CN111826356A - Ginseng PDS gene and application thereof - Google Patents

Abstract

The invention discloses a ginseng PDS gene, the base sequence of which is shown in a sequence table SEQ ID NO. 1; a plant over-expression vector, which is inserted with a gene shown as a sequence table SEQ ID NO. 1; the ginseng PDS gene is applied to the aspect of promoting the synthesis of plant leaf chlorophyll; the results of the invention provePgPDSGene silencing sequence of the gene can cause whitening of ginseng seedlings and fruits; in the overexpressionPgPDSThe chlorophyll content in the tobacco leaves of the gene is obviously increased; illustrative of the ginsengPDSThe overexpression of the gene can promote the synthesis of chlorophyll of leaves.

Description

Ginseng PDS gene and application thereof

Technical Field

The invention belongs to the technical field of biological genetic engineering, and particularly relates to a ginseng PDS gene and application thereof.

Background

Ginseng is a perennial herb of Araliaceae, Panax, is a famous and precious medicinal material, mainly produced in Jilin, Liaoning, Heilongjiang province, Korea, Russia and other places in China. Ginseng contains abundant medicinal components including saponin, organic acid, sterol, polypeptide, flavone, etc., wherein ginsenoside is the main medicinal active component of Ginseng radix. Ginseng has the functions of resisting cancer, improving immunity, promoting blood circulation, regulating endocrine, resisting aging and the like, and is widely applied to the industries of medical care, beauty treatment, food and the like at present.

In order to study the processes of synthesis, transportation, regulation and the like of ginsenoside, researchers use various methods to analyze, clone, verify functions and study action mechanisms of important functional genes in ginseng. The current research and verification techniques for the functional genes of the ginseng include real-time fluorescence quantitative PCR (qRT-PCR), RNA interference (RNAi), homologous and heterologous overexpression, and the like. However, the characteristics of long reproduction period, strict growth conditions and the like of ginseng hinder the process of related research of ginseng. Although the establishment of culture systems of callus, adventitious roots, hairy roots and the like of ginseng and a ginseng genetic transformation method on the basis provide a foundation for the research and verification of important functional genes of ginseng, the defects of long experimental period, complex operation and the like still exist, so that the establishment of a gene function verification method with simple operation and short experimental period in ginseng is necessary.

Virus Induced Gene Silencing (VIGS) is a new technique developed to study gene function based on plant defense mechanisms against invading viruses. The VIGS gene silencing technology belongs to posttranscriptional level regulation, and commonly used vectors comprise three types, namely RNA viral vectors, DNA viral vectors and satellite viral vectors. Currently, RNA viral vectors such as Tobacco Mosaic Virus (TMV), Tobacco Rattle Virus (TRV), and the like are most commonly used. Among them, the Tobacco Rattle Virus (TRV) gene silencing vector has the advantages of small molecular weight, convenient insertion of foreign sequences, high infection efficiency, light virus infection symptoms, high silencing efficiency, and the like, and has been widely used in plants such as arabidopsis thaliana, tomato, and the like.

The mechanism of RNA viral vector-mediated gene silencing is: after the recombinant viral vector carrying the target gene enters the plant cell nucleus, the RNA viral vector forms a large amount of transcription product dsRNA under the action of RNA polymerase (RdRp); these newly synthesized dsRNAs are cleaved enzymatically to form small interfering RNAs (siRNAs) of 21-25 nucleotides; the antisense strand of the siRNA is activated by binding to the RNA-induced silencing complex RISC; RISC with siRNA specifically binds with RNA sequence highly homologous with siRNA, then take mRNA of the target gene as template, siRNA as primer, synthesize dsRNA under the action of RNA polymerase, present cascade amplification effect, thus cause mRNA of the target gene can not exert messenger function. The VIGS gene silencing technology is simple and convenient to operate, can directly concern the researched gene by identifying the phenotype of the specific gene function deletion of the current plant, thereby greatly shortening the time required for verifying the gene function, and particularly has great advantages in the gene function research of the plant with difficult genetic transformation operation or long growth period.

