tgtgctaaat gtcaagcttg ttgatgacga tagcgttttg agcgctaaag ccagtgatta 1080 cactcttcac cattccgtac gtgaatcaaa gtatgctaca gccatgcatg ttggagctat 1140 tgaagtcatt tttgatagtt ttgcgtcccc ttctagtgac atagttgggg gagtggttct 1200 agtggataca gctcataaaa cagttgaaaa tgctgtgcgg agtgtatttg tgacagggct 1260 agcaggtgga aagatgatac gtgtgctcat gtacccaaac acactagtcg agattggacc 1320 taagatgaat gagagattca aactagtgtg taccacttct aacagcgaca ttgcagatgg 1380 ttttaatcta gctgcagtca aagtaaatgt ggtgggctgt actcagagct taactgcacg 1440 atacgtgccg caaccattct tggaacaatg cctcaatgaa gagcgtggca ccgttgttga 1500 gtacttagga cagatgtctt acgtgatgca caattctaac gagatatctg aagaatttct 1560 ggcacaacag acaatggcgt ttgactttgg gagcaacctg cgtctgcaag gatcttcatc 1620 tggagcatcc ttgcagcgta ccacctcaat gagatatttg gttggcccaa gacaaagttt 1680 taaacaactg gagctagata aagaaccatc agcatttgaa aagaaaagac ttgaggcaaa 1740 ggacggggca gacaaattcc gtgactcaac gtttgtggac cctgtgtatg ggaagacaag 1800 aagagctttc ggtcagactt ctgtgacgcg ctctttgctt aacagatttt cctctgccaa 1860 tgaaacagaa gggactcccc ttgacaccaa gatagcaaga acaaaaattt tgctcacaaa 1920 agttatggca ggaggaaaga tcttgtacac ggcgcgtttg agcgacgttc ttctaaataa 1980 agaccagagg gctgctattt cttttcagag aacccatgtc caacacagga aattggtggc 2040 tttagcaact ttgggagtac cagaaaacac tgggtgtgct ttaatgatgt gttacaacag 2100 tggagtacga ggaaaagcgg ttgttgatgc ttatacagcg tcggcagagg ctagtgtgat 2160 ttggaatcct gcctgtcagc ggcaagcaat gttggaaata gatgtcaatc cgtgccagag 2220 tggatggagc tatcagtatc tcagacagac caacagctac tttaatgtgg tatgcatttc 2280 gggttggacg acaactcctt taacagattt gtctatgacc atagattggt atctaagctc 2340 tgaagaaagt gtgacttcta tatactatgc ttcaggagga aatcctgtga taaagctgaa 2400 caggtggatg gggcgattga ttttcccaca gggaactgaa atgacaatgc aacgcatgcc 2460 cttggccata ggaggtggag ctggaggaaa tggattggtg tatatgaata tgccaaatgc 2520 cttgtgctct ttatggaggt acatcaaagg aggagttaag tttgaggtga tcaagctgag 2580 ctctccctat gtaaaggcaa ccatagcttt ctttatagct tttactgacg ttgatgcaac 2640 actacccaat cttgaagcat atccacataa gcttgttcag ttcgcagaga ttcaagacag 2700 agtgacgatt gaatttgata aagatgaatt tgtcatggcc tggtcttcac aagttcacac 2760 caatgtacct atagatcagg atgggtgtcc ttatttgtat gctgtggttc acgactgtgc 2820 aggatcgacc attcccggtg atttcaacat aggagttgtt ttgaaagaga tggttgatgt 2880 ggaagctata ggaagacatc caggatggaa aggggctcgc cctctgccag cgtcgcctca 2940 ggggttgcgt aagagttcgt caggtgtatg gaatgagttg tacacaatta gaggccctcc 3000 tgaggctaaa tccactgagg ttgttcagtt cgcaattgat ctcataggtg tcggtatttc 3060 taccgcagga cgcggaacat ggtcactgga aactagtaat agccctatga acaatttgct 3120 gcgtacggct acatggaaga gcggaacaat ccattttcaa gttcttatgg aagggaatcc 3180 tttgattaag aggggagatt gggcttctta ctgtgagatt tcattggtcc agagtgctaa 3240 agatacaaca ctgtcaagtc gtaattgggt catgaaagat ccttcctcat gggagctgga 3300 gtttgatatt aagattgaag gacctaatgc tggttttgaa aattgggagg cccacttgag 3360 caaccaaaca agttggtatt tgacgtttgc ggtttataac cctgatcaaa ccactgtgtt 3420 tactgtgaat ggtatgctta atgatgattt