CN114230651A

CN114230651A - Method for instantaneously changing color of dendrobium nobile by using DhMYB2 gene

Info

Publication number: CN114230651A
Application number: CN202111682443.XA
Authority: CN
Inventors: 李崇晖; 黄明忠; 侯天泽; 廖易
Original assignee: Tropical Crops Genetic Resources Institute CATAS
Current assignee: Tropical Crops Genetic Resources Institute CATAS
Priority date: 2021-12-30
Filing date: 2021-12-30
Publication date: 2022-03-25
Anticipated expiration: 2041-12-30
Also published as: CN114230651B

Abstract

The invention discloses a method for instantaneously changing the color of dendrobium by using DhMYB2 gene. The invention provides an application of a substance inhibiting the biological function of a DhMYB2 protein or a substance inhibiting the expression of a gene encoding the DhMYB2 protein in any one of the following or culturing a plant with any one of the following phenotypes: 1) changing the flower color of dendrobium; 2) reducing the anthocyanin content in the dendrobium orchid; 3) increasing the color brightness of dendrobium; 4) the brightness of dendrobium is reduced; 5) forming different flower colors of the dendrobium orchid single plant; the invention specifically obtains a segment of sequence of a CDS coding region of the DhMYB2 gene from dendrobii orchid, constructs a VIGS vector, transfers agrobacterium to the VIGS vector, and injects dendrobii orchid to realize the color change. The method has the advantages of remarkable color change effect, different plants and flowers, strong ornamental value and interestingness.

Description

Method for instantaneously changing color of dendrobium nobile by using DhMYB2 gene

Technical Field

The invention relates to a method for instantaneously changing the color of dendrobium by using DhMYB2 gene, belonging to the field of molecular biology and biotechnology.

Background

Dendrobii (dendorbium) has over 1500 species and many artificial hybrids, growing and growing mainly in tropical, subtropical and eastern regions of asia. The dendrobium has bright orchid color, various flower types and long preservation period, is a flower with extremely high ornamental value, is called as world four-spectacular orchid with Phalaenopsis (Phalaenopsis), Oncidium (Oncidium) and Cattleya (Cattleya), and is widely applied to the aspects of cut flowers, pot flowers, brooches, bouquets, catering flowers and the like. Flower color is the most important ornamental character of dendrobium. The orchid color of dendrobium mainly comprises dark red, purple red, pink, yellow, green, white and the like, and has rich coloring modes, such as pure color, decorative pattern, lip color specificity and the like. Anthocyanidin is the main pigment in the flowers of dendrobium, and controls the formation of purple red, pink, peach red and other colors. In recent years, breeders pay attention to changing the flower color and flower coloring mode of dendrobium. However, the traditional crossbreeding requires the comprehensive collection of breeding resources, and is influenced by the genetic background of the crossbreeding parents, so that the directional breeding of flower colors is difficult to realize. With the rapid development of biotechnology, it will become possible to improve the color and directionally culture new varieties of dendrobium by using genetic engineering technology.

The R2R3-MYB transcription factor is a key factor for determining the spatiotemporal pattern of anthocyanin synthesis in plant floral organs. The coloring mode of the dendrobium petals/sepals is usually different from that of the labial petals, which suggests that a complex anthocyanin synthesis regulation mode exists in the same dendrobium flowers.

Introduction of a foreign gene into VIGS (virus-induced gene silencing) leads to specific degradation of a plant endogenous mRNA sequence highly homologous to the foreign gene in a plant, and further studies on a target gene function through phenotypic variation. It is independent of the genetic transformation of the target plant and is a powerful tool for rapidly researching gene functions. The VIGS mechanism has a system silencing signal, and can carry out intercellular transmission in a long distance, thereby inducing the specific inhibition of the system, and therefore, the in-situ treatment is not required. In recent years, VIGS has been developed as a new rapid high-throughput gene function identification technology and is increasingly widely applied to the research of plant functional genomics. Many mature VIGS technologies have been established in dicotyledonous and monocotyledonous plants, the viruses used in dicotyledonous plants are Tobacco Rattle Virus (TRV), Cucumber Mosaic Virus (CMV), Tobacco Mosaic Virus (TMV) and the like, and in monocotyledonous plants, Brome Mosaic Virus (BMV), barley stripe virus (BSMV) and the like, and with the deep research of the VIGS technology, more and more viruses are derived into virus vectors to construct the VIGS system. The VIGS vectors that are currently successfully used in ornamental plants are 2 types, namely Tobacco Rattle Virus (TRV) based vectors and cymbidium mosaic virus (CymMV) based vectors.