Phytoene desaturase, which is located upstream of the carotenoid biosynthetic pathway, is one of the key rate-limiting enzymes in this metabolic pathway, affecting both the synthesis rate and the product level of the entire metabolic pathway. The enzyme is prepared fromPDSThe gene codes, and the gene is cloned and identified in various algae and higher plants at present. The research shows that the gene exists in a single copy form in a plant body, and the encoded protein is positioned on a thylakoid of chloroplast and is mainly expressed in leaves, flowers and fruits of the plant. When the gene isWhen the expression is blocked, the plant can generate a photobleaching phenomenon, and the phenotype is easy to observe by naked eyes, so the plant VIGS gene silencing system is generally usedPDSThe gene acts as a reporter to reflect the efficiency of silencing.

Disclosure of Invention

The invention aims to provide a ginseng PDS gene and application thereof.

The base sequence of the ginseng PDS gene is shown as a sequence table SEQ ID NO. 1.

A plant over-expression vector is inserted with a gene shown as a sequence table SEQ ID NO. 1.

The ginseng PDS gene is applied to the aspect of promoting the synthesis of plant leaf chlorophyll.

The invention provides a ginseng PDS gene, the base sequence of which is shown in a sequence table SEQ ID NO. 1; a plant over-expression vector, which is inserted with a gene shown as a sequence table SEQ ID NO. 1; the ginseng PDS gene is applied to the aspect of promoting the synthesis of plant leaf chlorophyll; the results of the invention provePgPDSGene silencing sequence of the gene can cause whitening of ginseng seedlings and fruits; in the overexpressionPgPDSThe chlorophyll content in the tobacco leaves of the gene is obviously increased; illustrative of the ginsengPDSThe overexpression of the gene can promote the synthesis of chlorophyll of leaves.

Drawings

FIG. 1: a TRV gene silencing vector;

FIG. 2:PgPDSgene full-length PCR amplification electrophoretogram; (M: DL2,000; lane 1: PCR product; lane 2: negative control);

FIG. 3:PgPDSgene partial sequence PCR amplification electrophoresis picture; (M: DL2,000; lane 1: PCR product; lane 2: negative control);

FIG. 4: PCR (polymerase chain reaction) verification electrophoretogram of PgPDS-pBI121 recombinant overexpression vector; (M: DL2,000; lanes 1-2: PCR product; lane 3: negative control);

FIG. 5: PgPDS-pBI121 recombinant vectorXbaI andSmai, double enzyme digestion verification of an electrophoretogram; (M: DL15,000; lane 1: proplasmid; lane 2: double restriction enzyme product of recombinant expression vector);

FIG. 6: PCR verification of the PgPDS-pTRV2 recombinant expression vector electrophoretogram; (M: DL2,000; lanes 1-5: PCR product; lane 6: negative control);

FIG. 7: PgPDS-pTRV2 recombinant vectorEcoRI andKpni, double enzyme digestion verification of an electrophoretogram; (M: DL15,000; lane 1: double cleaved product; lane 2:EcoRI single enzyme digestion products; lane 3:Kpni single enzyme digestion products);

FIG. 8: PCR of VIGS engineering bacteria liquid; (M: DL 2000; lanes 1-5: GV3101 containing pTRV2 plasmid, lane 6: negative control; lanes 7-11: GV3101 containing pTRV2: PgPDS plasmid, lane 12: negative control)

FIG. 9: overexpression of ginsengPgPDSDetecting the chlorophyll content in the tobacco leaves after gene generation;

FIG. 10:PgPDSVIGS silencing of genes in tobacco; (left: wild type plant; middle: pTRV2: PgPDS silenced plant; right: pTRV2:00 silenced plant);

FIG. 11: silencingPgPDSTobacco albino leaf of the gene was compared with wild type leaf; (left: wild type plant leaves; right: pTRV2: PgPDS silenced plant albino leaves;

FIG. 12: carrying out VIGS gene silencing of pTRV2 PgPDS by taking the ginseng embryo as an explant; (left: wild type plants; right: pTRV2: PgPDS silenced albino plants);

FIG. 13: VIGS silencing pTRV2 PgPDS in ginseng leafPgPDSRelative expression levels of the genes;

FIG. 14: VIGS silencingPgPDSDetecting the chlorophyll content in the genetically modified ginseng leaves;

FIG. 15: carrying out VIGS gene silencing of pTRV2 PgPDS by taking four-year-old ginseng leaves as explants; (A: wild type plants; B: pTRV2: post PgPDS silencing fruit albino plants).

