CN110938639B

CN110938639B - Tobacco ATP synthase gamma chain NtATPG and application thereof

Info

Publication number: CN110938639B
Application number: CN201911316324.5A
Authority: CN
Inventors: 陈千思; 徐国云; 张慧; 周会娜; 刘萍萍; 郑庆霞; 翟妞; 王晨; 金立锋
Original assignee: Zhengzhou Tobacco Research Institute of CNTC
Current assignee: Zhengzhou Tobacco Research Institute of CNTC
Priority date: 2019-12-19
Filing date: 2019-12-19
Publication date: 2022-07-08
Anticipated expiration: 2039-12-19
Also published as: CN110938639A

Abstract

The invention belongs to the field of tobacco genetic engineering, and particularly relates to a tobacco ATP synthase gamma chain NtATPG and an application patent application thereof.NtATPGThe gene consists of 1134 bases, and the base sequence is shown as SEQ ID NO. 1. The NtATPG protein consists of 377 amino acid residues, and the specific amino acid sequence is shown as SEQ ID NO. 2. In the application, through preliminary research on a specific tobacco ATP synthase gamma chain NtATPG, the inventor finds that the content of the glycerate substance in tobacco is highly related, and the glycerate substance content in the tobacco is obviously reduced after the gene is silenced. Based on the characteristic, the method can be used for controlling the quality of the tobacco leaves and cultivating a certain application basis and reference for new tobacco varieties.

Description

Tobacco ATP synthase gamma chain NtATPG and application thereof

Technical Field

The invention belongs to the field of tobacco genetic engineering, and particularly relates to a tobacco ATP synthase gamma chain NtATPG and an application patent application thereof.

Background

Nicotiana, tubuliformes, commonly ingested by humansNicotiana) There are more than 60 species, and two cultivars are mainly used for preparing the tobacco for smoking, namely common tobacco (also called carthamus tinctorius,Nicotiana tabacum) And yellow flower tobacco: (Nicotiana rustica) Wherein the former occupies the main cultivation area. The cultivated tobacco can be divided into six types of flue-cured tobacco, sun-cured tobacco, air-cured tobacco, burley tobacco, aromatic tobacco and yellow flower tobacco according to the characteristics of tobacco leaf quality, biological characters, cultivation modulation methods and the like, wherein the flue-cured tobacco is the most widely cultivated common tobacco in China.

As a leaf economic crop, the cultivation technology of flue-cured tobacco is different from other field crops, and not only a certain tobacco yield is required, but also the quality of the tobacco is emphasized. The tobacco leaf quality determines the availability of the tobacco leaves, directly influences the color, the fragrance, the taste and the commodity value of cigarette commodities, is also related to the economic benefit of tobacco growers, and is the life and the starting point of the tobacco industry. Therefore, in order to meet the increasing demand of cigarette enterprises at home and abroad on high-quality tobacco leaves, the quality and the safety of the tobacco leaves must be continuously improved.

Organic acids are an important component of the chemical composition of tobacco. The organic acid in the tobacco mainly refers to organic acid except amino acid, the variety is various, the content difference is large, the total content is generally 12% -16%, and most of the organic acid exists in the form of salt synthesized with alkali metal or organic base or ester. Organic acids in tobacco are generally classified into volatile acids, semi-volatile acids, and non-volatile acids. The research has generally considered that the organic acid not only plays an important role in the growth and development process of tobacco, but also has an important influence on the quality of tobacco leaves and cigarettes. Generally, organic acids can increase smoke acidity, alcohol and smoke, and make smoke taste sweet and pleasant. Especially volatile organic acids, although the content thereof is very low (up to 0.1-0.2%, and even 0.01-0.05%), the influence on the sensory quality of tobacco leaves is far greater than that of polybasic acids and higher fatty acids.

In a word, with the deepening of tobacco genetic engineering, the important influence of organic acid substance components on the tobacco leaf quality is combined, and the deep research and development of coding genes related to the organic acid substances in the tobacco can lay a good technical foundation for the tobacco quality regulation and control.