At present, the VIGS technology successfully applied in dendrobium nobile is not seen, and reports of regulating biosynthesis of anthocyanin in dendrobium nobile by using DhMYB2 gene and changing flower color are not seen.

Disclosure of Invention

The invention aims to provide application of a substance for inhibiting the biological function of the DhMYB2 protein or a substance for inhibiting the expression of a gene coding the DhMYB2 protein.

The invention provides an application of a substance inhibiting the biological function of a DhMYB2 protein or a substance inhibiting the expression of a gene encoding the DhMYB2 protein in any one of the following or culturing a plant with any one of the following phenotypes:

1) changing the flower color of dendrobium;

2) reducing the anthocyanin content in the dendrobium orchid;

3) increasing the flower color lightness of dendrobium (embodied in flower color parameter L in the embodiment)^*The value rises);

4) the reduction of the vividness of dendrobium orchids is reduced (the embodiment specifically shows that the chroma C value is reduced);

5) forming different flower colors of the dendrobium orchid single plant;

the DhMYB2 protein is any one of the following proteins:

1) the amino acid sequence of the protein is a sequence 2 in a sequence table;

2) a protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to 1).

The flower color is changed into white flower or light color.

In the application, the coding gene of the DhMYB2 protein is any one of the following genes:

1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

2) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 1) and which code for proteins having the same function;

3) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in 1) and encoding a protein having the same function.

In the above application, the substance is a VIGS vector;

the action target sequence of the VIGS vector is sequence 1 or the position corresponding to 1 st-187 bp of the sequence 1 or the position corresponding to 1 st 598-744bp of the sequence 1. Corresponds to a position on a DNA molecule which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the sequence 1 and encodes a protein having the same function, and which corresponds to the 1 st-187 bp position of the sequence 1 or the 598 nd 744bp positions of the sequence 1.

In the application, the VIGS vector is obtained by inserting the fragment shown in the sequence 1 or the 1 st-187 bp site corresponding to the sequence 1 or the 1 st-744 bp site corresponding to the sequence 1 into the pCymMV-pro60 vector.

The dendrobium orchid (namely the dendrobium orchid to be changed) is a dendrobium orchid with a purple red phenotype, and the specific variety is 'mini', 'flower' or self-breeding variety '17002'.

The invention also aims to provide a method for changing the flower color of dendrobium nobile orchid.

The method provided by the invention comprises the following steps:

1) constructing a VIGS vector; the action target sequence of the VIGS vector is sequence 1 or the position corresponding to 1 st-187 bp of the sequence 1 or the position corresponding to 1 st 598 and 744bp of the sequence 1;

2) transferring the VIGS vector into agrobacterium to obtain a recombinant strain;

3) and (3) introducing the recombinant bacteria into the leaves of dendrobium with the flower color to be changed, and culturing to obtain the dendrobium with the changed flower color.

In an embodiment of the present invention, the leaf of dendrobium to be changed in flower color is specifically the back of the first leaf below the flower stalk, and the introducing is injection.

In the method, the dendrobium orchid with changed flower color is characterized in that compared with the dendrobium orchid with the changed flower color, the dendrobium orchid with changed flower color has the advantages of increased flower color types, lighter flower color, reduced anthocyanin content, increased flower color brightness and/or reduced vividness.

In the method, in the step 3), the introduction time is the period when the dendrobium to be changed in flower color is in the extracted inflorescence of 10-15cm and the flower bud is not opened.

The invention also aims to provide a method for reducing the anthocyanin content in dendrobium nobile orchid.

The method provided by the invention comprises the following steps: the content or activity of the DhMYB2 protein in dendrobium nobile orchid is inhibited or the expression of the coding gene of the DhMYB2 protein in dendrobium nobile orchid is inhibited, so that the anthocyanin content in dendrobium nobile orchid is reduced.

The DhMYB2 protein is any one of the following proteins:

1) the amino acid sequence of the protein is a sequence 2 in a sequence table;

In the method, the inhibition of the content or activity of the DhMYB2 protein in dendrobium nobile flower, or the inhibition of the expression of the coding gene of the DhMYB2 protein in dendrobium nobile flower is realized by introducing a VIGS vector into dendrobium nobile flower;

the action target sequence of the VIGS vector is sequence 1 or the position corresponding to 1 st-187 bp of the sequence 1 or the position corresponding to 1 st 598-744bp of the sequence 1.