ctgctgtgct ggtaacacac tgatgcctcc 3480 tttcttagag ccacaaagtt tagcttcaga taggacacct ttgtcacaga tgacctttag 3540 ctatgaggac aacttggtaa gggatgttga tccgccagac ccagataacg ttcagggaag 3600 gccagaaact agcagtgatc aagaacgtag actgcagcag cagaggaagc gtggcttcaa 3660 caataaattt gcattctaaa ttggtttctt ttggacacct tctccagttt tctttagttt 3720 tggtgtattt gcagttcact tgtttccttt cgttttctta tctagagatt tttaggtttt 3780 agtatttatc ttctttcaat ttgtgtgttt gcaagttttt tatgttagtt tgaatattag 3840 agtaaatctt ctttggatgt ttgaaagtct gtggaaacat tccggttcag ggagcaggac 3900 cgcctaggag gtaggactct gggtttagtt gctctcacat gttataaata gaatacattt 3960 gcttactttt gttattgagt gtgttttctt ttc 3993 <110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Method for gene editing of plant using RNA plant virus and uses it <130> PN19403 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 443 <212> PRT <213> Campylobacter jejuni <400> 1 Met Ala Arg Ile Leu Ala Phe Asp Ile Gly Ile Ser Ser Ile Gly Trp 1 5 10 15 Ala Phe Ser Glu Asn Asp Glu Leu Lys Asp Cys Gly Val Arg Ile Phe 20 25 30 Thr Lys Val Glu Asn Pro Lys Thr Gly Glu Ser Leu Ala Leu Pro Arg 35 40 45 Arg Leu Ala Arg Ser Ala Arg Lys Arg Leu Ala Arg Arg Lys Ala Arg 50 55 60 Leu Asn His Leu Lys His Leu Ile Ala Asn Glu Phe Lys Leu Asn Tyr 65 70 75 80 Glu Asp Tyr Gln Ser Phe Asp Glu Ser Leu Ala Lys Ala Tyr Lys Gly 85 90 95 Ser Leu Ile Ser Pro Tyr Glu Leu Arg Phe Arg Ala Leu Asn Glu Leu 100 105 110 Leu Ser Lys Gln Asp Phe Ala Arg Val Ile Leu His Ile Ala Lys Arg 115 120 125 Arg Gly Tyr Asp Asp Ile Lys Asn Ser Asp Asp Lys Glu Lys Gly Ala 130 135 140 Ile Leu Lys Ala Ile Lys Gln Asn Glu Glu Lys Leu Ala Asn Tyr Gln 145 150 155 160 Ser Val Gly Glu Tyr Leu Tyr Lys Glu Tyr Phe Gln Lys Phe Lys Glu 165 170 175 Asn Ser Lys Glu Phe Thr Asn Val Arg Asn Lys Lys Glu Ser Tyr Glu 180 185 190 Arg Cys Ile Ala Gln Ser Phe Leu Lys Asp Glu Leu Lys Leu Ile Phe 195 200 205 Lys Lys Gln Arg Glu Phe Gly Phe Ser Phe Ser Lys Lys Phe Glu Glu 210 215 220 Glu Val Leu Ser Val Ala Phe Tyr Lys Arg Ala Leu Lys Asp Phe Ser 225 230 235 240 His Leu Val Gly Asn Cys Ser Phe Phe Thr Asp Glu Lys Arg Ala Pro 245 250 255 Lys Asn Ser Pro Leu Ala Phe Met Phe Val Ala Leu Thr Arg Ile Ile 260 265 270 Asn Leu Leu Asn Asn Leu Lys Asn Thr Glu Gly Ile Leu Tyr Thr Lys 275 280 285 Asp Asp Leu Asn Ala Leu Leu Asn Glu Val Leu Lys Asn Gly Thr Leu 290 295 300 Thr Tyr Lys Gln Thr Lys Lys Leu Leu Gly Leu Ser Asp Asp Tyr Glu 305 310 315 320 Phe Lys Gly Glu Lys Gly Thr Tyr Phe Ile Glu Phe Lys Lys Tyr Lys 325 330 335 Glu Phe Ile Lys Ala Leu Gly Glu His Asn Leu Ser Gln Asp Asp Leu 340 345 350 Asn Glu Ile Ala Lys Asp Ile Thr Leu Ile Lys Asp Glu Ile Lys Leu 355 360 365 Lys Lys Ala Leu Ala Lys Tyr Asp Leu Asn Gln Asn Gln Ile Asp Ser 370 375 380 Leu Ser Lys Leu Glu Phe Lys Asp His Leu Asn Ile Ser Phe Lys Ala 385 390 395 400 Leu Lys Leu Val Thr Pro Leu Met Leu Glu Gly Lys Lys Tyr Asp Glu 405 410 415 Ala Cys Asn Glu