Detailed Description

Example 1 Ginseng radixPDSCloning of genes

Material sources are as follows: jilin "big horse teeth" ginseng variety seed, purchased from Jilin province, Tonghua city; the four-year-old ginseng grows in a planting base of a research center for developing and utilizing ginseng gene resources in Jilin province; the tobacco variety is the original raw tobacco.

Ginseng, radix GinsengPDSScreening and identification of genes

Reported download of plants from NCBIPDSThe gene mRNA nucleic acid sequence is 460 in total, and is compared with Jilin ginseng transcriptome (p is less than or equal to 10)^-6) Obtaining 39 nucleic acid sequences, searching by NCBI online tool Conserved Domains Search, wherein only two transcripts in one gene have complete phytoene desaturase Conserved domain (PLN02612), searching by NCBI online tool ORF Finder and Blast comparison, the sequences of the two transcripts in the open reading frame are completely identical, and only 3' untranslated region is partially different, thus determining the gene as ginsengPgPDSA gene;

second, total RNA extraction and cDNA synthesis of ginseng

Extracting total RNA of 4-year-old ginseng leaves by using Tripure regent, and taking 1 mu g of total RNA to perform reverse transcription to obtain cDNA serving as a gene cloning template;

III,PgPDSCloning of genes

PgPDSThe gene length is 1,746 bp (581 aa), and the base sequence is shown in a sequence table SEQ ID NO. 1; based on the sequences obtained above, primers for amplifying the full length of the gene were designed using Primer Premier 5 software, and 5' ends of the primers were addedXbaI andSmai, enzyme digestion recognition site to obtain a primer:

PgPDS-F: GCTCTAGAATGTCTCAATTTGGCCAAGTCT

PgPDS-R: TCCCGGGTTAGACAACGCTTGCCTCAGC

simultaneously designing a primer (479-EcoRI andKpni, enzyme digestion recognition site to obtain a primer:

PgPDS(partial)-F: CGGAATTCGACTGGCTTACACATTTTCTTTGG

PgPDS(partial)-R: GGGGTACCGAAGAAATCGGTTCAAAGCAATC

utilize the abovePgPDSThe gene primer is obtained by performing PCR amplification by using 4-year-old ginseng leaf cDNA as a templatePgPDSThe full-length gene (FIG. 2) and the amplification product of 443bp partial sequence (FIG. 3); the above-mentionedIs/are as followsPgPDSThe base sequence of 443bp partial sequence of the gene is shown in a sequence table SEQ ID NO. 2;

and carrying out agarose gel electrophoresis on the amplification products, carrying out agarose gel recovery on the target band, connecting the recovery products to a T vector, and transferring the T vector into escherichia coli DH5 alpha competent cells by using a heat shock method. The competent cells containing the recombinant cloning vector plasmid were screened on a resistant plate containing 100 mg/L ampicillin, resistant monoclonals were picked and shaken for PCR of the bacterial solution, and PCR positive monoclonals were taken and sent to sequencing company for sequencing. The result obtained by sequencing is completely consistent with the original sequence,PgPDSthe gene cloning was successful.

Example 2PgPDSConstruction of Gene overexpression vector

Extracting the recombinant plasmid and the overexpression vector pBI121 plasmid from the colibacillus monoclonal containing the target gene full length with correct sequencing result, and utilizing restriction endonucleaseXbaI andSmai, carrying out double enzyme digestion, and recovering enzyme digested productPgPDSThe gene fragment and the expression vector contain functional element fragments, and are connected by T4 ligase. The upper recombinant expression vector after connection is transferred into escherichia coli DH5 alpha competent cells by a hot shock method, a resistant plate containing 50 mg/L kanamycin is used for screening, resistant monoclonals are picked and shaken, and then bacteria liquid PCR identification (figure 4) and double enzyme digestion verification (figure 5) are carried out. The result shows that the target stripe size is consistent withPgPDSGene length, which indicates that the construction of the recombinant over-expression vector is successful; the recombinant expression vector is transferred into agrobacterium GV3101 competent cells by a hot shock method, and positive clones containing the recombinant expression vector are selected by PCR and stored for later use.