The invention provides a DhMYB2-pCymMV-pro60 recombinant VIGS vector constructed based on a DhMYB2 gene fragment and an insertion fragment sequence thereof, particularly a sequence of a CDS coding region of a DhMYB2 gene obtained from dendrobii orchids is subjected to reverse transcription RT-PCR to obtain the gene fragment, the gene fragment is inserted into a pCymMV-pro60 vector to construct a VIGS vector, agrobacterium is transferred into the VIGS vector, dendrobii orchids are injected, flowers with first flower color change can be bloomed after 20-30 days, flowers with each flower color change on the inflorescence are subjected to flower color change until the whole flowers are withered and withered to obtain dendrobii orchids with different flower colors formed by a single plant, and if unopened flower buds exist after one month, the bloomed flower color is recovered to be normal. The method of the invention has the advantages that: the flower color changing effect is obvious, the appearance of different plants and different flowers is different, the ornamental value is strong, and the interestingness is achieved; the injection of the leaves does not damage flowers, and the flowering form is normal without deformity; the flower color changing effect is lasting, a first flower with changed flower color can be opened 20-30 days after injection, and then each flower opened on the inflorescence has changed flower color until the whole flower is aged and withered; by injecting the pollen in the early stage of inflorescence extraction, flowers with more changed flower colors can be obtained.

Drawings

FIG. 1 is a schematic representation of the DhMYB2 insert used to construct the VIGS vector.

FIG. 2 is the ` Mini ` flower phenotype of silenced DhMYB 2.

FIG. 3 shows the ` 17002 ` and ` flower phenotype after silencing DhMYB 2.

FIG. 4 shows flower color parameters and anthocyanin content (C) of "17002" and 'flower' petals (A) and sepals (B) after silencing of DhMYB 2.

FIG. 5 shows the silencing efficiency of DhMYB2 expression after treatment with "17002" of DhMYB 2-1.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.

The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

pCymMV-pro60 vector, which was gifted by professor Zetty Wen-Chieh Tsai, the institute for tropical plant science, Taiwan, successfully university, and is described in the following documents: lu et al, 2012, A High-through Virus-Induced Gene-stretching vector for Screening transformation factory in Virus-Induced Plant, Molecular Plant-Microbe Interactions,25 (6): 738-746.

example 1 method for instantaneously changing the color of dendrobium nobile

Construction of one, VIGS vector

1. DhMYB2-pMD18-T recombinant plasmid

The method comprises the steps of taking flower buds of Dendrobium varieties 'Red pearls' (Dendrobium 'Red Pearl') (plants are purchased from south-Galamina orchid industry Co., Ltd. in Hainan province) as materials, extracting total RNA by using a total RNA extraction kit method of a polysaccharide polyphenol plant of radix asparagi, synthesizing cDNA by using a Thermo Scientific reverse transcription kit, and taking the cDNA as a template. Designing a full-length cDNA amplification primer: MYB2F1: 5'-GCAATGGGAAAAAATCCGTGC-3'; MYB2R1:5'-CGGGAAAAAAATTCTATGACAAA-3', amplified using the template described above.

The amplification reaction program is 95 ℃ for 3min,95 ℃ for 30S,60 ℃ for 30S,72 ℃ for 1min for 30S,35 cycles, and 72 ℃ for 10 min.

An amplification reaction system: vazyme 2X Phanta Max Master Mix (from Nanjing Novowed Biotech Co., Ltd.) 10. mu.L, forward primer MYB2F1 and reverse primer MYB2R1 each 0.5. mu.L, template cDNA 0.5. mu.L, and sterile water to make up 20. mu.L of the total system.

The amplified product was subjected to 1% agarose electrophoresis, the band of interest was recovered, and the PCR 3' -blunt-ended product plus-A tail was obtained using 2 × Rapid Taq Master Mix (purchased from Nanjing Novozan Biotech Co., Ltd.), and cloned into

On the T1 vector (purchased from all-gold Biotechnology Co., Ltd.), the DhMYB2-pMD18-T recombinant plasmid was obtained and sequenced.

DhMYB2-

the-T1 recombinant plasmid is obtained by inserting DhMYB2 gene shown in sequence 1

A plasmid obtained from the T1 vector expresses DhMYB2 protein shown in a sequence 2.

2. VIGS vectors

1) Obtaining of inserts DhMYB2-1 through DhMYB2-5

After aligning with DhMYB2(KY039157), use DhMYB2-

The T1 plasmid is used as a template, and PCR amplification is carried out by the following primer pairs respectively:

MYB2VF1：5'-GCAATGGGAAAAAATCCGTGC-3'，

MYB2VR1：5'-TCAGGTAATTTAGCCATCGGA；

MYB2VF2：5'-CCAACGTTAAACATGGAAACT-3'，

MYB2VR2：5'-TCATTATCTGTCCGACCGGGT-3'；

MYB2VF3：5'-ACAAATGATACAACTTTGATC-3'，

MYB2VR3：5'-TTAGCTATTGACTCTTCTGCT-3'；

MYB2VF4：5'-GTGGCTAGTATGATTCCTGAA-3'，

MYB2VR4：5'-CGCTTGATCAGGAAATGAAAC-3'；

MYB2VF5：5'-TGAAAGATTACAAGATTTTGAG-3'，

MYB2VR5：5'-CTTACACTGATATTATCACATA-3'；

before amplification, linkers attB1 are added at the 5' ends of the F and R primers of each pair of primers respectively: GGGGACAAGTTTGTACAAAAAAGCAGGCT and attB 2: GGGGACCACTTTGTACAAGAAAGCTGGGT are provided.