Leu Asn Leu Lys Val Ala Ile Asn Glu Asp Lys Lys 420 425 430 Asp Phe Leu Pro Ala Phe Asn Glu Thr Tyr Tyr 435 440 <210> 2 <211> 541 <212> PRT <213> Campylobacter jejuni <400> 2 Met Asp Glu Val Thr Asn Pro Val Val Leu Arg Ala Ile Lys Glu Tyr 1 5 10 15 Arg Lys Val Leu Asn Ala Leu Leu Lys Lys Tyr Gly Lys Val His Lys 20 25 30 Ile Asn Ile Glu Leu Ala Arg Glu Val Gly Lys Asn His Ser Gln Arg 35 40 45 Ala Lys Ile Glu Lys Glu Gln Asn Glu Asn Tyr Lys Ala Lys Lys Asp 50 55 60 Ala Glu Leu Glu Cys Glu Lys Leu Gly Leu Lys Ile Asn Ser Lys Asn 65 70 75 80 Ile Leu Lys Leu Arg Leu Phe Lys Glu Gln Lys Glu Phe Cys Ala Tyr 85 90 95 Ser Gly Glu Lys Ile Lys Ile Ser Asp Leu Gln Asp Glu Lys Met Leu 100 105 110 Glu Ile Asp His Ile Tyr Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr 115 120 125 Met Asn Lys Val Leu Val Phe Thr Lys Gln Asn Gln Glu Lys Leu Asn 130 135 140 Gln Thr Pro Phe Glu Ala Phe Gly Asn Asp Ser Ala Lys Trp Gln Lys 145 150 155 160 Ile Glu Val Leu Ala Lys Asn Leu Pro Thr Lys Lys Gln Lys Arg Ile 165 170 175 Leu Asp Lys Asn Tyr Lys Asp Lys Glu Gln Lys Asn Phe Lys Asp Arg 180 185 190 Asn Leu Asn Asp Thr Arg Tyr Ile Ala Arg Leu Val Leu Asn Tyr Thr 195 200 205 Lys Asp Tyr Leu Asp Phe Leu Pro Leu Ser Asp Asp Glu Asn Thr Lys 210 215 220 Leu Asn Asp Thr Gln Lys Gly Ser Lys Val His Val Glu Ala Lys Ser 225 230 235 240 Gly Met Leu Thr Ser Ala Leu Arg His Thr Trp Gly Phe Ser Ala Lys 245 250 255 Asp Arg Asn Asn His Leu His His Ala Ile Asp Ala Val Ile Ile Ala 260 265 270 Tyr Ala Asn Asn Ser Ile Val Lys Ala Phe Ser Asp Phe Lys Lys Glu 275 280 285 Gln Glu Ser Asn Ser Ala Glu Leu Tyr Ala Lys Lys Ile Ser Glu Leu 290 295 300 Asp Tyr Lys Asn Lys Arg Lys Phe Phe Glu Pro Phe Ser Gly Phe Arg 305 310 315 320 Gln Lys Val Leu Asp Lys Ile Asp Glu Ile Phe Val Ser Lys Pro Glu 325 330 335 Arg Lys Lys Pro Ser Gly Ala Leu His Glu Glu Thr Phe Arg Lys Glu 340 345 350 Glu Glu Phe Tyr Gln Ser Tyr Gly Gly Lys Glu Gly Val Leu Lys Ala 355 360 365 Leu Glu Leu Gly Lys Ile Arg Lys Val Asn Gly Lys Ile Val Lys Asn 370 375 380 Gly Asp Met Phe Arg Val Asp Ile Phe Lys His Lys Lys Thr Asn Lys 385 390 395 400 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Lys Val Leu 405 410 415 Pro Asn Lys Ala Val Ala Arg Ser Lys Lys Gly Glu Ile Lys Asp Trp 420 425 430 Ile Leu Met Asp Glu Asn Tyr Glu Phe Cys Phe Ser Leu Tyr Lys Asp 435 440 445 Ser Leu Ile Leu Ile Gln Thr Lys Asp Met Gln Glu Pro Glu Phe Val 450 455 460 Tyr Tyr Asn Ala Phe Thr Ser Ser Thr Val Ser Leu Ile Val Ser Lys 465 470 475 480 His Asp Asn Lys Phe Glu Thr Leu Ser Lys Asn Gln Lys Ile Leu Phe 485 490 495 Lys Asn Ala Asn Glu Lys Glu Val Ile Ala Lys Ser Ile Gly Ile Gln 500 505 510 Asn Leu Lys Val Phe Glu Lys Tyr Ile Val Ser Ala Leu Gly Glu Val 515 520 525 Thr Lys Ala Glu Phe Arg Gln Arg Glu Asp Phe Lys Lys 530 535 540 <210> 3 <211> 96 <212> DNA <213> Artificial Sequence <220> <223> gRNA <400> 3 ttgagtttgt aacagctgct gcgttttagt