Example 3PgPDSOverexpression of genes in tobacco

(1) Soaking tobacco seeds, then vernalizing the soaked tobacco seeds in an environment at 4 ℃ for 24 hours, sowing the tobacco seeds in a seedling tray, and placing the seedling tray in an artificial climate room for daily culture;

(2) the GV3101 Agrobacterium containing PgPDS-pBI121 and pBI121 plasmids was activated on LB plate medium containing 50. mu.g/mL kanamycin and 30. mu.g/mL rifampicin, and on liquid LB medium containing the above antibiotics, 10 mM MES and 20. mu.M ASCulturing overnight to OD₆₀₀=0.4-0.6, using a catalyst containing 10 mM MES, 20. mu. MAS and 10 mM MgCl₂The centrifuged thallus is resuspended by the sterile water, and the resuspended bacteria liquid is activated for 3 hours at normal temperature for genetic transformation;

(3) pricking a small hole on the back of the mature tobacco leaf by using a sterile syringe needle, slightly pressing the syringe which is absorbed with the invaded dye solution at the small hole, slightly propping the syringe hole with the front of the leaf through the leaf by using a finger belly, and slowly injecting the heavy suspension to diffuse in the leaf;

(4) culturing the infected plant in the dark for 1 day, and then transferring to a normal illumination period for continuous culture;

(5) 10 days after transformation, respectively taking wild tobacco leaves and performing overexpressionPgPDSPutting the tobacco leaves after gene treatment into a centrifuge tube, adding DMF into the centrifuge tube, and standing at 4 ℃ for overnight extraction; measuring OD of the above extractive solution with enzyme-labeling instrument_663.8And OD_646.8The absorbance and the formula are used for calculating the chlorophyll content; the results are shown in FIG. 9, in overexpressionPgPDSChlorophyll in the leaves of transgenic tobaccoaChlorophyll, chlorophyllbAnd chlorophylla+bThe content of (A) is remarkably increased; the above results illustrate that Ginseng radixPDSThe overexpression of the gene can promote the synthesis of chlorophyll of tobacco leaves.

Example 4PgPDSConstruction of Gene (443 bp) VIGS Gene silencing vector

Extracting recombinant cloning vector plasmid and VIGS gene silencing expression vector pTRV2 plasmid from Escherichia coli monoclonal containing target gene partial sequence with correct sequencing result, and using restriction endonucleaseEcoRI andKpni, carrying out double enzyme digestion, and recovering enzyme digested productPgPDSThe gene fragment and the expression vector contain functional element fragments, and are connected by T4 ligase. The ligated recombinant expression vector was transferred into E.coli DH 5. alpha. competent cells by hot shock, and screened using a resistant plate containing 50 mg/L kanamycin, and after the resistant monoclonal was picked up and amplified, PCR identification of the bacterial suspension (FIG. 6) and double restriction enzyme digestion verification (FIG. 7) were performed. The result shows that the target stripe size is consistent withPgPDSLength of partial sequence of gene, descriptionSuccessfully constructing the VIGS recombinant expression vector; the recombinant expression vector was transferred into competent cells of Agrobacterium GV3101 by hot shock, and positive clones containing the recombinant expression vector were selected by PCR (FIG. 8) and stored for future use.

Example 5PgPDSVIGS Gene silencing in tobacco

(1) Soaking tobacco seeds, then vernalizing the soaked tobacco seeds in an environment at 4 ℃ for 24 hours, sowing the tobacco seeds in a seedling tray, and placing the seedling tray in an artificial climate chamber for daily culture until the tobacco seeds are six-leaf old;

(2) the Agrobacterium GV3101, containing PgPDS-pTRV2, pTRV1, pTRV2 plasmids, was activated on LB plate medium containing 50. mu.g/mL kanamycin, 50. mu.g/mL gentamicin and 30. mu.g/mL rifampicin and cultured overnight to OD in liquid LB medium containing the above antibiotics, 10 mM MES and 20. mu.M AS₆₀₀=0.4-0.6, using a catalyst containing 10 mM MES, 20. mu. MAS and 10 mM MgCl₂Resuspending the centrifuged cells with sterile water, activating the resuspended cells at normal temperature for 3-24 h, mixing the resuspended cells containing PgPDS-pTRV2 and pTRV2 plasmids with the resuspended cell containing pTRV1 plasmid 1: 1 volume ratio is mixed and configured into a staining solution for genetic transformation;