Homologous fragments of the following 5 inserts were obtained:

homologous fragment attB1-DhMYB2-1-attB2, homologous fragment attB1-DhMYB2-2-attB2, homologous fragment attB1-DhMYB2-3-attB2, homologous fragment attB1-DhMYB2-4-attB2, and homologous fragment attB1-DhMYB2-5-attB 2.

The PCR reaction procedure was 95 ℃ for 4min,95 ℃ for 30S,60 ℃ for 30S,72 ℃ for 20S,35 cycles, and 72 ℃ for 5 min.

The amplification reaction system described above: vazyme 2X Phanta Max Master Mix (from Nanjing Novowed Biotech Co., Ltd.) 10. mu.L, 0.5. mu.L each of the adapter-added forward primer MYB2VF and the adapter-added reverse primer MYB2VR, 0.5. mu.L of the template cDNA, and the total 20. mu.L of the system was made up with sterile water.

The amplified product was subjected to 2% agarose electrophoresis, and the desired band was recovered.

2) Construction of VIGS vector

Use of

BP Clonase^TMII Enzyme Mix Invitrogen, Sammer Feishel science (China) Ltd]The 5 homologous fragments were each homologously recombined into pCymMV-pro60 vector to obtain 5 recombinant plasmids.

The reaction system is as follows: PCR product 7. mu.L, pCymMV-pro60 vector 1. mu.L, BP clone^TMII enzyme mix 2. mu.L, 25 ℃ for 1h, 1. mu.L proteinase K solution was added, 37 ℃ for 10 min.

After the reaction is finished, 10 mu L of 5 recombinant plasmids are respectively transformed into escherichia coli TOP 10 competent cells, the escherichia coli TOP 10 competent cells are cultured on 100 mu g/mL kanamycin-resistant LB culture medium overnight until single colonies are formed, the correctness of the insertion position sequences of the recombinant plasmids is verified by sequencing after PCR detection, and the correct recombinant plasmids are respectively named as the following recombinant plasmids 1 to 5, namely 5 VIGS vectors.

The recombinant plasmid 1 for expressing DhMYB2-1 is a plasmid obtained by homologous recombination of a homologous fragment attB1-DhMYB2-1-attB2 between attP1 and attP2 sites of a pCymMV-pro60 vector; the DNA molecule nucleotide sequence shown in attB1-DhMYB2-1-attB2 consists of attB1 sequence, 1-187bp position (DhMYB2-1) of the sequence 1 and attB2 sequence.

The recombinant plasmid 2 for expressing DhMYB2-2 is a plasmid obtained by homologous recombination of a homologous fragment attB1-DhMYB2-2-attB2 between attP1 and attP2 sites of a pCymMV-pro60 vector; the nucleotide sequence of the DNA molecule shown as attB1-DhMYB2-2-attB2 consists of attB1 sequence, 191 st and 311bp positions (DhMYB2-2) of the sequence 1 and attB2 sequence.

The recombinant plasmid 3 for expressing DhMYB2-3 is a plasmid obtained by homologous recombination of a homologous fragment attB1-DhMYB2-3-attB2 between attP1 and attP2 sites of a pCymMV-pro60 vector; the nucleotide sequence of the DNA molecule shown as attB1-DhMYB2-3-attB2 consists of an attB1 sequence, a 463-596bp position (DhMYB2-3) of the sequence 1 and an attB2 sequence.

The recombinant plasmid 4 for expressing DhMYB2-4 is a plasmid obtained by homologous recombination of a homologous fragment attB1-DhMYB2-4-attB2 between attP1 and attP2 sites of a pCymMV-pro60 vector; the nucleotide sequence of the DNA molecule shown as attB1-DhMYB2-4-attB2 consists of an attB1 sequence, a 598-744bp position (DhMYB2-4) of the sequence 1 and an attB2 sequence.