ccctgaaaag ggactaaaat aaagagtttg 60 cgggactctg cggggttaca atcccctaaa accgct 96 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aaaccatgga tggccagaat cctggcct 28 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aaaggatcct tagtagtagg tttcgttgaa g 31 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 aaaccatgga tggacgaagt gaccaaccc 29 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aaaggatcct tactttttga agtcctctct c 31 <210> 8 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aaaggatcct tgagtttgta acagctgctg ggttttagtc cctgaaaag 49 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aaaacgcgtg cggttttagg ggattgtaac 30 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 atgaagacta atctttttc 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ttaaagctca tcatgtttg 19 <210> 12 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 atgtctacac cattt 15 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gggccccacca ccgctgt 17 <210> 14 <211> 3993 <212> DNA <213> Unknown <220> <223> Radish mosaic virus RNA2 <400> 14 tattaaaatt ttattgaaat tttgataaac cgcaatcagg accagtgtcc gaactgttac 60 ttttgaactc agttttcaac gaaggcaggt aattggctta caaaccgatc agactgtcat 120 tgagaacaaa agaatcaggt tacgctaaag taaggacact cgtattgttc cattggtgct 180 tctgcatctt tgggcactac agttaccttg ttgtttgcat tcctaaccag acgaaggtgg 240 gtaacgagct tttaaacttg tcagaccacc acaggaaacg atagtgcgat ttcacattgc 300 tgtgcctctc agagaatatc agatattgtg gaagcgtgcg ccggggtttg aagttacgcc 360 cgtctaaaat caattaaatc attggacgtg aatgacttac ttttcccctc aaaatcattt 420 tgtgaattac atattagcta ggcacggttg cgacgaggat tcaggggact tccgagtctc 480 tcctcaacag aaatacaacg aattactagt gcaatctcct ttaaagtttg ttttctttat 540 tttctttttt cattttgtag ttttcataga acgcttgttt ggatttcggt ttgccgcaga 600 cagttggtta tcgtaccgtt ttcaaggttt gtggagaagt ttgagaaagc ccatagagtt 660 caccaaagct cgaaaggctg ccctagcaga attcgcacca caaccatttg tttttttaga 720 tcccattatc acatattcag cagatagtgt tatagatatg gaacaggtta tggaacgtgg 780 agttgcagca aaagccttga tggtgcaaga caaagtatca atcaacaaga aacataagta 840 cgaaggcatc aaggattgca ttccatcagg aaaggacatg tacgtttttc gtcagaagat 900 gtttgacatg ttgatgcgcc gaagaaagag caaggaagtt gacatcactc gcattgaagg 960 gagtgagata atagaaatga aacacatgga cgttgggact ttaactcctg gtgaaaatgt 1020 tgtgctaaat gtcaagcttg ttgatgacga tagcgttttg agcgctaaag ccagtgatta 1080 cactcttcac cattccgtac gtgaatcaaa gtatgctaca gccatgcatg ttggagctat 1140 tgaagtcatt tttgatagtt ttgcgtcccc ttctagtgac atagttgggg gagtggttct 1200 agtggataca gctcataaaa cagttgaaaa tgctgtgcgg agtgtatttg tgacagggct 1260 agcaggtgga aagatgatac gtgtgctcat gtacccaaac acactagtcg agattggacc 1320 taagatgaat gagagattca aactagtgtg taccacttct aacagcgaca ttgcagatgg 1380 ttttaatcta gctgcagtca aagtaaatgt ggtgggctgt actcagagct taactgcacg 1440 atacgtgccg caaccattct tggaacaatg cctcaatgaa gagcgtggca ccgttgttga 1500 gtacttagga cagatgtctt acgtgatgca caattctaac gagatatctg aagaatttct 1560 