Disclosure of Invention

Based on the research of the tobacco glycerate substance content regulating gene, the invention aims to provide a tobacco ATP synthase gamma chain NtATPG gene and application thereof in the aspect of regulating the tobacco glycerate substance content, thereby laying a certain foundation for regulating and controlling the tobacco leaf quality and breeding new tobacco varieties.

The technical solution adopted in the present application is detailed as follows.

Coding gene of tobacco ATP synthase gamma chain NtATPGNtATPG，Contains 1134 basic groups, and the basic sequence is shown in SEQ ID NO. 1.

The coding geneNtATPGThe application of the method in controlling the content of the glycerate in the tobacco leaves is realized by regulating the expression quantity of a gamma chain NtATPG of a tobacco ATP synthase by utilizing a gene silencing technology or a gene overexpression method.

The coding geneNtATPGThe PCR amplification preparation method comprises the following steps:

(1) extracting (for example, taking tobacco K326 leaves as a sample) genome, and carrying out reverse transcription to obtain cDNA for later use;

(2) designing a primer for PCR amplification, and carrying out PCR amplification, wherein the specific primer sequence is designed as follows:

NtATPG-F：5’- GGGTAATTCTTATTTCCTCC - 3’，

NtATPG-R：5’- TCAGTTTCCCTTCCTTTGTT - 3’。

the tobacco ATP synthase gamma chain NtATPG is composed of 377 amino acid residues, and the specific amino acid sequence is shown as SEQ ID NO. 2.

The protein is related to the content of glyceric acid substances in plant leaves, and the content of the glyceric acid substances in the leaves is obviously reduced after the expression of the protein is reduced.

By using the saidCoding geneNtATPGThe method for cultivating the new variety of tobacco comprises constructing the tobacco containing gene by a transgenic technology, a transient expression technology or a genome editing technologyNtATPGTransforming tobacco by using a virus-induced silencing vector, an RNAi interference vector, an overexpression vector or a genome editing vector of the gene, and screening to obtain a new tobacco variety with changed glyceric acid content;

specific examples thereof include: interference using virus-induced gene silencing (VIGS) techniqueNtATPGThe expression of the gene(s) causes it to be silenced,NtATPGthe content of glyceric acid substances in the gene silencing plants is obviously reduced, and then new plant varieties with reduced glyceric acid content are obtained.

In other words, a method for breeding a new variety of tobacco with low glyceric acid content by interfering with virus-induced gene silencing (VIGS)NtATPGThe expression of the gene(s) causes it to be silenced,NtATPGthe glyceric acid content in the new tobacco variety plants with the gene silencing is obviously reduced.

In general, volatile acid can directly enter smoke gas in the smoking process of cigarettes due to the volatility of the volatile acid, and has good effect on taste and aroma, so that glyceric acid serving as volatile fatty acid has important influence on the quality of tobacco. Based on the important function of glyceric acid, the regulation and control gene of the glyceric acid substance in the tobacco is deeply researched, and a new tobacco variety is constructed by utilizing genetic engineering, so that a good application foundation can be laid for improving the tobacco variety. In the application, through preliminary research on a specific tobacco ATP synthase gamma chain NtATPG, the inventor finds that the gene is highly related to the content of tobacco glycerate substances, and the content of the glycerate substances in tobacco is obviously reduced after the gene is silenced. Based on the characteristic, the method can be used for controlling the quality of the tobacco leaves and cultivating a certain application basis and reference for new tobacco varieties.

Drawings

FIG. 1 shows the comparison of control plants,NtATPGrelative expression of the gene in the gene-silenced plant;

FIG. 2 is a comparison of glyceric acid content in tobacco leaves with virus-induced gene silencing and in control tobacco leaves.

Detailed Description

The present application is further illustrated by the following examples, which are intended to be briefly described as follows before describing the specific examples.