The recombinant plasmid 5 for expressing DhMYB2-5 is a plasmid obtained by homologous recombination of a homologous fragment attB1-DhMYB2-5-attB2 between attP1 and attP2 sites of a pCymMV-pro60 vector; the nucleotide sequence of the DNA molecule shown as attB1-DhMYB2-5-attB2 consists of attB1 sequence, 758. sup. th and 958. sup. bp position (DhMYB2-5) of the sequence 1 and attB2 sequence.

Insert sizes DhMYB2-1, DhMYB2-2, DhMYB2-3, DhMYB2-4, DhMYB2-5 and the positions in the CDS sequence of the original DhMYB2 gene are shown in FIG. 1.

Second, the agrobacterium-mediated transient expression of 5 pCymMV-pro60 recombinant vectors in dendrobium

1. Preparation of recombinant bacterium

The 5 recombinant plasmids 1 to 5 constructed in the first step above were transformed into Agrobacterium-infected GV3010(pSoup) by freeze thawing with liquid nitrogen (purchased from Shanghai Wei Biotech Co., Ltd.), cultured on YEB solid resistant medium containing 100. mu.g/mL kanamycin and 50. mu.g/mL rifampicin until a single colony formed, the single colony was collected and cultured in YEB liquid resistant medium containing 100. mu.g/mL kanamycin and 50. mu.g/mL rifampicin (Shanghai Ye Biotech Co., Ltd., product No. R30379) overnight until the bacterial liquid became turbid, and the bacterial liquid was examined by the above primers and PCR program, respectively, to confirm that the plasmid contained. Obtaining positive recombinant bacteria 1 to 5, expressing DhMYB2-1 by the recombinant bacteria 1, expressing DhMYB2-2 by the recombinant bacteria 2, expressing DhMYB2-3 by the recombinant bacteria 3, expressing DhMYB2-4 by the recombinant bacteria 4, and expressing DhMYB2-5 by the recombinant bacteria 5.

The empty vector pCymMV-pro60 vector is transferred into agrobacterium-infected GV3010 by the same method to obtain a recombinant strain transferred with the empty vector, which is named as GV3010/pCymMV-pro 60.

2. Transient transfection

1) Preparation of transfection bacterial solution

Respectively culturing the bacterial liquid of the positive recombinant bacteria 1 to 5 of the 1 in a YEB liquid resistant culture medium for expanding culture until OD is obtained_600nmCentrifuging at 5000rpm/min for 5min to collect thallus, removing YEB culture medium, re-suspending thallus with MS culture medium, centrifuging at 5000rpm/min for 5min, collecting thallus, re-suspending with MS culture medium (Beijing Sorboubao technology, Ltd., product number M8522), and adjusting OD_600nmAnd obtaining a bacterial liquid when the value reaches 1.0, adding acetosyringone with the final concentration of 100 mu M into the bacterial liquid, and standing for 30min at the dark place at room temperature to obtain the transfection bacterial liquid of the recombinant bacteria 1-5.

2) Preparation of transfected plants

Taking dendrobium varieties 'mini' (the plants are purchased from south-Galamina orchid industry Co., Ltd. in Hainan east) as plant materials, selecting plants with inflorescences extracted by 10-15cm and unopened flower buds, wiping off flower buds with the length of more than 1cm, and reserving tender flower buds at the front section of the inflorescences to obtain plants to be transfected.

3) Injection transfection

And taking GV3010/pCymMV-pro60 bacterial liquid as a negative control, sucking the transfectant bacterial liquid of the recombinant bacteria 1-5 by using a 1mL sterile syringe, respectively injecting the transfectant bacterial liquid into the back surface of the first leaf below the pedicel of the plant to be transfected obtained in the step 2), and injecting 300 mu L of bacterial liquid into each plant. The injected plant material is maintained in an incubator with 25 ℃, the illumination intensity of 20000Lux, the illumination/dark time of 16h/8h and the humidity of 85% until the plant material blooms. 5 strains were injected for each transfection.

3. Phenotypic observations

The transfected bacterium liquid of the recombinant bacteria 1 to 5 in the step 2 is injected into flowers for about 25 days, the injected plants bloom flowers with the changed first flower color, each subsequent flower has more obvious change than the previous flower color, the changed flower color can be kept withered, and if the flowers still bloom 60 days after the injection, the color is recovered.

The gene silencing induced by the introduction of the 5 insert VIGS vector into the 'mini' body has different effects reflected on the flower color change, and is specifically represented as follows:

the ` Mini ` phenotypic results 25 days after injection are shown in FIG. 2A, with DhMYB2-1 to DhMYB2-5 representing the transfer of recombinant plasmids expressing the different inserts, respectively; flowers transformed into different inserts exhibited the following states: the radial white plaque (transferred into DhMYB2-4 and DhMYB2-5), even the majority of the radial white plaque (transferred into DhMYB2-1), and white spots (transferred into DhMYB2-2 and DhMYB2-3) on the flower. As can be seen, the silencing effect of the VIGS vectors introduced with the DhMYB2-1 and DhMYB2-4 inserts was more pronounced in the phenotype than with other treatments.