ggcacaacag acaatggcgt ttgactttgg gagcaacctg cgtctgcaag gatcttcatc 1620 tggagcatcc ttgcagcgta ccacctcaat gagatatttg gttggcccaa gacaaagttt 1680 taaacaactg gagctagata aagaaccatc agcatttgaa aagaaaagac ttgaggcaaa 1740 ggacggggca gacaaattcc gtgactcaac gtttgtggac cctgtgtatg ggaagacaag 1800 aagagctttc ggtcagactt ctgtgacgcg ctctttgctt aacagatttt cctctgccaa 1860 tgaaacagaa gggactcccc ttgacaccaa gatagcaaga acaaaaattt tgctcacaaa 1920 agttatggca ggaggaaaga tcttgtacac ggcgcgtttg agcgacgttc ttctaaataa 1980 agaccagagg gctgctattt cttttcagag aacccatgtc caacacagga aattggtggc 2040 tttagcaact ttgggagtac cagaaaacac tgggtgtgct ttaatgatgt gttacaacag 2100 tggagtacga ggaaaagcgg ttgttgatgc ttatacagcg tcggcagagg ctagtgtgat 2160 ttggaatcct gcctgtcagc ggcaagcaat gttggaaata gatgtcaatc cgtgccagag 2220 tggatggagc tatcagtatc tcagacagac caacagctac tttaatgtgg tatgcatttc 2280 gggttggacg acaactcctt taacagattt gtctatgacc atagattggt atctaagctc 2340 tgaagaaagt gtgacttcta tatactatgc ttcaggagga aatcctgtga taaagctgaa 2400 caggtggatg gggcgattga ttttcccaca gggaactgaa atgacaatgc aacgcatgcc 2460 cttggccata ggaggtggag ctggaggaaa tggattggtg tatatgaata tgccaaatgc 2520 cttgtgctct ttatggaggt acatcaaagg aggagttaag tttgaggtga tcaagctgag 2580 ctctccctat gtaaaggcaa ccatagcttt ctttatagct tttactgacg ttgatgcaac 2640 actacccaat cttgaagcat atccacataa gcttgttcag ttcgcagaga ttcaagacag 2700 agtgacgatt gaatttgata aagatgaatt tgtcatggcc tggtcttcac aagttcacac 2760 caatgtacct atagatcagg atgggtgtcc ttatttgtat gctgtggttc acgactgtgc 2820 aggatcgacc attcccggtg atttcaacat aggagttgtt ttgaaagaga tggttgatgt 2880 ggaagctata ggaagacatc caggatggaa aggggctcgc cctctgccag cgtcgcctca 2940 ggggttgcgt aagagttcgt caggtgtatg gaatgagttg tacacaatta gaggccctcc 3000 tgaggctaaa tccactgagg ttgttcagtt cgcaattgat ctcataggtg tcggtatttc 3060 taccgcagga cgcggaacat ggtcactgga aactagtaat agccctatga acaatttgct 3120 gcgtacggct acatggaaga gcggaacaat ccattttcaa gttcttatgg aagggaatcc 3180 tttgattaag aggggagatt gggcttctta ctgtgagatt tcattggtcc agagtgctaa 3240 agatacaaca ctgtcaagtc gtaattgggt catgaaagat ccttcctcat gggagctgga 3300 gtttgatatt aagattgaag gacctaatgc tggttttgaa aattgggagg cccacttgag 3360 caaccaaaca agttggtatt tgacgtttgc ggtttataac cctgatcaaa ccactgtgtt 3420 tactgtgaat ggtatgctta atgatgattt ctgctgtgct ggtaacacac tgatgcctcc 3480 tttcttagag ccacaaagtt tagcttcaga taggacacct ttgtcacaga tgacctttag 3540 ctatgaggac aacttggtaa gggatgttga tccgccagac ccagataacg ttcagggaag 3600 gccagaaact agcagtgatc aagaacgtag actgcagcag cagaggaagc gtggcttcaa 3660 caataaattt gcattctaaa ttggtttctt ttggacacct tctccagttt tctttagttt 3720 tggtgtattt gcagttcact tgtttccttt cgttttctta tctagagatt tttaggtttt 3780 agtattttc ttctttcaat ttgtgtgttt gcaagttttt tatgttagtt tgaatattag 3840 agtaaatctt ctttggatgt ttgaaagtct gtggaaacat tccggttcag ggagcaggac 3900 cgcctaggag gtaggactct gggtttagtt gctctcacat gttataaata gaatacattt 3960 gcttactttt gttattgagt gtgttttctt ttc 3993