Biological material:

the Nicotiana benthamiana, a common tobacco material, is planted in a Zhenzhou tobacco institute planting base in the following examples, seedling is grown in a seedling raising pot, seedling division is carried out two weeks after germination, the seedlings are planted in a plastic pot (10 cm multiplied by 10 cm), and cultivation management such as daily fertilizer and water management is carried out under the dark condition of 22 ℃ and 16h light/8 h;

the VIGS vector used in the following examples is a viral vector (TRV) derived from tobacco rattle virus, specifically using TRV2 (a commonly used vector) carrying kanamycin selection marker and 35S promoter, and TRV2 carrying multiple cloning sites such as EcoR I and BamH I, which can be used to carry and transform foreign genes;

experimental reagent:

LB liquid medium, 1L content contains: 10 g bacterial peptone (bacteriological peptone); 10 g sodium chloride (NaCl); 5g yeast extract (yeast extract), autoclaving;

YEB liquid culture medium, 1L content contains: 5g beef extract (beef extract); 5g bacterial peptone (bacteriological peptone); 5g sucrose (sucrose); 1 g yeast extract (yeast extract); 2 mL of 1M magnesium sulfate (MgSO 4), autoclaved;

1M 2- (N-morpholine) ethanesulfonic acid (MES) stock: ddH₂Dissolving O, filtering, sterilizing, and storing at-20 ℃ for later use;

200 mM Acetosyringone (Acetosyringone, As) stock solution: dimethyl Sulfoxide (DSMO) was dissolved and stored at-20 ℃ until use.

Example 1

This example relates to tobaccoNtATPGThe construction of gene cloning and silencing vectors is briefly described below.

(1) TobaccoNtATPGCloning of genes

Tobacco genome and related methods based on prophaseNtATPGGene study and selectionThe specific coding sequence is a target segment, and the primer sequence for PCR amplification is designed as follows:

NtATPG-F：5’- GGGTAATTCTTATTTCCTCC - 3’，

NtATPG-R：5’- TCAGTTTCCCTTCCTTTGTT - 3’；

using cDNA of tobacco K326 leaf (firstly extracting genome, then making reverse transcription into cDNA) as template, making PCR amplification so as to obtain the invented productNtATPGA gene;

the PCR amplification procedure was: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 15s, extension at 72 ℃ for 30s, and complete extension at 72 ℃ for 5min after 34 cycles;

and carrying out agarose gel electrophoresis detection on the PCR amplification product, and recovering the electrophoresis product for later use.

(2) Construction of recombinant TRV2- NtATPGCarrier

Carrying out EcoRI and BamHI double enzyme digestion on the PCR amplification product in the step (1), simultaneously carrying out EcoRI and BamHI double enzyme digestion on an empty vector TRV2, respectively recovering enzyme digestion products, and utilizing T4 DNA ligase to carry out ligation;

transforming the ligation product into escherichia coli competent DH5 alpha, coating the transformation product on LB solid culture medium containing 50mg/L Kan after the transformation operation is finished, and culturing at 37 ℃ overnight;

selecting positive single colony to amplify, further carrying out PCR identification, and ensuring to obtain a correctly constructed recombinant vector TRV2- NtATPG。

It should be noted that, in the following description,

tobaccoNtATPGThe gene comprises 1134 bases, the base sequence is shown as SEQ ID NO.1, and the specific base sequence is as follows:

ATGTCTTGCTCAAATTTGACAATGTTGGTATCCTCAAAACCATCTCTTTCTGACTCCTCTGCACTTTCTTTCCGCTCTTCTGTCAACCCTTTTCAGCTTCCTAACCATAACTCATCAGGCCCTTCAAACCCCTCAAGATCATCATCAGTCACCCCTGTTCACTGTGGTCTCCGTGATCTACGTGATCGGATTGAATCAGTCAAGAACACCCAGAAAATTACTGAGGCTATGAAGCTTGTGGCTGCTGCTAAAGTCAGAAGAGCTCAAGAAGCTGTTGTGGGTGCTAGGCCTTTCTCTGAGACTTTGGTTGAGGTCCTTTACAACATCAATGAACAGCTTCAAACTGATGACATTGATGTTCCCCTCACCAAAGTTAGACCTGTCAAGAAAGTGGCTTTGGTTGTTGTCACTGGTGATCGTGGTCTATGTGGTGGTTTTAACAATTACCTCATCAAAAAAGCTGAGGCCAGGATTAGAGATTTGAAAGCTCTTGGCATTGAATACACTATTATCAGTGTTGGCAAAAAGGGTAATTCTTATTTCCTCCGTAGGCCTTACATTCCTGTAGATAAGTTCCTTGAAGGAAGCAATTTGCCCACTGCTAAAGATGCTCAGGCCATTGCTGATGATGTTTTTTCGCTTTTCGTGAGTGAAGAGGTTGACAAAGTTGAGCTTTTGTACACAAAGTTTGTGTCTTTAGTGAAATCTGAACCAGTGATTCACACCCTTCTTCCATTGTCACCAAAGGGAGAGATTTGTGACATCAATGGGAACTGTGTTGATGCAGCAGAAGATGAGTTCTTTAGGTTGACAACAAAGGAAGGGAAACTGACAGTGGAAAGAGATATTATGAGGACTAAGACAACTGATTTTTCGCCAATCTTGCAATTTGAGCAGGACCCTGTTCAGATTCTTGATGCCTTGCTTCCACTTTACTTGAACAGTCAAATCTTGAGGGCATTGCAGGAGTCATTAGCCAGTGAGCTTGCTGCTAGGATGAGTGCCATGAGCGCTGCAACAGATAATGCAACTGAGTTGAAGAAGAACCTTTCTAGAGCGTACAACAGACAGCGTCAGGCAAAGATTACAGGAGAAATATTGGAGATTGTTGCTGGTGCAGATGCCTTGGTTTAA。

the tobacco ATP synthase gamma chain protein NtATPG comprises 377 amino acids, the amino acid sequence is shown as SEQ ID NO.2, and the specific amino acid sequence is as follows:

MSCSNLTMLVSSKPSLSDSSALSFRSSVNPFQLPNHNSSGPSNPSRSSSVTPVHCGLRDLRDRIESVKNTQKITEAMKLVAAAKVRRAQEAVVGARPFSETLVEVLYNINEQLQTDDIDVPLTKVRPVKKVALVVVTGDRGLCGGFNNYLIKKAEARIRDLKALGIEYTIISVGKKGNSYFLRRPYIPVDKFLEGSNLPTAKDAQAIADDVFSLFVSEEVDKVELLYTKFVSLVKSEPVIHTLLPLSPKGEICDINGNCVDAAEDEFFRLTTKEGKLTVERDIMRTKTTDFSPILQFEQDPVQILDALLPLYLNSQILRALQESLASELAARMSAMSAATDNATELKKNLSRAYNRQRQAKITGEILEIVAGADALV。

example 2

Based on example 1, the inventors further constructed the recombinant TRV2- NtATPGThe vector transforms tobacco plants and verification analysis is carried out on the phenotype change conditions of related plants, and the specific experimental process is briefly described as follows.

(1) Transformation of Agrobacterium

It should be noted that, referring to the operation of example 1 and the prior art, the inventors prepared the TRV2-GFP recombinant vector at the same time as a control, and the specific transformation process was:

TRV2-GFP (vector control) and TRV2- NtATPGThe positive clone plasmids are respectively transformed into agrobacterium GV3101 competent cells in an electric shock transformation mode, so as to facilitateCulturing and screening are carried out by using YEB plates containing 50mg/L Kan and 50mg/L Rif, and agrobacterium carrying the target gene is screened by colony PCR after inverted culture for 2 days at 28 ℃.

(2) Preparation of a bacterial solution for transfection

Culturing the positive agrobacterium clones obtained by screening in the step (1) in 5 mL of YEB liquid culture medium (containing 50mg/L Kan and 50mg/L Rif) at 28 ℃ and 250 rpm overnight;

50uL of the overnight culture was inoculated into 50 mL of YEB liquid medium (containing 50mg/L Kan), and cultured to OD₆₀₀= 1.0-1.5, centrifuging at 4000g for 5min, collecting thallus, resuspending with MMA, and adjusting OD₆₀₀About = 1.0;

finally, the mixture is placed at room temperature for about 3 hours and then used as a bacterial liquid for transfection.

(3) Transient transformation

And (3) taking 3-4 w (week) of seedling-age Nicotiana benthamiana leaves as an experimental material, injecting the bacterial liquid for transfection prepared in the step (2) into the tobacco leaves by using a 1 mL-specification injector, continuously culturing the injected tobacco in an artificial incubator, and observing the phenotypic change.