(3) pricking small holes on the back of the leaves of the 3 rd, 4 th, 5 th and 6 th leaves of the tobacco by using a sterile syringe needle, slightly pressing the syringe which absorbs the invaded staining solution at the small holes, slightly propping the syringe holes by the finger pulp on the front surfaces of the leaves through the leaves, and slowly injecting the heavy suspension to diffuse the heavy suspension in the leaves;

(4) culturing the infected plant in the dark for 1 day, and then transferring to a normal illumination period for continuous culture;

(5) about 20 days after transformation, the 9 th leaf blade and the 12 th leaf blade of the tobacco plant which is transformed with pTRV2: PgPDS obviously show whitening phenotype (figure 10), the comparison graph of the leaf blade and a negative control leaf blade is shown in figure 11, the transformation rate is counted according to the whitening phenotype of the leaf blade, and the ginsengPgPDSGene pair bensheng cigarettePDSThe success rate of gene silencing is about 80%.

Example 6PgPDSVIGS gene silencing of genes in ginseng seedlings

(1) Taking cracked ginseng seeds, removing seed shells, placing under running water to flush sand, sterilizing with 75% alcohol for 1min under aseptic condition, sterilizing with 5% sodium hypochlorite for 10 min, rinsing with sterile water, cutting endosperm, taking out ginseng embryo, and placing in 1/2MS culture medium;

(2) prepared as abovePgPDSPlacing the ginseng embryo in the staining solution for shaking infection for 10 min, taking out, sucking the bacterial liquid with sterile filter paper, and placing in 1/2MS culture medium for 16h light/8 h dark culture. About 20 days after infection, the leaves of the ginseng seedlings begin to have a whitening phenotype, and the comparison of the leaves with wild plants is shown in figure 12, so that not only are the leaves completely whitened, but also the leaf stalks have a greenish phenotype;

(3) separately extracting wild ginseng leaf and silencingPgPDSThe RNA in the ginseng leaf after gene is reverse transcribed into cDNAPgPDSFluorescent quantitative PCR primers for the genes:

PgPDS-Q-F: GTGGACAGGCGTATGTTGAG

PgPDS-Q-R: CTGGGTTGATGAAGTTTAATGAC；

the cDNA was subjected to fluorescent quantitative PCR reaction, and the results are shown in FIG. 13, where the cDNA was silentPgPDSIn the whitening leaf of the ginseng with the gene,PgPDSthe expression level of the gene is extremely reduced, which indicates that the VIGS system is applied to ginsengPgPDSThe silencing of the gene is successful;

(4) respectively taking wild ginseng leaf and silencingPgPDSPlacing the ginseng leaves after gene treatment in a centrifuge tube, adding DMF into the centrifuge tube, and standing at 4 ℃ for overnight extraction; measuring OD of the above extractive solution with enzyme-labeling instrument_663.8And OD_646.8The absorbance and the formula are used for calculating the chlorophyll content; the results are shown in FIG. 14, after silencingPgPDSChlorophyll in albino leaf of ginsengaChlorophyll, chlorophyllbAnd chlorophylla+bAll the contents of the active ingredients are reduced very remarkably, in particular to chlorophyllbThe content is reduced by about 75 percent; the above results illustrate that Ginseng radixPDSThe gene silencing can obviously inhibit the synthesis of chlorophyll in the ginseng leaves.

Example 7PgPDSVIGS Gene silencing in Ginseng fruit

(1) Prepared as abovePgPDSGene sinkThe silent infection liquid is used for injecting and infecting the four-year-old ginseng leaves in the flowering phase by using a leaf injection method for infecting tobacco through VIGS (viral infection of protein coding gene) 2 of PDS genes;

(2) after 100 days of infection, immature fruits of infected plants showed albino phenotype (FIG. 15), indicating that leaves were subjected to flowering stage of ginsengPgPDSVIGS injection infection of the gene can inhibit chlorophyll synthesis in ginseng fruits.