Claims (8)

삭제delete 삭제delete 삭제delete 편집하고자 하는 유전자의 염기서열에 특이적인 가이드 RNA 코딩 서열을 멀티클로닝 사이트 내에 포함하는 RNA 식물바이러스 기반 감염성클론을 식물체의 유묘기에 접종하는 단계; 및
상기 RNA 식물바이러스 기반 감염성클론에 접종된 식물체에 서열번호 1의 아미노산 서열로 이루어진 Cas9(CRISPR associated protein 9)의 N-말단 단편 코딩 서열 또는 서열번호 2의 아미노산 서열로 이루어진 Cas9의 C-말단 단편 코딩 서열을 멀티클로닝 사이트 내에 각각 포함하는 2개의 RNA 식물바이러스 기반 감염성클론을 개화 1~3주 전에 동시에 접종하는 단계;를 포함하는 유전자 교정 식물체의 제조방법.Inoculating an RNA plant virus-based infectious clone containing a guide RNA coding sequence specific for the nucleotide sequence of a gene to be edited in a multi-cloning site in the seedling stage of the plant; and
In plants inoculated into the RNA plant virus-based infectious clone, the N-terminal fragment coding sequence of Cas9 (CRISPR associated protein 9) consisting of the amino acid sequence of SEQ ID NO: 1 or the C-terminal fragment coding of Cas9 consisting of the amino acid sequence of SEQ ID NO: 2 A method for producing a gene-corrected plant comprising; simultaneously inoculating two RNA plant virus-based infectious clones each containing a sequence in a multi-cloning site 1-3 weeks before flowering. 제4항에 있어서, 상기 RNA 식물바이러스는 포텍스바이러스(Potexvirus) 속, 토바모바이러스(Tobamovirus) 속 또는 코모바이러스(Comovirus) 속의 식물바이러스인 것을 특징으로 하는 유전자 교정 식물체의 제조방법.5. The method of claim 4, wherein the RNA plant virus is a plant virus of the genus Potexvirus, Tobamovirus, or Comovirus. 삭제delete 삭제delete 삭제delete
KR1020190149519A 2019-11-20 2019-11-20 Method for gene editing of plant using RNA plant virus and uses thereof KR102274496B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190149519A KR102274496B1 (en) 2019-11-20 2019-11-20 Method for gene editing of plant using RNA plant virus and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190149519A KR102274496B1 (en) 2019-11-20 2019-11-20 Method for gene editing of plant using RNA plant virus and uses thereof