Further by qRT-PCRNtATPGThe gene expression was examined, and the results are shown in FIG. 1, in which TRV2-NtATPGIn the infected plant of (1), the plant,NtATPGthe expression level of (2) is significantly reduced.

Further, the inventors tested the experimental group (TRV 2-NtATPGThe plant impregnated with the plant) and the control group (TRV 2-GFP impregnated plant) were tested for their glyceric acid content (the testing method was referred to "analysis of metabonomics of fresh tobacco leaves based on the combination of gas chromatography and liquid chromatography-mass spectrometry" (zhengqingxia et al, tobacco science and technology, 2019)), and the results are shown in fig. 2.

As can be seen from the results in FIG. 2, the glyceric acid content in the experimental group is significantly reduced compared with the control group, and the reduction percentage can reach 86.45%. This further suggests that by silencingNtATPGThe gene can regulate and control the content of the plant glyceric acid in the tobacco leaves, and further can lay a certain technical foundation for the regulation and control of the quality of tobacco leaves and the cultivation of new tobacco varieties.

SEQUENCE LISTING

<110> Zhengzhou tobacco institute of China tobacco general Co

<120> tobacco ATP synthase gamma chain NtATPG and application thereof

<130> none

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1134

<212> DNA

<213> Nicotiana tabacum

<400> 1

atgtcttgct caaatttgac aatgttggta tcctcaaaac catctctttc tgactcctct 60

gcactttctt tccgctcttc tgtcaaccct tttcagcttc ctaaccataa ctcatcaggc 120

ccttcaaacc cctcaagatc atcatcagtc acccctgttc actgtggtct ccgtgatcta 180

cgtgatcgga ttgaatcagt caagaacacc cagaaaatta ctgaggctat gaagcttgtg 240

gctgctgcta aagtcagaag agctcaagaa gctgttgtgg gtgctaggcc tttctctgag 300

actttggttg aggtccttta caacatcaat gaacagcttc aaactgatga cattgatgtt 360

cccctcacca aagttagacc tgtcaagaaa gtggctttgg ttgttgtcac tggtgatcgt 420

ggtctatgtg gtggttttaa caattacctc atcaaaaaag ctgaggccag gattagagat 480

ttgaaagctc ttggcattga atacactatt atcagtgttg gcaaaaaggg taattcttat 540

ttcctccgta ggccttacat tcctgtagat aagttccttg aaggaagcaa tttgcccact 600

gctaaagatg ctcaggccat tgctgatgat gttttttcgc ttttcgtgag tgaagaggtt 660

gacaaagttg agcttttgta cacaaagttt gtgtctttag tgaaatctga accagtgatt 720

cacacccttc ttccattgtc accaaaggga gagatttgtg acatcaatgg gaactgtgtt 780

gatgcagcag aagatgagtt ctttaggttg acaacaaagg aagggaaact gacagtggaa 840

agagatatta tgaggactaa gacaactgat ttttcgccaa tcttgcaatt tgagcaggac 900

cctgttcaga ttcttgatgc cttgcttcca ctttacttga acagtcaaat cttgagggca 960

ttgcaggagt cattagccag tgagcttgct gctaggatga gtgccatgag cgctgcaaca 1020

gataatgcaa ctgagttgaa gaagaacctt tctagagcgt acaacagaca gcgtcaggca 1080

aagattacag gagaaatatt ggagattgtt gctggtgcag atgccttggt ttaa 1134

<210> 2

<211> 377

<212> PRT

<213> Nicotiana tabacum

<400> 2

Met Ser Cys Ser Asn Leu Thr Met Leu Val Ser Ser Lys Pro Ser Leu

1 5 10 15

Ser Asp Ser Ser Ala Leu Ser Phe Arg Ser Ser Val Asn Pro Phe Gln

20 25 30

Leu Pro Asn His Asn Ser Ser Gly Pro Ser Asn Pro Ser Arg Ser Ser

35 40 45

Ser Val Thr Pro Val His Cys Gly Leu Arg Asp Leu Arg Asp Arg Ile