4. Molecular identification

Taking flower bud with length of about 2cm from 25 days 'mini' after injection of each insert in the 3, extracting total RNA by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit method, and using PrimeScript^TMTotal RNA was reverse transcribed into cDNA using RT reagent Kit with gDNA Eraser (Perfect Real Time) (available from Boehringer Biotech, Inc.). The expression level of DhMYB2 gene in flower buds was analyzed using Takara SYBR Premix Ex TaqTM II (Tli RNaseH Plus) fluorescent quantitation kit (purchased from Takara Biotechnology engineering (Dalian) Co., Ltd.). Untreated dendrobii blue 'mini' was used as a control. 3 strains per strain.

The primers used for real-time fluorescent quantitative PCR detection of the DhMYB2 gene are as follows:

DhMYB2-qF：5′-AAGGCAAATGGACGACGGTG-3′；

DhMYB2-qR：5′-TGTTTAACGTTGGGCCTCAGG-3′。

amplification reaction procedure of real-time fluorescent quantitative PCR: 3min at 95 ℃; 10s at 95 ℃ and 30s at 60 ℃ for 40 cycles. The relative expression level of the DhMYB2 gene is normalized by taking dendrobium beta-actin, TUA and CYP, 3 genes as internal references, and 2 genes are used^–△△CTThe method indicates relative quantification of the gene. The primer sequence of the internal reference gene is as follows:

Actin-qF：5′-GTCAGGGACATCAAGGAGAAG-3′，

Actin-qR：5′-TGGGCACCTAAATCTCTCAGC-3′；

TUA-qF：5′-CAAAGAAGATGCAGCCAACAAC-3′，

TUA-qR：5′-AAGACCAGTGCAGTTGTCAGCTA-3′；

CYP-qF：5′-TCTACGCCGACACGACTCCT-3′，

CYP-qR：5′-GGTGAAAGGTAGAGCCCTTGAA-3′。

the results are shown in FIG. 2B, and it can be seen that DhMYB2-1 to DhMYB2-5 respectively represent plants injected with different inserts, and that the silencing effect of the VIGS vector of the two inserts of DhMYB2-1 and DhMYB2-4 is more significant at the gene expression level than other treatments, which is consistent with the phenotypic results.

Therefore, two inserts of DhMYB2-1 and DhMYB2-4 can be adopted to transiently express dendrobium and realize flower color change.

Example 2 Agrobacterium-mediated transient expression of pCymMV-pro60 recombinant vectors for DhMYB2-1 and DhMYB2-4 in Dendrobium

Transient expression for changing the color of dendrobium

The recombinant strain 1 (OD) expressing DhMYB2-1 prepared in example 1 was selected_600nmValue up to 1.0) and recombinant bacterium 4 (OD) expressing DhMYB2-4_600nmThe value reached 1.0), another two dendrobium varieties "17002" (parent and parent are respectively 'splash' x 'swan orchid' hybrid, the parent and parent are purchased from south-hainan orchids industries limited company) and 'flower' (purchased from south-hainan orchids biotechnology limited company), the injection method is the same as that of example 1. 7 strains were injected for each treatment.

30 days after injection, CIEL was used under a C2 ℃ light source using an NF555 colorimeter^*a^*b^*Flower color parameters of petals and sepals of a plurality of discolored flowers of dendrobium determined by a color system are as follows: lightness L^*And a hue a^*、b^*Value and calculating chroma C ═ a according to the formula^*2+b^*2)^1/2. Anthocyanin in petals and sepals is extracted and the content is determined by referring to the method of Li et al (2016). [ Li et al, 2016, Isolation and characterization of a R2R3-MYB transformation factor produced to an anti-pathological in biochemical in the spathes of Anthurium andraeanum(Hort.),Plant Cell Rep.,35(10):2151-2165。]

GV3010/pCymMV-pro60 was injected as a control.

The results are as follows:

the silencing effect of introducing the DhMYB2-1VIGS vector and the VIGS vector expressing DhMYB2-4 into "17002" and 'flowers', respectively, was similar, with DhMYB2-1 treated phenotype (embodied in flower color changes) being more pronounced than DhMYB2-4 (Table 1, FIG. 3), and overall "17002" phenotype changes more pronounced than 'flowers' (FIG. 3).