Sequence listing

<110> Jilin university of agriculture

<120> ginseng PDS gene and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>2

<211>1746

<212>DNA

<213> Ginseng radix (Panax ginseng C.A. Mey)

<400>2

atgtctcaat ttggccaagt ctctgcagtc aatttgagca ggcaaagtaa tgtaataaac 60

ttttggaact cccaatctaa ttgggactgt ggtgttcaaa gcggttcacg gcagagaaat 120

gcactattca gaggttgtta ttttatgggt caaagggtga aaatacctat tgcggatgct 180

ctgataacaa gatcaagaaa aaatgtgcac cggttggagg tggtttgcat tgactatcca 240

agaccagaga ttgataatac agttcctttc ttagaagctg cttacttatc ttcatccttt 300

cgtactgctc cccgcccaaa taagccactg gaaatcgtaa ttgctggtgc agggttggct 360

ggtttatcta ctgcaaaata tttggctgat gcaggtcaca agcccatatt gttggaagca 420

agagatgttc ttggtgggaa ggtggctgct tggaaagatg atgatggaga ctggtatgag 480

actggcttac acattttctt tggggcttac ccgaatgttc agaacctgtt tggagaacta 540

ggcattaatg atcgattgca gtggaaggag cattctatga tatttgcgat gccaaataag 600

ccaggggaat ttagccgatt tgattttcct gaagttctac ctgcaccgtt aaatgggatt 660

tgggctatct tgaagaataa tgaaatgctt acatggcctg agaaagtcaa gtttgcactg 720

ggactcttgc cagcaattat cggtggacag gcgtatgttg aggctcaaga tggtttaagt 780

gtcaaagatt ggatgagaaa gcaaggtata ccagatcggg ttactactga ggtttttgtt 840

gccatgtcga agtcattaaa cttcatcaac ccagatgaac tttcaatgca atgtgttttg 900

attgctttga accgatttct tcaggagaag catggttcaa agatggcttt cttagatgga 960

agccctccag aaagactctg catgcctatt gctgatcata ttcagtcact gggtggtgaa 1020

gtccggctta attcacgggt acagaagatc gagctaaata acgatggaac tgtcaagagt 1080

ttactactaa ctaatgggaa tgtaattgaa gctgatgcat atgtaattgc tgctccagtt 1140

gatatcctga agctcctttt acctgaagac tggaaggaga tcccatattt caggaaattg 1200

gataaattag ttggggtccc agttatcaat gttcatatat ggtttgacag gaaactgaag 1260

aacacatatg atcatctact tttcagcaga agctcccttc ttagtgtata tgctgatatg 1320

tctgtgacat gtaaggaata ttataaccca aatcaatcca tgttggagtt ggtttttgca 1380

cctgcagaag aatggatttc acgaagtgac atcgatatta ttgatgctac attgagtgaa 1440

ctggcaagac tctttcctga tgagattgcc acggatcaga gtaaagcaaa gatattgaag 1500

tatcatgttg ttaaaacacc aaggtctgtt tataaaactg taccaggctg tgaaccctgc 1560

cgtcccttgc aaaaatctcc catagaggga ttctatctag ccggcgatta cacaaaacag 1620

aagtatttgg cttcaatgga gggtgctgtg ctctcaggaa agctttgtgc acaaactatt 1680

ttacaggatt atgaggttct tgtttccagg gagcagaaga tgcttgctga ggcaagcgtt 1740

gtctaa 1746

<210>2

<211>443

<212>DNA

<213> Ginseng radix (Panax ginseng C.A. Mey)

<400>2

gactggctta cacattttct ttggggctta cccgaatgtt cagaacctgt ttggagaact 60

aggcattaat gatcgattgc agtggaagga gcattctatg atatttgcga tgccaaataa 120

gccaggggaa tttagccgat ttgattttcc tgaagttcta cctgcaccgt taaatgggat 180

ttgggctatc ttgaagaata atgaaatgct tacatggcct gagaaagtca agtttgcact 240

gggactcttg ccagcaatta tcggtggaca ggcgtatgtt gaggctcaag atggtttaag 300

tgtcaaagat tggatgagaa agcaaggtat accagatcgg gttactactg aggtttttgt 360

tgccatgtcg aagtcattaa acttcatcaa cccagatgaa ctttcaatgc aatgtgtttt 420

gattgctttg aaccgatttc ttc 443

Claims (4)

1. The base sequence of the ginseng PDS gene is shown as a sequence table SEQ ID NO. 1.

2. A plant over-expression vector is inserted with a gene shown as a sequence table SEQ ID NO. 1.

3. The use of the ginseng PDS gene of claim 1 to promote the synthesis of chlorophyll in plant leaves.

4. Use according to claim 3, characterized in that: the plant is ginseng or tobacco.

Images