50 55 60

Glu Ser Val Lys Asn Thr Gln Lys Ile Thr Glu Ala Met Lys Leu Val

65 70 75 80

Ala Ala Ala Lys Val Arg Arg Ala Gln Glu Ala Val Val Gly Ala Arg

85 90 95

Pro Phe Ser Glu Thr Leu Val Glu Val Leu Tyr Asn Ile Asn Glu Gln

100 105 110

Leu Gln Thr Asp Asp Ile Asp Val Pro Leu Thr Lys Val Arg Pro Val

115 120 125

Lys Lys Val Ala Leu Val Val Val Thr Gly Asp Arg Gly Leu Cys Gly

130 135 140

Gly Phe Asn Asn Tyr Leu Ile Lys Lys Ala Glu Ala Arg Ile Arg Asp

145 150 155 160

Leu Lys Ala Leu Gly Ile Glu Tyr Thr Ile Ile Ser Val Gly Lys Lys

165 170 175

Gly Asn Ser Tyr Phe Leu Arg Arg Pro Tyr Ile Pro Val Asp Lys Phe

180 185 190

Leu Glu Gly Ser Asn Leu Pro Thr Ala Lys Asp Ala Gln Ala Ile Ala

195 200 205

Asp Asp Val Phe Ser Leu Phe Val Ser Glu Glu Val Asp Lys Val Glu

210 215 220

Leu Leu Tyr Thr Lys Phe Val Ser Leu Val Lys Ser Glu Pro Val Ile

225 230 235 240

His Thr Leu Leu Pro Leu Ser Pro Lys Gly Glu Ile Cys Asp Ile Asn

245 250 255

Gly Asn Cys Val Asp Ala Ala Glu Asp Glu Phe Phe Arg Leu Thr Thr

260 265 270

Lys Glu Gly Lys Leu Thr Val Glu Arg Asp Ile Met Arg Thr Lys Thr

275 280 285

Thr Asp Phe Ser Pro Ile Leu Gln Phe Glu Gln Asp Pro Val Gln Ile

290 295 300

Leu Asp Ala Leu Leu Pro Leu Tyr Leu Asn Ser Gln Ile Leu Arg Ala

305 310 315 320

Leu Gln Glu Ser Leu Ala Ser Glu Leu Ala Ala Arg Met Ser Ala Met

325 330 335

Ser Ala Ala Thr Asp Asn Ala Thr Glu Leu Lys Lys Asn Leu Ser Arg

340 345 350

Ala Tyr Asn Arg Gln Arg Gln Ala Lys Ile Thr Gly Glu Ile Leu Glu

355 360 365

Ile Val Ala Gly Ala Asp Ala Leu Val

370 375

Claims

1. Coding gene of tobacco ATP synthase gamma chain NtATPGNtATPGThe application of the gene silencing technology in the regulation and control of the content of glyceric acid substances in tobacco leaves is characterized in that the regulation and control utilizes the gene silencing technology to down-regulate the expression quantity of gamma chain NtATPG of ATP synthase of tobacco so as to down-regulate the content of the glyceric acid substances in the tobacco leaves;

coding gene of tobacco ATP synthase gamma chain NtATPGNtATPGThe base sequence is shown in SEQ ID NO. 1.

2. The application of the tobacco ATP synthase gamma chain NtATPG in the regulation and control of the content of glyceric acid substances in the tobacco leaves is characterized in that the tobacco ATP synthase gamma chain NtATPG is related to the content of glyceric acid substances in the tobacco leaves, and the regulation and control is to reduce the expression of the tobacco ATP synthase gamma chain NtATPG so that the content of the glyceric acid substances in the tobacco leaves is obviously reduced;

the amino acid sequence of the tobacco ATP synthase gamma chain NtATPG is shown in SEQ ID NO. 2.

3. Coding gene utilizing tobacco ATP synthase gamma chain NtATPGNtATPGThe method for breeding tobacco variety is characterized in that the tobacco variety containing coding gene is constructed by transgenic technologyNtATPGThe virus-induced silencing vector of (1) is used for transforming tobacco and screening to obtain a tobacco variety with the glyceric acid content reduced;