Flower color parameter results of dendrobium petals and sepals express DhMYB2-1VIGS vector and DhMYB2-4 VIGS vector to silence DhMYB2, and lightness L of petals and sepals^*The value was increased and the chroma C value was decreased, indicating that lightness of the flower color was increased and vividness was decreased, the flower color was significantly lighter compared to the control, the color change after silencing of DhMYB2-1 to DhMYB2 was more significant than DhMYB2-4 (FIGS. 4A, 4B), and L from FIG. 4^*And C value shows that the flower color data is in a certain distribution range, which indicates that various flower colors are formed.

The detection result of the content of anthocyanin is as follows: the anthocyanin content in DhMYB2-1 treated "17002" and 'flower' petals and sepals was also significantly lower than the control (fig. 4C).

Table 1 shows the positive rate of the flower color phenotype after DhMYB2 silencing

As can be seen from the above, the dendrobium has more obvious color change after the recombinant vector expressing DhMYB2-1 is silenced.

Secondly, the silencing efficiency of DhMYB2 in the flower bud of 17002 after 30 days of treatment of DhMYB2-1

Injecting the recombinant strain 1 expressing DhMYB2-1 into 3 plants (DhMYB2-1-1, DhMYB2-1-2 and DhMYB2-1-3) in dendrobii orchid 17002 after 30 days, taking flower buds about 2cm in length as materials, extracting total RNA by using a radix asparagi polysaccharide polyphenol plant total RNA extraction kit method, and using PrimeScript^TMTotal RNA was reverse transcribed into cDNA using RT reagent Kit with gDNA Eraser (Perfect Real Time) (available from Boehringer Biotech, Inc.). The expression level of DhMYB2 gene in flower buds was analyzed using Takara SYBR Premix Ex TaqTM II (Tli RNaseH Plus) fluorescent quantitation kit (purchased from Takara Biotechnology engineering (Dalian) Co., Ltd.). Dendrobium "17002" was used as a control. The method is the same as the first embodiment.

The results are shown in fig. 5, and it can be seen that the expression level of the DhMYB2 gene of the flower buds (DhMYB2-1-1, DhMYB2-1-2, and DhMYB2-1-3) treated by DhMYB2-1 from 3 different plants is obviously reduced compared with the control, the minimum amplitude is reduced by 46%, the maximum amplitude is reduced by 95%, and the VIGS-mediated silencing effect of the DhMYB2 gene is better.

SEQUENCE LISTING

<110> research institute for tropical crop variety resources of Chinese tropical agricultural academy of sciences

<120> method for instantaneously changing color of dendrobium nobile by using DhMYB2 gene