Publications (2)

Publication Number Publication Date
KR20210061684A KR20210061684A (en) 2021-05-28
KR102274496B1 true KR102274496B1 (en) 2021-07-08

Family

ID=76140345

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190149519A KR102274496B1 (en) 2019-11-20 2019-11-20 Method for gene editing of plant using RNA plant virus and uses thereof

Country Status (1)

Country Link
KR (1) KR102274496B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018151155A1 (en) * 2017-02-15 2018-08-23 国立研究開発法人農業・食品産業技術総合研究機構 Method for producing genome-edited plants using plant virus vectors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018151155A1 (en) * 2017-02-15 2018-08-23 国立研究開発法人農業・食品産業技術総合研究機構 Method for producing genome-edited plants using plant virus vectors

Also Published As

Publication number Publication date
KR20210061684A (en) 2021-05-28

Similar Documents

Publication Publication Date Title
KR20150085846A (en) Tal-Mediated Transfer DNA Insertion
CN110885835A (en) Nucleic acid sequences encoding transcription factors regulating alkaloid synthesis and their use for improving plant metabolism
JP2000507446A (en) Single step cutting means
CN105838717A (en) Promoters for regulating expression in plants
CA3071440C (en) Methods and compositions for viral-based gene editing in plants
CN110452291A (en) Application of the dendrobium candidum embryonic development advanced stage Abundant protein DoLEA43 in promotion plant callus is formed
KR102643810B1 (en) A method of mass production of target gene in plants
US20240026369A1 (en) Use of enhanced pol theta activity for eukaryotic genome engineering
CN110106189B (en) VBMYB gene and encoding protein and application thereof
KR102274496B1 (en) Method for gene editing of plant using RNA plant virus and uses thereof
DE60131075T2 (en) CONSTRUCTED BY RELEASE IN CLOSED, CIRCULAR FORM FROM A LARGER NUCLEOTIDE SEQUENCE WHICH ALLOWS THE SITE-SPECIFIC AND / OR DEVELOPMENT-SPECIFIC, REGULATED EXPRESSION OF SELECTED GENETIC SEQUENCES
CN110157710B (en) NaD1 gene promoter of nicotiana tabacum and application thereof
CN114230651A (en) Method for instantaneously changing color of dendrobium nobile by using DhMYB2 gene
KR20210062588A (en) Antibody produced by using afucosylated n.benthamiana and uses thereof
CN111826356A (en) Ginseng PDS gene and application thereof
CN108424911B (en) Seed-specific bidirectional promoter and application thereof
KR101322348B1 (en) StEIP gene enhancing resistance to Bacterial wilt and use thereof
KR101724370B1 (en) TRSV recombinant vector and uses thereof
CN109852626A (en) Albumen, expression vector, transformed plant and the application of a kind of GhOR gene and its coding
KR102579767B1 (en) Method for producing genome-edited tomato plant with increased Potyvirus resistance by eIF4E1 gene editing and genome-edited tomato plant with increased Potyvirus resistance produced by the same method
KR102110870B1 (en) IbOr-R96H mutant from Ipomoea batatas and uses thereof
CN114672499B (en) Pinus massoniana geranyl pyrophosphate synthetase gene PmGPPS, and promoter and application thereof
CN115807010B (en) Honeysuckle leaf glandular hair-growing gene and application thereof
CN111019954B (en) Tobacco protein ACTB and application thereof
CN110295192B (en) Bivalent RNAi expression vector for constructing TYLCV and ToCV by Gateway technology and application thereof

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right