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1068

<212> DNA

<213> Artificial sequence

<400> 1

gcaatgggaa aaaatccgtg ctgcttcaag gaagggctta acaagggagc atggactact 60

tcggaagaca tgctcttgaa ggctttcgtc aatattcatg gagaaggcaa atggacgacg 120

gtgccacaca aagcagggct gagaaggtcg gggaagagct gtcgactccg atggctaaat 180

tacctgaggc ccaacgttaa acatggaaac ttttccgagg aagaggacga cctcatcatc 240

agacttcata aactccttgg caatagatgg tctctgattg ctggaaggct acccggtcgg 300

acagataatg aaataaaaaa ctattggaac ataaccttat gtaagaaagc aagctttcaa 360

catcaaatgc atcagccaag ccgcccaagc atcatacaaa gacctccaac ttctaatctt 420

ggatttccaa catcatcatc tacaacacaa tcacaagctg ccacaaatga tacaactttg 480

atcctaacaa cggccataag gtgcaataaa ctggctattc caatgctact tccatcttct 540

tcaacaagta agcaggagat cccaaacatg caattagcag aagagtcaat agctaaagtg 600

gctagtatga ttcctgaaag cagcaaagtt ggtcccttgg tagaagaaga tctttttaag 660

gaactatttc aggtggagga gaatatggtt ttgaataacg acaaatttaa tgatgacaat 720

attgtttcat ttcctgatca agcggctgta atggagtttg aaagattaca agattttgag 780

aaatggatgc tgaatgatga agatgttgat tgccttcctc ctaatgatca aatgcgtatg 840

ttgacctctt tatttgatat aggaagtgaa ttctagggac aattctcttt tattgtttat 900

tctagagtta taaggtgttg tgtattcata attttgtatg tgataatatc agtgtaagtt 960

gagactatta atgtggctag ggatgaagtt ttgaagtggt tgaaggtgac tccatcctta 1020

ttcaattaaa aaaaatgtag ctatgtttgt catagaattt ttttcccg 1068

<210> 2

<211> 290

<212> PRT

<213> Artificial sequence

<400> 2

Met Gly Lys Asn Pro Cys Cys Phe Lys Glu Gly Leu Asn Lys Gly Ala

1 5 10 15

Trp Thr Thr Ser Glu Asp Met Leu Leu Lys Ala Phe Val Asn Ile His

20 25 30

Gly Glu Gly Lys Trp Thr Thr Val Pro His Lys Ala Gly Leu Arg Arg

35 40 45

Ser Gly Lys Ser Cys Arg Leu Arg Trp Leu Asn Tyr Leu Arg Pro Asn

50 55 60

Val Lys His Gly Asn Phe Ser Glu Glu Glu Asp Asp Leu Ile Ile Arg

65 70 75 80

Leu His Lys Leu Leu Gly Asn Arg Trp Ser Leu Ile Ala Gly Arg Leu

85 90 95

Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Ile Thr Leu

100 105 110

Cys Lys Lys Ala Ser Phe Gln His Gln Met His Gln Pro Ser Arg Pro

115 120 125

Ser Ile Ile Gln Arg Pro Pro Thr Ser Asn Leu Gly Phe Pro Thr Ser

130 135 140

Ser Ser Thr Thr Gln Ser Gln Ala Ala Thr Asn Asp Thr Thr Leu Ile

145 150 155 160

Leu Thr Thr Ala Ile Arg Cys Asn Lys Leu Ala Ile Pro Met Leu Leu

165 170 175

Pro Ser Ser Ser Thr Ser Lys Gln Glu Ile Pro Asn Met Gln Leu Ala

180 185 190

Glu Glu Ser Ile Ala Lys Val Ala Ser Met Ile Pro Glu Ser Ser Lys

195 200 205

Val Gly Pro Leu Val Glu Glu Asp Leu Phe Lys Glu Leu Phe Gln Val

210 215 220

Glu Glu Asn Met Val Leu Asn Asn Asp Lys Phe Asn Asp Asp Asn Ile

225 230 235 240

Val Ser Phe Pro Asp Gln Ala Ala Val Met Glu Phe Glu Arg Leu Gln

245 250 255

Asp Phe Glu Lys Trp Met Leu Asn Asp Glu Asp Val Asp Cys Leu Pro

260 265 270

Pro Asn Asp Gln Met Arg Met Leu Thr Ser Leu Phe Asp Ile Gly Ser

275 280 285

Glu Phe

290

Claims

1. The application of a substance for inhibiting the biological function of the DhMYB2 protein or a substance for inhibiting the expression of a gene coding the DhMYB2 protein in any one of the following or culturing a plant with any one of the following phenotypes:

1) changing the flower color of dendrobium;

2) reducing the anthocyanin content in the dendrobium orchid;

3) increasing the color brightness of dendrobium;

4) the brightness of dendrobium is reduced;

5) forming different flower colors of the dendrobium orchid single plant;

the DhMYB2 protein is any one of the following proteins:

1) the amino acid sequence of the protein is a sequence 2 in a sequence table;

2. Use according to claim 1, characterized in that:

the coding gene of the DhMYB2 protein is any one of the following genes:

3. Use according to claim 1 or 2, characterized in that:

the substance is a VIGS vector;

4. Use according to claim 3, characterized in that:

the VIGS vector is obtained by inserting a fragment shown in a sequence 1 or a position corresponding to 1-187bp of the sequence 1 or a position corresponding to 1 598-744bp of the sequence 1 into a pCymMV-pro60 vector.

5. A method for changing the flower color of dendrobium nobile lindl flower comprises the following steps:

6. The method of claim 5, wherein:

compared with the dendrobium to be changed in flower color, the dendrobium orchid with changed flower color has the advantages of increased flower color types, lighter flower color, reduced anthocyanin content, increased flower color brightness and/or reduced vividness.

7. The method according to claim 5 or 6, characterized in that:

in the step 3), the leading-in time is the period when the dendrobium to be changed in flower color is in the extracted 10-15cm inflorescence and the flower bud is not opened.

8. A method for reducing anthocyanin content in dendrobium orchid comprises the following steps: the biological function of DhMYB2 protein in dendrobium nobile orchid is inhibited or the expression of the encoding gene of the DhMYB2 protein in dendrobium nobile orchid is inhibited, so that the anthocyanin content in dendrobium nobile orchid is reduced;

the DhMYB2 protein is any one of the following proteins:

1) the amino acid sequence of the protein is a sequence 2 in a sequence table;

9. The method of claim 8, wherein:

the biological function of the DhMYB2 protein in dendrobium nobile flower or the expression of the coding gene of the DhMYB2 protein in dendrobium nobile flower is realized by introducing a VIGS vector into dendrobium nobile flower;